ID: 922226238

View in Genome Browser
Species Human (GRCh38)
Location 1:223648283-223648305
Sequence ACAGCTCCATGTGGCCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1384
Summary {0: 1, 1: 1, 2: 6, 3: 136, 4: 1240}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922226238_922226244 4 Left 922226238 1:223648283-223648305 CCCCCTGGGCCACATGGAGCTGT 0: 1
1: 1
2: 6
3: 136
4: 1240
Right 922226244 1:223648310-223648332 TGCAGTTTTTCCCACCTCGGAGG 0: 1
1: 0
2: 1
3: 3
4: 88
922226238_922226243 1 Left 922226238 1:223648283-223648305 CCCCCTGGGCCACATGGAGCTGT 0: 1
1: 1
2: 6
3: 136
4: 1240
Right 922226243 1:223648307-223648329 ATCTGCAGTTTTTCCCACCTCGG 0: 1
1: 0
2: 3
3: 16
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922226238 Original CRISPR ACAGCTCCATGTGGCCCAGG GGG (reversed) Intronic