ID: 922228946

View in Genome Browser
Species Human (GRCh38)
Location 1:223668872-223668894
Sequence CCTTCCTCATCGAGGCTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922228933_922228946 30 Left 922228933 1:223668819-223668841 CCCCACCTGCCTGAATTACCTCG No data
Right 922228946 1:223668872-223668894 CCTTCCTCATCGAGGCTGGCAGG No data
922228937_922228946 21 Left 922228937 1:223668828-223668850 CCTGAATTACCTCGCTCCCACAT No data
Right 922228946 1:223668872-223668894 CCTTCCTCATCGAGGCTGGCAGG No data
922228940_922228946 4 Left 922228940 1:223668845-223668867 CCACATCCAGATGCTGTGCAAAC No data
Right 922228946 1:223668872-223668894 CCTTCCTCATCGAGGCTGGCAGG No data
922228939_922228946 5 Left 922228939 1:223668844-223668866 CCCACATCCAGATGCTGTGCAAA No data
Right 922228946 1:223668872-223668894 CCTTCCTCATCGAGGCTGGCAGG No data
922228935_922228946 28 Left 922228935 1:223668821-223668843 CCACCTGCCTGAATTACCTCGCT No data
Right 922228946 1:223668872-223668894 CCTTCCTCATCGAGGCTGGCAGG No data
922228934_922228946 29 Left 922228934 1:223668820-223668842 CCCACCTGCCTGAATTACCTCGC No data
Right 922228946 1:223668872-223668894 CCTTCCTCATCGAGGCTGGCAGG No data
922228938_922228946 12 Left 922228938 1:223668837-223668859 CCTCGCTCCCACATCCAGATGCT No data
Right 922228946 1:223668872-223668894 CCTTCCTCATCGAGGCTGGCAGG No data
922228936_922228946 25 Left 922228936 1:223668824-223668846 CCTGCCTGAATTACCTCGCTCCC No data
Right 922228946 1:223668872-223668894 CCTTCCTCATCGAGGCTGGCAGG No data
922228941_922228946 -2 Left 922228941 1:223668851-223668873 CCAGATGCTGTGCAAACAAACCC No data
Right 922228946 1:223668872-223668894 CCTTCCTCATCGAGGCTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922228946 Original CRISPR CCTTCCTCATCGAGGCTGGC AGG Intergenic
No off target data available for this crispr