ID: 922233365

View in Genome Browser
Species Human (GRCh38)
Location 1:223705013-223705035
Sequence GTGGATGAACTGGGGGAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 219}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922233365_922233373 2 Left 922233365 1:223705013-223705035 CCATACTCCCCCAGTTCATCCAC 0: 1
1: 0
2: 3
3: 15
4: 219
Right 922233373 1:223705038-223705060 AAGGATTAATAGCTCACTCAGGG 0: 1
1: 0
2: 1
3: 13
4: 155
922233365_922233372 1 Left 922233365 1:223705013-223705035 CCATACTCCCCCAGTTCATCCAC 0: 1
1: 0
2: 3
3: 15
4: 219
Right 922233372 1:223705037-223705059 AAAGGATTAATAGCTCACTCAGG 0: 1
1: 0
2: 1
3: 12
4: 108
922233365_922233376 21 Left 922233365 1:223705013-223705035 CCATACTCCCCCAGTTCATCCAC 0: 1
1: 0
2: 3
3: 15
4: 219
Right 922233376 1:223705057-223705079 AGGGGAGGCTTCCTGCCCCTCGG 0: 1
1: 0
2: 1
3: 25
4: 269
922233365_922233374 3 Left 922233365 1:223705013-223705035 CCATACTCCCCCAGTTCATCCAC 0: 1
1: 0
2: 3
3: 15
4: 219
Right 922233374 1:223705039-223705061 AGGATTAATAGCTCACTCAGGGG 0: 1
1: 0
2: 0
3: 12
4: 107
922233365_922233375 6 Left 922233365 1:223705013-223705035 CCATACTCCCCCAGTTCATCCAC 0: 1
1: 0
2: 3
3: 15
4: 219
Right 922233375 1:223705042-223705064 ATTAATAGCTCACTCAGGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922233365 Original CRISPR GTGGATGAACTGGGGGAGTA TGG (reversed) Intronic
900078233 1:835127-835149 GTGGGTGAACAGGGGGTGGAGGG - Intergenic
900988946 1:6089131-6089153 GTGGGTTAACTGGGGGGGTCGGG - Intronic
901587778 1:10312575-10312597 GTGGATGGAATGGCAGAGTAGGG - Intronic
902594618 1:17500450-17500472 GTGGATGACTTTGGGAAGTATGG + Intergenic
902689658 1:18102352-18102374 GTGGATGAACTGGGGAGGCTGGG + Intergenic
903359835 1:22769942-22769964 GTGGATAAATTGGTGGTGTAAGG + Intronic
904209832 1:28879667-28879689 GTGGATGAGCAGGGGGAGGTGGG + Intergenic
904771644 1:32884495-32884517 GAGGCTGAACTGGGGAAGTGGGG + Intergenic
906248078 1:44291028-44291050 GAGGATGCAGTGGGGGAGGAAGG - Intronic
906716879 1:47976793-47976815 GTGTATGAACTGAGGGTGTTGGG + Intronic
906907436 1:49911161-49911183 GTGGATGGAATGTGGGAGTGGGG + Intronic
908362221 1:63380372-63380394 GTGGCTGAAGTGGGGGAAGAAGG + Intronic
913386333 1:118261899-118261921 GTGCATGAACTGGGGAAGGGGGG - Intergenic
915136313 1:153734031-153734053 GCAGATGAAATGGGGGAGAAAGG - Intronic
917672320 1:177284451-177284473 GTGGAAGAAGAGGGGGTGTAAGG + Intergenic
921324962 1:213980453-213980475 GTGGGTGAGTTGGGGGAGAACGG - Intergenic
921374040 1:214455010-214455032 GAGGAAGAACGGGAGGAGTAGGG - Intronic
921812374 1:219529515-219529537 GTGGAAGAACTGAAGGAGTTAGG - Intergenic
922206878 1:223455808-223455830 GTGGTGGAGCTGGGAGAGTAGGG - Intergenic
922233365 1:223705013-223705035 GTGGATGAACTGGGGGAGTATGG - Intronic
922414014 1:225403856-225403878 CTGGGGGAACTGGGGGAGCAGGG - Intronic
922414032 1:225403901-225403923 CTGGGGGAACTGGGGGAGCAGGG - Intronic
922674912 1:227544079-227544101 GGGGCTGAGCTGGGGGAGTCAGG - Intergenic
1063662198 10:8042721-8042743 GGGGAGGAAGTGGGGGAGGAAGG - Intergenic
1066184403 10:32995130-32995152 GTGGAGGAAATGCGGGAGTGTGG + Intronic
1066997630 10:42578360-42578382 GAGGATGAAGAGGAGGAGTAGGG - Intronic
1067370004 10:45673744-45673766 GAGCATACACTGGGGGAGTATGG + Intergenic
1068842299 10:61629433-61629455 GTGGGTGAAGTGGTGGAGTGTGG - Intergenic
1071218343 10:83433505-83433527 GCAGATGAACTGGGAGAGAAGGG - Intergenic
1072043275 10:91629950-91629972 GTGGCAGAGCTGGGGGAGAATGG - Exonic
1074969454 10:118523814-118523836 CTGGATAAATTGGAGGAGTATGG - Intergenic
1076706403 10:132304332-132304354 GTGGGTGAACTGGGGGGGTTTGG - Intronic
1078525826 11:12100596-12100618 GAGCATGAACTGGGGCAATAAGG + Intronic
1080335064 11:31186242-31186264 GTGGAGGAACAAGGAGAGTATGG - Intronic
1081891706 11:46548245-46548267 GTGGATGAAATGGGAGGGCAAGG - Exonic
1083707490 11:64526308-64526330 GTGGATGAAGGGTGGGAGGAGGG - Intergenic
1083839961 11:65298775-65298797 GTGGAGGAGCTGGGGGAGAACGG - Intronic
1089741254 11:120586166-120586188 GTGGAGTACATGGGGGAGTAGGG + Intronic
1089769881 11:120795228-120795250 CTGGAAGAACTGAGGGATTAAGG + Intronic
1090827806 11:130400220-130400242 GGGGATGAGCTGGAGGAGCATGG + Intergenic
1091768102 12:3134964-3134986 GTGGAGGACATGGGGGAGTAGGG + Intronic
1096901703 12:54889710-54889732 GTGGATAAAATTGGGGATTAGGG + Intergenic
1097707227 12:62880818-62880840 GTGGATCATCTGGGGTAGCAGGG - Intronic
1098549829 12:71750897-71750919 GTGCAAGAACAGGGGGAGAAAGG + Intergenic
1101022606 12:100568563-100568585 ATAGATGAACTGGGGGAGTAGGG + Intergenic
1102396016 12:112586439-112586461 CTGGATGCAGTGAGGGAGTAAGG + Intronic
1102419844 12:112794842-112794864 CAGGCTGGACTGGGGGAGTAGGG - Intronic
1105304926 13:19161594-19161616 CTGGAGGAGGTGGGGGAGTAGGG + Intergenic
1105503548 13:20991758-20991780 GGGGAAGAACTGTGGGAGTCAGG + Intronic
1107046666 13:36000118-36000140 ATGGAAGAACTGAGGGAATAGGG - Intronic
1108703263 13:52961775-52961797 GTGGATGAACTGGAGGGGAGAGG + Intergenic
1109491995 13:63114081-63114103 GAGGATTAACTGGGGGACAAAGG - Intergenic
1111436949 13:88223694-88223716 GTTGAAGAACTGGAGGAGTTAGG + Intergenic
1112248258 13:97754171-97754193 GTGGAAAGACTGGGGGAGGAAGG - Intergenic
1112923287 13:104641750-104641772 GTGTATGAAGTGGGAGAATAAGG + Intergenic
1115849860 14:37583088-37583110 GGGGGTGAAGAGGGGGAGTAAGG + Intergenic
1121504760 14:94468366-94468388 GTGGATGAAGGGAGGGAGGAAGG + Intronic
1121835545 14:97088867-97088889 GAGGATGACCTGGAGGAGGAAGG + Intergenic
1122956090 14:105072068-105072090 GTGGATGGACGGCGGGAGTGTGG - Intergenic
1123055480 14:105567335-105567357 GTGGATGAGCTGGAGGTGTGAGG + Intergenic
1123079931 14:105687175-105687197 GTGGATGAGCTGGAGGTGTGCGG + Intergenic
1124639868 15:31391089-31391111 GTGGATAATGTGGGGGAGTGTGG + Intronic
1125305729 15:38310525-38310547 GTGGATCAACTTGGGGAGAATGG + Intronic
1126305830 15:47256284-47256306 GTAGATCAACTTAGGGAGTATGG + Intronic
1129615524 15:77096595-77096617 GTGCATGAACTGGGGGCGAATGG + Intergenic
1131585824 15:93691699-93691721 GAGGATTAACTGAGGGAGGAGGG + Intergenic
1131985379 15:98038467-98038489 GTGGATGCAATGTGGGAGAAGGG + Intergenic
1133214220 16:4281539-4281561 GTGAATGAACTGTGGGTGTGCGG - Intergenic
1133843207 16:9428942-9428964 GCAGATGAACTGGGGGAGAAGGG + Intergenic
1134617665 16:15664115-15664137 GTGGAGGGAGTGGGGGAGTGGGG - Intronic
1135658302 16:24270979-24271001 GTGGCTGAAATGGGGGAGTGAGG + Intronic
1136032837 16:27516032-27516054 GTGGATGCACTTGGCCAGTAGGG + Intronic
1137362534 16:47832044-47832066 GTGGCAGAACAGGGTGAGTAAGG + Intergenic
1137389865 16:48072416-48072438 GTGGATGCACTGGAGGAGTAAGG - Intergenic
1138108704 16:54306158-54306180 GTGGCTGAACTGGGGGGATATGG + Intergenic
1138434378 16:56989127-56989149 CAGGATGAACTAGGGGAGAAGGG - Intergenic
1141506723 16:84482878-84482900 GTGGATGAGCTGGGGATGCAGGG + Intronic
1142174761 16:88640008-88640030 GTGGATGAACTCGGTGTGGAAGG - Exonic
1145823977 17:27862681-27862703 GCAGATGGACTGGGGGAGGAGGG + Intronic
1147032294 17:37649131-37649153 GTGTAGGAAGTGAGGGAGTAAGG + Intergenic
1148126798 17:45241487-45241509 GTGGAGGAGCTGGAGGAGAAGGG + Exonic
1149771888 17:59328965-59328987 GTTGATGAACTGGGGGATGGCGG + Intergenic
1152678140 17:81651948-81651970 GTGCGTGCCCTGGGGGAGTACGG + Intronic
1153978566 18:10290498-10290520 GTGGAAGAACAGGGGGAGGGAGG + Intergenic
1155089130 18:22489076-22489098 GTGAATGAACTTGGGGACAAAGG + Intergenic
1160480274 18:79233643-79233665 GTTGATGAACAGGAGGAATAGGG + Intronic
1160775153 19:852174-852196 GTTGATGAAAAGGGGGAGAAGGG - Intronic
1160967448 19:1752964-1752986 GTGGAGGAAGTGGGGGAAAAGGG - Exonic
1161507121 19:4650047-4650069 GTGGAAGAACTGGCGGAGGAGGG - Intronic
1161741605 19:6024334-6024356 GTAGATGAACTCAGGGAGAAGGG - Intronic
1161888829 19:7019135-7019157 GTGGATGAAGTGCAGGAGGAGGG - Intergenic
1163402897 19:17105036-17105058 AGGGATGAACAGGGGGAGCATGG - Intronic
1163683405 19:18696703-18696725 GTGCATGTACTGGGGGAGTGGGG + Intronic
1164039793 19:21484124-21484146 GAGGATGACCTGGGTGAGTCCGG - Intronic
1165380472 19:35476044-35476066 CTGGATGAAGTGAGGGAGCAAGG + Intergenic
1165420837 19:35721204-35721226 GTGGAGGGGCTGGGGGAGGAGGG - Exonic
1167580125 19:50336545-50336567 CTGGATGTACTGGTGGAGCAGGG - Intronic
1167583643 19:50360980-50361002 ATGGATGTACTGGTGGAGCAGGG - Exonic
925611289 2:5705521-5705543 GTGGAGGAGCTAGGGGAGTAGGG + Intergenic
925741664 2:7010234-7010256 GTGGAGGCACTGGGAGAGAAAGG + Intronic
925930516 2:8703636-8703658 GCAGATGAACTGGGAGAGAAGGG + Intergenic
926049837 2:9737666-9737688 TGGGAGGTACTGGGGGAGTAGGG - Intergenic
931440445 2:62286786-62286808 GTGGATGAAGTGGGGGAGGAGGG - Intergenic
932573291 2:72949651-72949673 GAGGATGGACTGGAGGGGTAAGG + Intronic
932757382 2:74417885-74417907 GTGGGTGGACGGGGGGAGGAGGG + Intronic
934092956 2:88570350-88570372 CTGGAAGAGCTGGGGGAGCAGGG - Intronic
935511523 2:103981970-103981992 GTGGAGTAAGTGGGGAAGTATGG + Intergenic
937071369 2:119066208-119066230 GGGAATGAACTGTTGGAGTAGGG - Intergenic
937325021 2:120985229-120985251 GTGGGTGGGCTGGGGGAGTGAGG + Intronic
938462809 2:131509039-131509061 CTGGAGGAGGTGGGGGAGTAGGG - Intergenic
939098938 2:137872184-137872206 GCAGATGAACTGGGAGAGAAGGG + Intergenic
939462901 2:142519619-142519641 GAGGAGGAATTGGGGGAGGAGGG + Intergenic
940216350 2:151307564-151307586 GTGGATTAAGAGGGGGAGCAGGG - Intergenic
941897209 2:170641181-170641203 GTGAATAAACTGGGAGGGTAGGG + Intronic
942250899 2:174047018-174047040 GTGGCTGGACTGGGGGTGTTTGG + Intergenic
943248586 2:185487244-185487266 GTAGGGGAACTGTGGGAGTAAGG + Intergenic
943682904 2:190786487-190786509 GGGCATGATCTGGGGGAGCAAGG - Intergenic
944882149 2:204024279-204024301 GAGTATGAAGTGGGGGAGGAGGG + Intergenic
945250847 2:207765786-207765808 GTGCTTGAACTGGGGGAGGGAGG - Exonic
947944717 2:234091740-234091762 GTGAATAAACTGGAGGAGGAGGG + Intergenic
1171210088 20:23310295-23310317 GTGGATGAGCTGAAGGAGAAAGG - Intergenic
1176702391 21:10071321-10071343 CTGGTCGAACTGGGAGAGTATGG - Intergenic
1177608036 21:23407767-23407789 GTGGGTGAACGGGTGGAGGAAGG - Intergenic
1180061727 21:45388725-45388747 GTGGATGAACCTGGGGACTGTGG - Intergenic
1180608993 22:17083936-17083958 GTGGATGCACTAGGGCAGGACGG + Intergenic
1180691466 22:17720006-17720028 GGGGATGAAAAGGGGGAGAATGG + Intronic
1180726600 22:17951130-17951152 GTGGAGGAACTTGTTGAGTAAGG - Intronic
1181295504 22:21835201-21835223 GAGGCTGAACTGAGGGAGGAAGG + Intronic
1181785361 22:25222653-25222675 GGGAATGAACTGGGTGAGTTTGG + Intronic
1182432895 22:30311006-30311028 GTGGATGTGCAGGGGGAGCATGG + Intronic
1182624903 22:31638445-31638467 GGGGATGAAGTGGGGAAGTGGGG + Intronic
1183428982 22:37754520-37754542 GGTGATGATCTGGGGGAATATGG + Intronic
1183655531 22:39182516-39182538 TTGGATGAACTGGGGGTATGAGG + Intergenic
1185344202 22:50304304-50304326 GTGGATCCACTGGGGGGGTGCGG + Intronic
950287920 3:11759605-11759627 GTGGAGGAACTGGGGTAGGGTGG - Intergenic
951719468 3:25682784-25682806 GTAGATCAATTTGGGGAGTATGG - Intergenic
953411800 3:42694628-42694650 CATGATGAACTGGGGGAGCATGG - Intronic
953921987 3:46958510-46958532 GCAGATGAACTGGGAGAGAAGGG - Intronic
954369924 3:50164893-50164915 GAGGATTAACTGTGTGAGTATGG + Intronic
955020045 3:55111082-55111104 GATGATGAACTGGGGGCCTAGGG - Intergenic
955176676 3:56621237-56621259 GGGGGTGGACTGGGGGAGAAGGG + Intronic
956874056 3:73444682-73444704 GTGGAGGTAGTGGTGGAGTAAGG + Intronic
959564988 3:107825088-107825110 GGGGATGAACTGTGGCAGGATGG + Intergenic
959709130 3:109367396-109367418 GAGGAGCAACTGGGGGATTAAGG - Intergenic
960079872 3:113530053-113530075 GTGGGAGAGCTGGGGGAGGAAGG + Intergenic
964886590 3:161490701-161490723 GTGGATGAACTGGTGTAGAGAGG - Intergenic
966414277 3:179673041-179673063 GTGGGAGAGCTGGGGCAGTAGGG + Intronic
967100177 3:186209888-186209910 GAGGATTAGCTGGGGGAGTGGGG - Intronic
968091648 3:195901723-195901745 GGGGATAATCTGGGGTAGTAAGG - Intronic
970989420 4:22195140-22195162 GCAGATGAACTGGGGAAGAAGGG - Intergenic
974840073 4:67289163-67289185 GTGGAAGAATTGGGGGAGAAGGG + Intergenic
974907825 4:68079021-68079043 GTTGATGCATTGGGGGACTATGG - Intronic
975092402 4:70419482-70419504 GTAAATGACCTGGGGCAGTATGG + Intergenic
976327416 4:83787749-83787771 GAGGAAGAACTGGGGAAGGATGG + Intergenic
976688110 4:87838343-87838365 GTGGGTGTGGTGGGGGAGTAGGG - Intronic
977837085 4:101657669-101657691 GAGGATGAACATGGGGAGAAGGG - Intronic
978168577 4:105640333-105640355 GTAGATGAAGTGGAGGAGGAGGG - Intronic
980374564 4:131927735-131927757 CTGGTCGAACTGGGAGAGTATGG - Intergenic
983518039 4:168677811-168677833 CAGGATTAACTGGCGGAGTAGGG - Intronic
990248781 5:53891646-53891668 GTGGGTGATCTGGGGGAGAATGG - Intronic
992903100 5:81318621-81318643 GTAGATGAATTTGGGGAATATGG + Intergenic
993174861 5:84470878-84470900 ATGAATGGACTGGGGGAGTTTGG - Intergenic
996656322 5:125941063-125941085 GTGGAGGAACTTGGGGTATATGG + Intergenic
997397095 5:133570436-133570458 GTGGAAGAACTGGGAGGCTAAGG - Intronic
997729584 5:136157810-136157832 GAGCATGAACTGGGGGGGTTAGG + Intronic
997815068 5:137008867-137008889 GAGGCTAAACTGGGGGAGAAGGG + Intronic
998102914 5:139449166-139449188 GTGGAGCAGCTGGGGGAGGAAGG + Exonic
999117063 5:149173524-149173546 GTGGATGAGATGGGGCAGAAGGG + Intronic
999452896 5:151691658-151691680 GCTGATGTACTGGGGGTGTACGG - Intergenic
1001234723 5:170019923-170019945 GTAGATGCACTGGGGGAGAGAGG - Intronic
1001759486 5:174195425-174195447 TTCGATGAACTGGGGCAGTGAGG - Intronic
1002375279 5:178784379-178784401 GTGTATGAACTGGGAGTGTGGGG + Intergenic
1004205470 6:13587853-13587875 GAAGGTGAACTGGGGGAGGAAGG + Intronic
1006315753 6:33290550-33290572 TTGGAGGAACTGGAGGACTAGGG - Intronic
1007073596 6:39053269-39053291 GAGGATGAAATGGAGGAGTGGGG + Intronic
1007307127 6:40915791-40915813 GTGGATGACCTGGGAAAGTCAGG - Intergenic
1008591402 6:52996932-52996954 GCGAATGAATTGGGGTAGTAGGG + Intergenic
1011768336 6:90648716-90648738 TGGGAGGAACTGGGGAAGTAAGG + Intergenic
1013435596 6:110102125-110102147 GTGGAGGAGGTGGGGGAGTGGGG + Exonic
1016685753 6:146880471-146880493 GCAGATGAACTGGGGAAGAAGGG - Intergenic
1018322695 6:162629091-162629113 GTATATGAATTGGGGCAGTAGGG - Intronic
1018583917 6:165334966-165334988 GTGGATGCCCTGTGGGAGGACGG - Intronic
1019551817 7:1606884-1606906 GGGGAAGAACAGGGGGAGGAGGG - Intergenic
1026977044 7:74505387-74505409 GTGGGTGCACTTGGGGAGCATGG - Intronic
1027572356 7:79886000-79886022 GTAAATGAACTTGGGCAGTATGG - Intergenic
1029209288 7:98892671-98892693 GTGGAGGAAATGGGGGAAAAGGG - Intronic
1030886567 7:114945500-114945522 GTGGAAGACCTGGGGTATTATGG + Intronic
1033797593 7:144865914-144865936 GTAGATCAATTTGGGGAGTATGG + Intergenic
1034317466 7:150146337-150146359 GTGTTTGAACTGGGGAAATAAGG - Intergenic
1034775285 7:153820888-153820910 GTGTTTGAACTGGGGAAATAAGG + Intergenic
1035454158 7:158997985-158998007 GTGGATGAAGGTGGGGAGTGTGG - Intergenic
1035454245 7:158998238-158998260 GTGGATGAAGGTGGGGAGTGTGG - Intergenic
1035454262 7:158998289-158998311 GTGGATGAAGGTGGGGAGTGTGG - Intergenic
1035454299 7:158998391-158998413 GTGGATGAAGGTGGGGAGTGTGG - Intergenic
1035454336 7:158998495-158998517 GTGGATGAAGGTGGGGAGTGTGG - Intergenic
1035454369 7:158998598-158998620 GTGGATGAAGGTGGGGAGTGTGG - Intergenic
1035454404 7:158998699-158998721 GTGGATGAAGATGGGGAGTGTGG - Intergenic
1035454421 7:158998751-158998773 GTGGATGAAGGTGGGGAGTGTGG - Intergenic
1035454439 7:158998803-158998825 GTGGATGAAGGTGGGGAGTGTGG - Intergenic
1035454455 7:158998855-158998877 GTGGATGAAGGTGGGGAGTGTGG - Intergenic
1035527405 8:324616-324638 GTGGGTGAACAGGGGGTGGAGGG + Intergenic
1035958662 8:4112450-4112472 GTGGAAGAACCAGGGGAGAATGG - Intronic
1039957590 8:42219114-42219136 GTGGAAGCACTGGGGGTATAGGG + Intergenic
1041711228 8:60896333-60896355 GAGGCTGAACAGTGGGAGTATGG - Intergenic
1043445316 8:80313844-80313866 GAGGATGAAGTGGGAGAGGAGGG - Intergenic
1044519038 8:93176543-93176565 ATGGATGGGGTGGGGGAGTAGGG - Intergenic
1044695032 8:94914212-94914234 GTGGATAAACTTTGGGAATAAGG + Intronic
1047631259 8:126711166-126711188 ATGGAAGAACTGGGGGAGAAAGG - Intergenic
1048506456 8:135026506-135026528 GTGGTAGGACTGGGGGAGGAAGG + Intergenic
1048658033 8:136564330-136564352 GTGGATTAATTTGGGTAGTAAGG - Intergenic
1050546869 9:6716622-6716644 GTGGATGGCGTGGGGGAATAGGG + Intergenic
1052751051 9:32491110-32491132 GTGGAAGAACTAGGAGAGAATGG + Intronic
1053489699 9:38489258-38489280 GTGGATGAACCAGGAGAGTGGGG - Intergenic
1053766543 9:41407396-41407418 CTGGTCGAACTGGGAGAGTATGG + Intergenic
1054320341 9:63654377-63654399 CTGGTCGAACTGGGAGAGTATGG - Intergenic
1054545211 9:66318902-66318924 CTGGTCGAACTGGGAGAGTATGG + Intergenic
1058758009 9:108101849-108101871 GTGGATGAAATGGGTGTGTGAGG - Intergenic
1060041025 9:120301239-120301261 TTGGATGAGGTAGGGGAGTAAGG - Intergenic
1060190905 9:121591916-121591938 GGGGACAAACTGGGAGAGTATGG + Intronic
1061153421 9:128842612-128842634 GTGGAGGCACTGGGGGAGGAAGG - Intronic
1061938412 9:133871308-133871330 ATGGATGAATTGGGGGTGGATGG + Intronic
1202787410 9_KI270719v1_random:41413-41435 CTGGTCGAACTGGGAGAGTATGG - Intergenic
1185612778 X:1402398-1402420 GAGGCTGAATTGGGGGAGGAGGG - Intergenic
1185793125 X:2942821-2942843 GCAGATGAACTGGGAGAGGAGGG - Intronic
1188056799 X:25550648-25550670 CTGGGTGAACTTGGGGACTAGGG + Intergenic
1190281668 X:48935096-48935118 GAGGAGGAACTGGGGGACCAGGG + Intronic
1194383006 X:93218870-93218892 GTGTTTGAACTGGGGTGGTAGGG + Intergenic
1195862858 X:109399954-109399976 GTTGATGAAGTGGGGGAGGGCGG + Intronic
1196016367 X:110944512-110944534 GAGCAGGAACTGGGGGAGGAAGG - Intronic
1196259748 X:113564601-113564623 GCAGATTAACTGGGGGAGAATGG - Intergenic
1197163261 X:123347179-123347201 GTGGATGAGCTGGCAGAGTGGGG + Intronic
1198452678 X:136783510-136783532 GCTGATGAACTGAGGGAATAGGG + Intergenic
1198560358 X:137843271-137843293 GAGGGTGGACTGGGGGAGGATGG - Intergenic
1199726583 X:150588945-150588967 GTGAATGAACTGGGCAATTAAGG - Intronic
1200258150 X:154596776-154596798 GTTGAGAATCTGGGGGAGTAGGG + Intergenic
1200982625 Y:9276253-9276275 TCTGATGAACTGGGGGTGTAGGG + Intergenic
1201958593 Y:19652646-19652668 GTGGAGAAATTGGGGAAGTAGGG - Intergenic
1202127770 Y:21583448-21583470 TCTGATGAACTGGGGGTGTAGGG - Intergenic