ID: 922233418 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:223705369-223705391 |
Sequence | TTCCGAGGATGTAGTCATGG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 67 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 3, 4: 63} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
922233418_922233423 | 16 | Left | 922233418 | 1:223705369-223705391 | CCACCATGACTACATCCTCGGAA | 0: 1 1: 0 2: 0 3: 3 4: 63 |
||
Right | 922233423 | 1:223705408-223705430 | GCTACTTTGGCTTTCTTACCAGG | 0: 1 1: 0 2: 1 3: 8 4: 107 |
||||
922233418_922233422 | 3 | Left | 922233418 | 1:223705369-223705391 | CCACCATGACTACATCCTCGGAA | 0: 1 1: 0 2: 0 3: 3 4: 63 |
||
Right | 922233422 | 1:223705395-223705417 | TGAGTGGCAGAGTGCTACTTTGG | 0: 1 1: 0 2: 0 3: 10 4: 113 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
922233418 | Original CRISPR | TTCCGAGGATGTAGTCATGG TGG (reversed) | Intronic | ||