ID: 922233418

View in Genome Browser
Species Human (GRCh38)
Location 1:223705369-223705391
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 63}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922233418_922233423 16 Left 922233418 1:223705369-223705391 CCACCATGACTACATCCTCGGAA 0: 1
1: 0
2: 0
3: 3
4: 63
Right 922233423 1:223705408-223705430 GCTACTTTGGCTTTCTTACCAGG 0: 1
1: 0
2: 1
3: 8
4: 107
922233418_922233422 3 Left 922233418 1:223705369-223705391 CCACCATGACTACATCCTCGGAA 0: 1
1: 0
2: 0
3: 3
4: 63
Right 922233422 1:223705395-223705417 TGAGTGGCAGAGTGCTACTTTGG 0: 1
1: 0
2: 0
3: 10
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922233418 Original CRISPR TTCCGAGGATGTAGTCATGG TGG (reversed) Intronic