ID: 922233517

View in Genome Browser
Species Human (GRCh38)
Location 1:223706114-223706136
Sequence TACCCTAAGCTCCAACAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 80}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922233516_922233517 -2 Left 922233516 1:223706093-223706115 CCTGGCAAGGGTGGGATGTAATA 0: 1
1: 0
2: 0
3: 7
4: 111
Right 922233517 1:223706114-223706136 TACCCTAAGCTCCAACAGACTGG 0: 1
1: 0
2: 0
3: 5
4: 80
922233515_922233517 1 Left 922233515 1:223706090-223706112 CCTCCTGGCAAGGGTGGGATGTA 0: 1
1: 0
2: 0
3: 14
4: 124
Right 922233517 1:223706114-223706136 TACCCTAAGCTCCAACAGACTGG 0: 1
1: 0
2: 0
3: 5
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922233517 Original CRISPR TACCCTAAGCTCCAACAGAC TGG Intronic
901183558 1:7357841-7357863 GACCCCAAGCTCCAGCAGCCCGG - Intronic
902053032 1:13579160-13579182 TATCCTAAGCTCCCAAAGCCAGG - Intergenic
910763531 1:90758488-90758510 AACCCTGACCTACAACAGACAGG - Intergenic
920822212 1:209391856-209391878 TACCCTAATCAACAGCAGACAGG + Intergenic
921533425 1:216313421-216313443 TACCCCAAGGTGCAACAGAATGG + Intronic
922233517 1:223706114-223706136 TACCCTAAGCTCCAACAGACTGG + Intronic
924437731 1:244058218-244058240 AACCCTAAGCTCAAGCAGTCAGG + Intergenic
1069258320 10:66361841-66361863 TACCCTAATCTCAAAAAGAATGG - Intronic
1079301804 11:19285157-19285179 GACCCTCATCTCCAACAGCCAGG - Intergenic
1087128470 11:94648745-94648767 TACACCACTCTCCAACAGACAGG - Intergenic
1088595694 11:111438764-111438786 TACCCTAAGCTTCAAAAGAGAGG + Intronic
1091038730 11:132256856-132256878 GACCCCTAGCTCCCACAGACAGG + Intronic
1091716384 12:2779696-2779718 TGGCCTAAGCTACAAAAGACAGG + Intergenic
1103014110 12:117480640-117480662 TACCCCAAGCTCTAACTGAGGGG + Intronic
1106928493 13:34637855-34637877 TACCCTATGCTCCACCAGCTGGG - Intergenic
1110378884 13:74826808-74826830 AACCCTAACCCCCAACAGAATGG + Intergenic
1113017200 13:105840906-105840928 TACCCTAAGCTTCCACCTACAGG - Intergenic
1113209375 13:107957227-107957249 AAACCTAAGCTGCAACACACAGG - Intergenic
1116756024 14:48949084-48949106 AACTATAAGCTCCAAAAGACAGG + Intergenic
1120173281 14:81268150-81268172 TACAGTAAGCTCCAACAGTCAGG + Intronic
1120859707 14:89243925-89243947 TCCCCTAAGCTCCAACTCGCAGG + Intronic
1121220246 14:92279535-92279557 TCCCTTCAGCTCCAACAGTCAGG + Intergenic
1124637161 15:31372673-31372695 GACGCTGAGCTCCACCAGACTGG - Exonic
1130446769 15:84009333-84009355 TACCATAGGCTTCATCAGACTGG - Intronic
1132779047 16:1612912-1612934 TACCCTAAGGGCCAACAAGCAGG - Intronic
1133618234 16:7500050-7500072 TACTCTAAGCTGCAACCCACTGG + Intronic
1134292650 16:12914949-12914971 TACGGTAAGTTCCAGCAGACAGG + Intronic
1134572490 16:15303224-15303246 TACCCTGGGCTCCAACACTCGGG + Intergenic
1134729894 16:16452816-16452838 TACCCTGGGCTCCAACACTCGGG - Intergenic
1134937538 16:18259080-18259102 TACCCTGGGCTCCAACACTCGGG + Intergenic
1135227684 16:20675488-20675510 CACTCTAAGGTCCACCAGACTGG - Intronic
1137250513 16:46737552-46737574 TACTCTAAGCTCCCAGAGGCAGG + Intronic
1137822740 16:51461408-51461430 TACCCTGAGCTCCAGGTGACTGG - Intergenic
1140218766 16:73028562-73028584 GCCCCAAAGCACCAACAGACAGG + Intronic
1142725192 17:1808613-1808635 TACCATAATCACCAACATACTGG + Intronic
1143260372 17:5594093-5594115 TGCCCTAAGCCCCTGCAGACTGG - Intronic
1153983398 18:10331918-10331940 TACCCAAATCTCCATCACACTGG - Intergenic
1157103837 18:44754872-44754894 TACCCAAAGCCCCAACATAGTGG + Intronic
1158989645 18:62855485-62855507 TCCCATAAGCTGCAACAGAATGG - Intronic
1160063261 18:75550999-75551021 TATCCTCAGCACCAACAGAAGGG - Intergenic
1160402361 18:78620306-78620328 TTCCCCATGCTCCAGCAGACTGG - Intergenic
928893600 2:36235555-36235577 TTCACTAAGCTCCACCAGAGCGG - Intergenic
932515119 2:72338788-72338810 TACCCAAGGCTGCTACAGACAGG + Intronic
933565710 2:83948034-83948056 TCCCCTAAGCCTCACCAGACGGG - Intergenic
935390530 2:102547740-102547762 TAACCTAAGTTCCAACAAGCAGG - Intergenic
936499233 2:113052669-113052691 TGGACTCAGCTCCAACAGACTGG - Intronic
937167760 2:119836936-119836958 AACCCTCAGCTCCAGCAGCCTGG + Intronic
937589536 2:123596437-123596459 TACCCAAGGCTACAACAGTCAGG + Intergenic
938801074 2:134763770-134763792 AACCCTATGCCCCAACAGGCTGG + Intergenic
939474178 2:142664756-142664778 TGCACTAGGCCCCAACAGACAGG - Intergenic
944547745 2:200814318-200814340 TACCCTAACCATCAACAGCCAGG - Intronic
1170592521 20:17781708-17781730 TACCATAAGCTCCACAAGGCAGG - Intergenic
1171093323 20:22306686-22306708 TACCCTGAGCTGGAACAGAGGGG + Intergenic
1173298075 20:41777045-41777067 TACTGTAAGCTCCACCAGCCGGG + Intergenic
1178673181 21:34610129-34610151 TACAATATGCTACAACAGACTGG + Intronic
952995794 3:38880988-38881010 TACCCTAGTCTCCAACAGCAAGG - Intronic
963039716 3:141059923-141059945 TGGCCTAGGGTCCAACAGACAGG + Intronic
980874239 4:138644906-138644928 TACCCTAGCCTCTAACAGGCAGG + Intergenic
985009053 4:185563753-185563775 TTCCCTAAACTCCAAAAGGCCGG + Intergenic
986805060 5:11301331-11301353 TACTCTAGGGTCCAGCAGACAGG + Intronic
990716815 5:58646599-58646621 TACACTAAGCTCCTTCAGATGGG + Intronic
993353048 5:86873442-86873464 TGCACTAAGCCCCAACAGATCGG + Intergenic
994987207 5:106951828-106951850 TTCCCTAAACTCCAACTGACAGG + Intergenic
995411349 5:111860501-111860523 TAACCTAAGCACTAACTGACTGG - Intronic
997714271 5:136030230-136030252 TGCCCAAACCTCCAAGAGACTGG + Intronic
1002716643 5:181232222-181232244 TACCATGAGCTCCCACTGACAGG - Intronic
1005050541 6:21679797-21679819 TAACCTAAATTCCAACAGAGTGG - Intergenic
1006818815 6:36874348-36874370 TACCGTAAGCTCCTAAAGGCAGG + Intronic
1007176145 6:39899001-39899023 CACCCTAAGCTCCTACACAGGGG + Intronic
1012493050 6:99803952-99803974 TCCCCTAATGTCCAACAGTCAGG + Intergenic
1015538521 6:134291318-134291340 TGCACTAGGCCCCAACAGACCGG + Intronic
1016573728 6:145544191-145544213 TTCCCTAACCTCCATCAGAAAGG + Intronic
1017708489 6:157146358-157146380 TCCCCTAAGGTCCTACAGGCAGG + Intronic
1021950209 7:25766910-25766932 TATGCTAAGCTGCAACTGACTGG - Intergenic
1022346239 7:29517176-29517198 TAGCCACAGCTCCAAAAGACAGG - Intergenic
1028608850 7:92685627-92685649 TGCACTAGGCCCCAACAGACTGG + Intronic
1042863910 8:73340130-73340152 AATGCTAAGCTCAAACAGACTGG + Intergenic
1044278917 8:90334131-90334153 TCCAGTAAACTCCAACAGACCGG + Intergenic
1045457992 8:102400850-102400872 TACCCTATTCTCAAACAGACAGG + Intronic
1045703427 8:104893357-104893379 GACCTTAAGCTCCATCAGAGCGG + Intronic
1047596138 8:126379533-126379555 TACAGTAAGCTCCAACAGTTTGG + Intergenic
1049723058 8:144129892-144129914 CACCCTAACCTCCAACCAACTGG - Intergenic
1050324859 9:4489652-4489674 TCCCCTAAGGTCCAACGGATTGG - Intergenic
1055079017 9:72248582-72248604 TACTTTAAGCTCAAACAGAAGGG + Intronic
1058749668 9:108026980-108027002 CACCCAAATGTCCAACAGACTGG - Intergenic
1190851560 X:54248803-54248825 TCCCCTAATTTCCAACAGACAGG - Exonic