ID: 922234836

View in Genome Browser
Species Human (GRCh38)
Location 1:223714763-223714785
Sequence CATTGTGCCCAGCATATAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 988
Summary {0: 1, 1: 4, 2: 20, 3: 148, 4: 815}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922234836_922234839 22 Left 922234836 1:223714763-223714785 CCTACTATATGCTGGGCACAATG 0: 1
1: 4
2: 20
3: 148
4: 815
Right 922234839 1:223714808-223714830 ACTTACTTCTGAGGCTAGTGAGG 0: 1
1: 0
2: 0
3: 7
4: 175
922234836_922234840 23 Left 922234836 1:223714763-223714785 CCTACTATATGCTGGGCACAATG 0: 1
1: 4
2: 20
3: 148
4: 815
Right 922234840 1:223714809-223714831 CTTACTTCTGAGGCTAGTGAGGG 0: 1
1: 0
2: 2
3: 7
4: 167
922234836_922234838 13 Left 922234836 1:223714763-223714785 CCTACTATATGCTGGGCACAATG 0: 1
1: 4
2: 20
3: 148
4: 815
Right 922234838 1:223714799-223714821 CTTCTGAAGACTTACTTCTGAGG 0: 1
1: 0
2: 1
3: 15
4: 220
922234836_922234841 24 Left 922234836 1:223714763-223714785 CCTACTATATGCTGGGCACAATG 0: 1
1: 4
2: 20
3: 148
4: 815
Right 922234841 1:223714810-223714832 TTACTTCTGAGGCTAGTGAGGGG 0: 1
1: 0
2: 2
3: 13
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922234836 Original CRISPR CATTGTGCCCAGCATATAGT AGG (reversed) Intronic
900419389 1:2549152-2549174 CCCACTGCCCAGCATATAGTGGG + Intergenic
900425827 1:2578163-2578185 CTCACTGCCCAGCATATAGTGGG - Intergenic
901148266 1:7082976-7082998 CATAGTGCCTGGCATATTGTAGG + Intronic
901607943 1:10474272-10474294 CAAAGTCCCTAGCATATAGTAGG + Intronic
901755308 1:11438005-11438027 CACAGTGTCCAGAATATAGTAGG + Intergenic
901873359 1:12151682-12151704 CACAGTGCCCAACACATAGTAGG - Intergenic
901914590 1:12488268-12488290 CATAGTGCCTGGCACATAGTAGG - Intronic
902244176 1:15108546-15108568 CAGTGTGCCCAGCACGTAGTGGG + Intronic
902663741 1:17923181-17923203 CATTGTGCCTGGCATATAGTAGG - Intergenic
902729553 1:18360505-18360527 CATTGTTCCCGGCACCTAGTAGG + Intronic
902937946 1:19778189-19778211 CACAGTGCCTAGCACATAGTAGG - Intronic
903021220 1:20396633-20396655 CACTGTGCCTGGCACATAGTAGG + Intergenic
903031978 1:20470279-20470301 AATTGTGCCAAGCACACAGTAGG - Intergenic
903139163 1:21328367-21328389 CCTTGTGCCTGGCACATAGTGGG + Intronic
903268961 1:22176028-22176050 CACTGTGCCCGGCACATAGTAGG + Intergenic
903303961 1:22399740-22399762 CACCGTGCCTGGCATATAGTTGG - Intergenic
903369112 1:22823806-22823828 CATAGTGCCTGGCACATAGTAGG + Intronic
903381024 1:22896896-22896918 CGTGGTGCCCAGCACATAGTAGG + Intronic
903603288 1:24557167-24557189 CACGGTGCCCAGCATGCAGTAGG + Intronic
903749218 1:25609923-25609945 CAGTGTGCCTGGCATATAGTAGG - Intergenic
903806909 1:26012159-26012181 CATAGCGTCCAGTATATAGTAGG + Intergenic
903833023 1:26185948-26185970 CATAGTGCCCAGCCTAGAGCTGG - Intronic
903912561 1:26738465-26738487 CATAGTGCCTGGCATATAGTAGG + Intronic
904258044 1:29269456-29269478 CACAGTGCCCAGCACAAAGTGGG - Intronic
904286432 1:29455625-29455647 CATGGTGCCAAGCACAAAGTAGG - Intergenic
904311759 1:29633568-29633590 GACTGTGCCTGGCATATAGTAGG + Intergenic
904312682 1:29639535-29639557 CCTTGTGCCTGGCACATAGTAGG - Intergenic
904323573 1:29712301-29712323 CACAGTGCCCAGTACATAGTAGG - Intergenic
904374321 1:30070379-30070401 CACAGTACCCAGCACATAGTAGG - Intergenic
904481914 1:30799340-30799362 AATAGTGTCCAGCACATAGTAGG - Intergenic
904802481 1:33103707-33103729 CACAGTGCCTGGCATATAGTAGG + Intronic
904819746 1:33234319-33234341 CACAGAGCCCAGCATACAGTAGG + Intergenic
904843266 1:33388136-33388158 GCTTGTGCCCAGCATGTGGTGGG - Intronic
905021706 1:34820081-34820103 TCTTGTGGGCAGCATATAGTGGG - Intronic
905554018 1:38867700-38867722 CAATGTGCTCAGCGTATAGTTGG - Intronic
905860971 1:41351158-41351180 CTTCATGCCCAGCATATAATAGG + Intergenic
905940385 1:41858588-41858610 CATAGTACCCAGCATAGGGTAGG - Intronic
906261521 1:44395209-44395231 CATAGTATCTAGCATATAGTAGG - Intergenic
906728995 1:48064977-48064999 CACTGTGCCTAGCATGTAGTAGG - Intergenic
907077855 1:51594566-51594588 CATTGTCCCTAGCATATAGTTGG - Intronic
907217515 1:52878034-52878056 AATACTGCCTAGCATATAGTAGG - Intronic
907326298 1:53640673-53640695 CACTGTGCCCATCATACAGAAGG + Intronic
907353201 1:53850466-53850488 AATAGTACCCAGCACATAGTAGG + Intergenic
907391671 1:54162235-54162257 CATTGAGCCTGGCACATAGTAGG - Intronic
907633901 1:56113645-56113667 AATAGTGCCTACCATATAGTAGG + Intergenic
907880343 1:58544295-58544317 TATGGTGCCTAGCATTTAGTGGG - Intronic
907994927 1:59620431-59620453 TTTTGTACACAGCATATAGTTGG + Intronic
908025157 1:59942850-59942872 CTCTGTGCCCAGCACATAGTAGG - Intergenic
908133679 1:61104084-61104106 CAGGGTACCCAGCACATAGTAGG - Intronic
908163023 1:61430235-61430257 TATCATGCCCAGCACATAGTGGG + Intronic
908199026 1:61774867-61774889 CACAGGGCCCAGCACATAGTAGG - Intronic
908335402 1:63118049-63118071 CACGGTGGCCAGCATATGGTAGG - Intergenic
908338874 1:63155693-63155715 CATGGTGCCTAGCACATACTAGG - Intergenic
908342453 1:63195703-63195725 CATAATGCTCAGCATATAGCTGG - Intergenic
908344835 1:63221639-63221661 CCTAGTGCCTAGCATACAGTAGG - Intergenic
908403644 1:63793549-63793571 CACTGTGCCTGGCACATAGTAGG - Intronic
908450027 1:64244830-64244852 CATGGTGCCTGGCAAATAGTAGG + Intronic
908646814 1:66287389-66287411 CACAGTGCCCAACATTTAGTAGG + Intronic
908770786 1:67593675-67593697 CATTCTTCCCAGCACACAGTAGG + Intergenic
909356193 1:74712676-74712698 AATTGTGCCCACCCCATAGTGGG - Intronic
910075513 1:83272812-83272834 TATATTGCCCAGCACATAGTAGG - Intergenic
910145319 1:84073368-84073390 CATTATGCCTCGTATATAGTAGG - Intergenic
910155424 1:84212775-84212797 AATAGTGCCTGGCATATAGTAGG + Intronic
910205605 1:84746243-84746265 CATAGTGTCTAGCATATGGTTGG + Intergenic
910471484 1:87557952-87557974 CATCATGCCCAGCACATAGTAGG - Intergenic
910536824 1:88307726-88307748 CAATGTGCTAAGCACATAGTAGG - Intergenic
911709928 1:101059550-101059572 CCTTGTAAACAGCATATAGTTGG + Intergenic
912396091 1:109345097-109345119 AATAGTACCTAGCATATAGTAGG + Intronic
912481737 1:109986807-109986829 CTTTGTACCCAGCATACAGTAGG + Intronic
912498534 1:110106767-110106789 CATAGTGCCTGGCACATAGTAGG - Intergenic
912527912 1:110298473-110298495 CAATGTGCCAGGCATAGAGTTGG + Intergenic
912728545 1:112080702-112080724 CAAAGTGCCCAGAACATAGTAGG + Intergenic
912762449 1:112381265-112381287 CATGGTGCCTGGCACATAGTAGG - Intergenic
913047381 1:115085877-115085899 AATAGTGCCTAGCATATAGAAGG - Intronic
913352110 1:117873467-117873489 AATTGTGCCTTGCATATAGAAGG - Intronic
913428355 1:118760451-118760473 TTTTGTACACAGCATATAGTTGG - Intergenic
914254096 1:145946628-145946650 CTTAGTGCCTAGCAGATAGTAGG - Intronic
914256666 1:145965565-145965587 CATTGTGTCTGGCATATAGTAGG - Intronic
914452289 1:147803176-147803198 CAAGGAGCCCAGCATTTAGTTGG + Intergenic
915434201 1:155891199-155891221 CACCGTGCCCAGCTGATAGTGGG - Intergenic
915893508 1:159792851-159792873 AATTGTGGCTGGCATATAGTAGG - Intergenic
916062461 1:161109568-161109590 CACAGTGCCTGGCATATAGTAGG - Intronic
916184970 1:162122400-162122422 CATTGTGCTACGCATGTAGTAGG + Intronic
916602012 1:166302347-166302369 AACTATGCCCAGCATATAATAGG - Intergenic
916722293 1:167493552-167493574 TATTGTGCCCATTTTATAGTTGG + Intronic
916849290 1:168686752-168686774 CCCAGTGCCCAGCATATGGTAGG - Intergenic
917073493 1:171178573-171178595 CATGGTGCCCAGCCTAGAATTGG - Intergenic
917231355 1:172841294-172841316 CACAGTTCCTAGCATATAGTTGG - Intergenic
917719861 1:177777050-177777072 CATTGTGCCTAGCACATAACAGG + Intergenic
918417743 1:184329624-184329646 CACAGTGCACAGCATAAAGTGGG + Intergenic
918456091 1:184716677-184716699 CATAGTGCCTGGCATATAGTAGG - Intronic
918474869 1:184913497-184913519 AATTATTCCCAGCATACAGTTGG + Intronic
918576374 1:186065615-186065637 CACTGTGCCTAGAACATAGTAGG - Intronic
918587562 1:186205245-186205267 CACAGTGCCTGGCATATAGTAGG + Intergenic
918649085 1:186937910-186937932 CACAGTGCCCAGAATATAGTAGG + Intronic
919462595 1:197895680-197895702 CATGGTGTCTAGCACATAGTGGG - Intergenic
919769181 1:201146387-201146409 CATCTTGCCCAGAATATAGCAGG + Intronic
919844533 1:201633266-201633288 CACTATGCCCTGCACATAGTAGG - Intronic
920087918 1:203431429-203431451 CATAATGCCCAACACATAGTAGG + Intergenic
920354693 1:205362296-205362318 CATTGTGTCTGGCACATAGTGGG - Intergenic
920355591 1:205369611-205369633 CACAGTGCGCAGCACATAGTAGG + Intergenic
920357931 1:205389335-205389357 CACTGTGCCCAGCCTACATTTGG + Intronic
920442775 1:205992413-205992435 CACTGTGCCTGGCACATAGTGGG + Intronic
921137625 1:212275924-212275946 AATGGTGCCTAGCATATAGTAGG + Intergenic
921176648 1:212600819-212600841 CACGGTATCCAGCATATAGTTGG + Intronic
921372512 1:214438869-214438891 CATTGTGCTTAGCATATAGTAGG - Intronic
921832901 1:219748050-219748072 CATGGTGTCCAGCATTTTGTAGG - Intronic
921957699 1:221001064-221001086 AACAGTGCCCAGCACATAGTGGG - Intergenic
922234836 1:223714763-223714785 CATTGTGCCCAGCATATAGTAGG - Intronic
923330668 1:232921145-232921167 CAGTTTTCCCAGCACATAGTAGG + Intergenic
923442541 1:234034809-234034831 CACTGTGCCCAGCCCATAGATGG + Intronic
923725145 1:236499250-236499272 CAGTGTGCCCAGCATCCACTTGG + Intergenic
923765772 1:236891163-236891185 CAGTGTGTTCAGCATATTGTGGG - Exonic
923896288 1:238273797-238273819 TATTGGTCCCAGCATATAATAGG + Intergenic
924131268 1:240911044-240911066 GCTTTTGCCCAGAATATAGTAGG - Intronic
924614522 1:245601641-245601663 CACAGTGCCCAGCACATAGTAGG + Intronic
1063483632 10:6399217-6399239 CAGAGTGCCTTGCATATAGTAGG + Intergenic
1063748079 10:8909048-8909070 CATTGTGCCTAGCATATATTAGG - Intergenic
1063985774 10:11499936-11499958 CAGTGTGCCTAGCATATGGTAGG - Intronic
1064337316 10:14455412-14455434 CACTGTGCCCAGCCTATATACGG + Intronic
1064679941 10:17800598-17800620 CATAGTGCCCAGAACATAGTAGG - Exonic
1064825907 10:19400514-19400536 CTTAGTGCCTAGCACATAGTAGG + Intronic
1065232076 10:23608661-23608683 CATGGTGCCTGGCACATAGTAGG - Intergenic
1065287149 10:24196962-24196984 CACGGTGCCTGGCATATAGTAGG - Intronic
1066123553 10:32316152-32316174 CATTCTGCTGGGCATATAGTGGG - Intronic
1068425758 10:56861518-56861540 CACTGTGCTTGGCATATAGTAGG - Intergenic
1068778315 10:60891634-60891656 CACTGTGCCCAGCCTAGAGGAGG + Intronic
1068785241 10:60965499-60965521 CATGGTGCCTGGCATGTAGTAGG + Intronic
1068956875 10:62826330-62826352 CATAATACCTAGCATATAGTAGG - Intronic
1069986505 10:72287936-72287958 CACAGTGCCTGGCATATAGTAGG - Intergenic
1070180927 10:74013076-74013098 CATAGTGCTTGGCATATAGTAGG + Intronic
1070333289 10:75432863-75432885 CATGGTGCCTGGCATACAGTAGG - Intronic
1070365685 10:75734634-75734656 CATTGTGCCTAGCAAAGAGCAGG - Intronic
1070368050 10:75755327-75755349 CATTGTGCCTAGCACATAGCAGG + Intronic
1071562728 10:86656216-86656238 CACTGTGCCCAGGGTATAGTGGG - Exonic
1071775665 10:88785180-88785202 CATGGTGCCTTGCATATAATAGG - Intergenic
1072020806 10:91398232-91398254 TATTGTGGGCAGCATATAGTTGG - Intergenic
1072234789 10:93444278-93444300 CACAGTGCCTGGCATATAGTAGG - Intronic
1072241857 10:93504079-93504101 CATAGTGCCTAGTATATAGTAGG + Intronic
1072351716 10:94563776-94563798 CAGTGTGCCCAGCTTTTTGTTGG + Intronic
1073204965 10:101764001-101764023 AATGGTGCCCAGCACATGGTGGG - Intergenic
1073844118 10:107532703-107532725 AATGGTGCCTAGCACATAGTAGG - Intergenic
1074182003 10:111073889-111073911 CATTGTGCCTAGCATGTGGTTGG + Intergenic
1074428601 10:113373795-113373817 CAATGTGCCCAACACACAGTAGG - Intergenic
1074504625 10:114057928-114057950 TATTGGGCCCAGCACATAGTAGG - Intergenic
1075067334 10:119298235-119298257 AATTGTGCCTTGTATATAGTAGG - Intronic
1075216331 10:120539421-120539443 CACTGTGCCCAGCACACAGTGGG + Intronic
1075498766 10:122953581-122953603 CATTGTGCCCTGCACCCAGTAGG - Intronic
1075583279 10:123638406-123638428 CATGGTGCCAAGTATATAGAAGG + Intergenic
1075752303 10:124782956-124782978 TCTTGTAGCCAGCATATAGTTGG - Intronic
1076901427 10:133340297-133340319 CATGGTGCCCAGCACACAGAAGG + Intronic
1077930480 11:6726500-6726522 TATTGAAGCCAGCATATAGTTGG - Intergenic
1078829514 11:14966138-14966160 AATAGTGCCTAGCATATAGCAGG + Intronic
1078906563 11:15693321-15693343 CATAGGTCCCAGCACATAGTAGG - Intergenic
1078969549 11:16391493-16391515 CTTTGTGCCTGGCATATAGTAGG + Intronic
1079017561 11:16882130-16882152 CATAGTGCCTGGCACATAGTAGG + Intronic
1079085937 11:17444940-17444962 AATTGTGGCTGGCATATAGTTGG + Intronic
1079285054 11:19121444-19121466 AATAGTGCCCAGCACGTAGTAGG + Intronic
1079336189 11:19572797-19572819 AATTTTGCCCAGCACATGGTAGG + Intronic
1079454654 11:20625979-20626001 CATAGTGCCCAGCTCATAGGAGG + Intronic
1079507795 11:21173675-21173697 CATTGTGCCTGACATATGGTGGG + Intronic
1079541166 11:21577190-21577212 CATAGTGCCTTCCATATAGTGGG + Intergenic
1080549361 11:33358311-33358333 CACAGTGCCTGGCATATAGTGGG + Intergenic
1080578030 11:33617741-33617763 CATGGTGCCTGGCACATAGTAGG + Intronic
1080616046 11:33945680-33945702 CATGGTCCTCAGCACATAGTAGG + Intergenic
1081264232 11:40999686-40999708 CATAGTGTCCAGCATATGGCAGG - Intronic
1081334749 11:41850858-41850880 CAATGTGCCTAGCACATAATAGG - Intergenic
1081467014 11:43329570-43329592 CATGGTGCCTGGCAAATAGTAGG + Intronic
1081535753 11:43995134-43995156 CACCGTGCCCAGCATGCAGTAGG - Intergenic
1081601364 11:44497118-44497140 CATGGTGCCAGGCATATGGTAGG + Intergenic
1082074241 11:47963959-47963981 CATAGTGCCCAGCATCTGCTTGG + Intergenic
1083168947 11:60910757-60910779 CATTGTGCCTGGCACATAGCAGG + Intergenic
1083583832 11:63841876-63841898 CATACTGCTGAGCATATAGTAGG + Intronic
1084939076 11:72602694-72602716 CACAGTGCCCAGCACACAGTAGG - Intronic
1085019286 11:73195093-73195115 CACTGTGCCTGGCACATAGTAGG - Intergenic
1085275863 11:75299805-75299827 CATGGTACCTAGGATATAGTAGG + Intronic
1085478926 11:76805904-76805926 GCTGGTGCCCAGCACATAGTTGG + Intergenic
1086330808 11:85752222-85752244 CATCTTGCCCAGAATATACTGGG + Intronic
1086997942 11:93380085-93380107 GAGTGTGACCAGCATCTAGTGGG + Intronic
1088418958 11:109621209-109621231 CACTGTGCCTAGCACATTGTAGG - Intergenic
1088428873 11:109735243-109735265 CACTGTGGCCTGCACATAGTGGG + Intergenic
1089164768 11:116467332-116467354 CTTTGCACACAGCATATAGTGGG - Intergenic
1089273443 11:117316479-117316501 CAGTGTGCCTGGCATACAGTGGG - Intronic
1089626076 11:119751860-119751882 CATTGTGCCAACCATAAAGTAGG - Intergenic
1089837377 11:121383021-121383043 AATAGTGCTCTGCATATAGTTGG - Intergenic
1089909907 11:122087350-122087372 CAAAGTGCCCAGCACGTAGTAGG + Intergenic
1089992349 11:122873434-122873456 CACTGTGCCTGGCATATAATGGG + Intergenic
1090054570 11:123411368-123411390 CATGGTGCCTGGCATATAGCAGG + Intergenic
1090341567 11:126026276-126026298 CATAGTGCCTGGCATATAGTAGG - Intronic
1090650516 11:128802092-128802114 CATAGTGCCCAGCACAGAGGTGG - Intronic
1090730727 11:129571466-129571488 CCTGGTACCCAGCATATAGCAGG - Intergenic
1091392492 12:134215-134237 GACAGTGCCCAGCACATAGTGGG - Intronic
1091481947 12:842056-842078 CATTGTGCACAGCACACCGTAGG + Intronic
1091703972 12:2681314-2681336 CACAGTGCCCAGCACACAGTCGG + Intronic
1091875138 12:3927532-3927554 CAGTGTGCCCAGGATATTGAGGG - Intergenic
1092166162 12:6343588-6343610 CATTGTACCAAGAAGATAGTTGG - Intergenic
1092502557 12:9063825-9063847 TATTGTGCCTGGCAGATAGTAGG + Intergenic
1093008038 12:14072240-14072262 CATAGTGCCTGGCATAGAGTAGG - Intergenic
1093673807 12:21909785-21909807 CATAGTGCCCAGCATTTCCTGGG - Intronic
1093710349 12:22322354-22322376 CATTGTGCCTGGCACATAGAAGG + Intronic
1093849838 12:24022017-24022039 CATAGTGCCCGACACATAGTAGG - Intergenic
1093939372 12:25036210-25036232 CATAGTGCCTAGCATATAGTAGG + Intronic
1095177809 12:39113341-39113363 CACTGTGCCCAGCCTGTACTTGG + Intergenic
1095323122 12:40854078-40854100 CATAGTACCTAGCATACAGTAGG - Intronic
1095477470 12:42600529-42600551 CATTGTGCTCAGCATACAGTAGG - Intergenic
1095493224 12:42758047-42758069 CATTGTTGCCTGCATATAGAAGG + Intergenic
1095909089 12:47407783-47407805 CACAGTGTCTAGCATATAGTGGG - Intergenic
1095910219 12:47418552-47418574 CTCTGTGTCCTGCATATAGTAGG + Intergenic
1095980187 12:47968439-47968461 GCCTGTGCCCAGCAAATAGTTGG + Exonic
1096385768 12:51194313-51194335 CACTGTGCCCAGCCTATAACAGG + Intronic
1096523996 12:52199936-52199958 CACGGTGCCTGGCATATAGTGGG + Intergenic
1096613056 12:52815722-52815744 CATGGTGCCTGGCATATAGGAGG + Intergenic
1096841445 12:54382014-54382036 CACAGTACCCAGCACATAGTAGG + Intronic
1097158031 12:57026890-57026912 CACTGTGCCCATCATGTAGATGG - Intronic
1097515676 12:60602841-60602863 TATTGTACACAGCATATAGTTGG - Intergenic
1097650343 12:62290518-62290540 TATTGTAAGCAGCATATAGTTGG + Intronic
1097720681 12:63017100-63017122 CATTTTGCCCAGCATACAGTAGG - Intergenic
1097729219 12:63108609-63108631 CACAGTTCCCAGCATACAGTAGG - Intergenic
1097730971 12:63127575-63127597 CATGGTGCCTAGCATACAGTAGG - Intergenic
1097967944 12:65601415-65601437 CATATTGTCCAGCATATAATAGG - Intergenic
1098052795 12:66472245-66472267 CAATGTGCATGGCATATAGTTGG - Intronic
1098198249 12:68025301-68025323 GACAGTGCCCAGCACATAGTAGG - Intergenic
1098233098 12:68392753-68392775 CAGAGTACCCAGCATATAGTAGG + Intergenic
1098794447 12:74870735-74870757 CATAGTGTCCAGCATGTAGTAGG - Intergenic
1098932016 12:76429325-76429347 CATAGTTCCCAACACATAGTAGG - Intronic
1098978823 12:76932951-76932973 CATAATGCCTGGCATATAGTAGG + Intergenic
1098985790 12:77010483-77010505 CATAGTGCCTAGCATATAATAGG + Intergenic
1099021574 12:77411872-77411894 CATTGTGCTTAGCATATGGTAGG + Intergenic
1100351394 12:93786887-93786909 CATAGTGCCTAGTACATAGTAGG - Intronic
1100392350 12:94154873-94154895 CATAGTACCCAGTATGTAGTTGG + Intronic
1100467024 12:94855412-94855434 CTTTGTGACTAGCATATAGCTGG - Intergenic
1100467228 12:94857053-94857075 CATTGGGCCTGGCACATAGTAGG - Intergenic
1100515962 12:95328002-95328024 CACTGTGCCCAGCCTAGAGATGG - Intergenic
1100633874 12:96415544-96415566 CATTGTGCCCAGCCTAAAGTGGG + Intergenic
1100878803 12:98993455-98993477 CACTGTGCCCAGCCTGTAGTTGG + Intronic
1101010048 12:100439983-100440005 AAATGTGCCCAACACATAGTAGG + Intergenic
1101066134 12:101023122-101023144 CACAGTGCCTGGCATATAGTAGG + Intronic
1101230639 12:102737616-102737638 CATTGTGCCTGGCATATTATAGG + Intergenic
1101233314 12:102764012-102764034 CATTGTGCGCAGAACACAGTAGG - Intergenic
1101312774 12:103598811-103598833 GATTGTACGCAGCATATAGTAGG - Intronic
1101591909 12:106132371-106132393 CATGGTGCCAAGCACATAGTAGG - Intronic
1101670389 12:106866220-106866242 AATAGTGCCCAGCACACAGTAGG + Intronic
1101746424 12:107544954-107544976 AACAGTGCCCAGCACATAGTAGG + Intronic
1101805954 12:108063857-108063879 AATTGTACCCACCATAAAGTTGG - Intergenic
1101821957 12:108191239-108191261 CACAGTATCCAGCATATAGTAGG + Intronic
1101938240 12:109077557-109077579 CTTTGTGGACAGCATATAATGGG + Intronic
1102522640 12:113488278-113488300 CAGAGTGCCTAGCACATAGTTGG - Intergenic
1102528882 12:113531798-113531820 AAATGTGCCCAGCACACAGTGGG - Intergenic
1102810524 12:115820272-115820294 CATGGTGCCCAGCATACAGAAGG - Intergenic
1102895722 12:116596849-116596871 CATAGGGCCAAGCATATGGTAGG - Intergenic
1103099974 12:118164968-118164990 AACAGTGCCCAGCACATAGTAGG - Intronic
1103130476 12:118464101-118464123 CACAGTGCTCGGCATATAGTAGG + Intergenic
1103277238 12:119722741-119722763 CAAAGTGCCCAGTATACAGTAGG + Intronic
1104002707 12:124870354-124870376 CATAGTGCCCAGCACAGAGTAGG - Intronic
1104153982 12:126112733-126112755 CACAGTGCCCAGCACACAGTAGG - Intergenic
1104408638 12:128539871-128539893 CATTGTGCTGATCACATAGTGGG + Intronic
1104558306 12:129821954-129821976 CATGGTGCCCAGCATACAGCAGG - Intronic
1104615517 12:130264997-130265019 CAGTGTGCCCAGCAGAGAGTAGG + Intergenic
1104644153 12:130485234-130485256 CATAGTGCCCTGCATATAGTAGG - Intronic
1105755685 13:23461761-23461783 CATTGTGCTCATCATAAAATAGG - Intergenic
1105906736 13:24818791-24818813 TCTTGTGGACAGCATATAGTTGG + Intronic
1105960649 13:25333250-25333272 CCTCGAGCCCAGCACATAGTAGG - Intronic
1107085304 13:36421126-36421148 CATAGTGCTCAGAACATAGTAGG - Intergenic
1107137833 13:36963924-36963946 TATCATGCCCAGCACATAGTAGG - Intronic
1107144314 13:37041730-37041752 GATAGTGCCTAGCACATAGTAGG - Intronic
1107246476 13:38302310-38302332 AATAGTGCCTGGCATATAGTGGG + Intergenic
1107591976 13:41918124-41918146 CTTGGTGCTGAGCATATAGTAGG - Intronic
1108059918 13:46522344-46522366 CAATGTGCTCAGCACATAGTTGG + Intergenic
1108111580 13:47079647-47079669 CATAGTGCCTGGCATGTAGTAGG + Intergenic
1108956016 13:56158044-56158066 TCTTGTGGGCAGCATATAGTTGG - Intergenic
1109548690 13:63862814-63862836 CATTGTAGGCAGCATATGGTTGG - Intergenic
1109769690 13:66954651-66954673 CTTTGTGCCCAGAGCATAGTTGG - Intronic
1110155518 13:72312165-72312187 CATAGTGCCTGGCATATAGTGGG - Intergenic
1110543830 13:76734786-76734808 CACTGTGCCCAGCCTGAAGTAGG + Intergenic
1110798779 13:79670724-79670746 CACAGTGCCTGGCATATAGTAGG + Intergenic
1112005888 13:95253385-95253407 CTATGTGCCCAGCATGTTGTTGG - Intronic
1112006086 13:95254895-95254917 CTATGTGCCCAGCATGTTGTAGG - Intronic
1112276256 13:98023585-98023607 CATAGTGCCCAGCAAACACTAGG - Exonic
1112455777 13:99561572-99561594 CATTGTGCTTTGCATATAGTAGG + Intronic
1112585828 13:100717863-100717885 CACTGTGCCCCGCACATAGTAGG - Intergenic
1113588778 13:111483631-111483653 CAATGTGCCCAGCACATAGTAGG + Intergenic
1113828617 13:113276596-113276618 CCTTGTGCCCAGGAGAGAGTAGG - Intergenic
1114693287 14:24605449-24605471 CTTTGTGCCAGGCATATAATAGG - Intergenic
1114730946 14:24992024-24992046 CACTGTGCCAAGCACATTGTAGG + Intronic
1115795658 14:36932517-36932539 TATGATGCCCAGCACATAGTAGG - Intronic
1115873455 14:37833511-37833533 TCTTGTAGCCAGCATATAGTTGG + Intronic
1116443038 14:44976475-44976497 CAATGTGCTCAGAGTATAGTGGG - Intronic
1117131544 14:52692376-52692398 CATGGTGCCTGGCTTATAGTAGG - Intronic
1117284680 14:54275673-54275695 AACTGTGCCCAGCACATAGTAGG - Intergenic
1117354861 14:54914013-54914035 CACTGTGCCCAACATATTCTAGG + Intergenic
1117742810 14:58835348-58835370 CAGTGTGCTCAGCAGATACTAGG + Intergenic
1118302378 14:64627068-64627090 TATTGTGCCCAGCATATAGTAGG - Intergenic
1118679649 14:68226958-68226980 CATAGTGCCTATCATTTAGTAGG - Intronic
1119078349 14:71667462-71667484 CAAAGTGCCTAGCACATAGTAGG + Intronic
1119079956 14:71683849-71683871 CATTGTGCCCAGTGTATTTTTGG + Intronic
1119432328 14:74576326-74576348 AATGGTGCCCAGGATATAGCAGG - Intronic
1119593621 14:75913524-75913546 CATAGTGCCCAGCCTGTAGTAGG + Intronic
1120873240 14:89356724-89356746 CATGGTGCCTGGCATGTAGTAGG - Intronic
1120884175 14:89439146-89439168 CTATGAGCCCAGCATATAGAAGG - Intronic
1121052147 14:90826523-90826545 CACTGTGTCCGGCACATAGTAGG - Intergenic
1121573665 14:94966201-94966223 CATTGTGCCTGACACATAGTAGG - Intergenic
1121676879 14:95760573-95760595 CCTTGTGCCTGGCATCTAGTTGG - Intergenic
1121846707 14:97178328-97178350 CCTTCTGCCCAACACATAGTAGG - Intergenic
1122082575 14:99275390-99275412 CTTTGGGCCCAGCACACAGTAGG - Intergenic
1122140165 14:99658839-99658861 CACTGTGACCAGCACATAGTAGG - Intronic
1122185797 14:99994180-99994202 TATTGTAGACAGCATATAGTTGG + Intronic
1122189168 14:100026271-100026293 CATAGTGCCTTGCATACAGTAGG + Intronic
1122257574 14:100490265-100490287 CATAGTGCTAAGCACATAGTAGG + Intronic
1122431029 14:101643896-101643918 TTTTGTGGACAGCATATAGTTGG - Intergenic
1124849726 15:33324664-33324686 GATGGTGCTTAGCATATAGTAGG + Intronic
1125644795 15:41263181-41263203 CATAGTGCCTGGCATATACTAGG + Intronic
1125788289 15:42342159-42342181 CATGGTGCCCGGCATGCAGTAGG + Intronic
1125889404 15:43254361-43254383 CATGGTGCCCAGCACATTGCAGG + Intronic
1126063431 15:44806133-44806155 CATTTTGCTCAGCATTTGGTGGG - Intergenic
1126132602 15:45357042-45357064 CATGATGCCTAGCATATAGTAGG + Intergenic
1126470458 15:49005039-49005061 CACTGCGCCCAGCCAATAGTGGG - Intronic
1126852981 15:52809589-52809611 CAAGGAGCCCAGCACATAGTGGG - Intergenic
1126854369 15:52823659-52823681 TATTGTGCCAGGCACATAGTAGG + Intergenic
1126861730 15:52890985-52891007 CATAGTTTCTAGCATATAGTAGG + Intergenic
1127051517 15:55088968-55088990 CATGGGGCCTAGCACATAGTAGG + Intergenic
1127188172 15:56502231-56502253 TTTTGTGGGCAGCATATAGTGGG - Intergenic
1127422593 15:58821959-58821981 CACTGTGCCCAGCCTATGGATGG - Intronic
1127431835 15:58918041-58918063 CATTGCGCCCAGCTGGTAGTTGG + Intronic
1127755435 15:62087436-62087458 AATTGTGCCTTGCAAATAGTGGG - Intergenic
1127864195 15:63018558-63018580 CATTGTGCCTGGCACAGAGTAGG + Intergenic
1128069729 15:64787361-64787383 CTTTGTGCCCAGCACACAGCTGG - Intergenic
1128206767 15:65859472-65859494 AACAGTGCCCAGCACATAGTAGG + Intronic
1128474598 15:67986373-67986395 CATTGTGTCTGGCACATAGTAGG + Intergenic
1128912230 15:71526101-71526123 CATTGTCCCCAGCCTACAGGGGG - Intronic
1129577913 15:76772158-76772180 GATAGTGCCCAGTACATAGTAGG - Intronic
1129636843 15:77328549-77328571 CATTATGCCTAGTATATGGTAGG - Intronic
1129698791 15:77755717-77755739 CAGAATGCCCAGCACATAGTAGG - Intronic
1129712847 15:77829527-77829549 CATCGTGCCCAGCATACAGAAGG - Intergenic
1129796613 15:78382269-78382291 CACTATACCCAGCACATAGTAGG - Intergenic
1130786807 15:87106536-87106558 TCTTGTGAACAGCATATAGTTGG - Intergenic
1130811916 15:87388439-87388461 CATAGTGCTCAACATGTAGTAGG - Intergenic
1131692697 15:94844704-94844726 CATTTTCCCCAGCAAATAGCTGG + Intergenic
1131694876 15:94865909-94865931 CTTTGTCACCAGGATATAGTTGG + Intergenic
1131866221 15:96713468-96713490 CATAGTGCCCAGCACTGAGTAGG - Intergenic
1132140842 15:99393132-99393154 CTTAGTGGGCAGCATATAGTTGG - Intergenic
1132523133 16:400635-400657 CACTGTGCCCAGCACATGGGTGG + Exonic
1133385877 16:5370052-5370074 AATGGTGCCCAGCACATAGTAGG - Intergenic
1133495681 16:6315076-6315098 CATTGTGCTTAGCACAAAGTCGG - Intronic
1133820708 16:9234024-9234046 CATTGGGCCCACTTTATAGTTGG + Intergenic
1134095441 16:11415584-11415606 CCTTGTGCCCTGCATGTAGTAGG - Intronic
1134674466 16:16079721-16079743 AATAGTGCCCAGTATATAGTAGG + Intronic
1134755936 16:16667397-16667419 CATAGTGCCCAGCATACAACAGG - Intergenic
1134756305 16:16670517-16670539 CACAGTGCCCAGCACATAGTAGG + Intergenic
1134784551 16:16929858-16929880 CATACTGCCTAGCATAGAGTAGG - Intergenic
1134838481 16:17382102-17382124 GAGAGTGCCCAGCACATAGTGGG - Intronic
1134989765 16:18688647-18688669 CACAGTGCCCAGCACATAGTAGG - Intergenic
1134990132 16:18691767-18691789 CATAGTGCCCAGCATACAACAGG + Intergenic
1135055802 16:19231280-19231302 CACTGTGCCCAGCATACAGAGGG - Intronic
1135072608 16:19365174-19365196 CATGGTGCCTGGCACATAGTAGG + Intergenic
1135074821 16:19384122-19384144 CACTGCGCCCAGCCTATAGAAGG + Intergenic
1135172012 16:20193013-20193035 CCTTGTGCTCAGCATACACTGGG + Intergenic
1135286823 16:21200770-21200792 CACTGTGCCTGGCATATGGTAGG + Intronic
1135645531 16:24158327-24158349 CCTTGTGCCTCACATATAGTAGG - Intronic
1135656082 16:24250897-24250919 AATAGTGCTCAGGATATAGTAGG - Intergenic
1135693385 16:24564463-24564485 CATTGTGCCCAGCAGACAAAAGG + Intronic
1136008920 16:27349687-27349709 CAATGTGCCTGGCACATAGTAGG - Intronic
1136046026 16:27615640-27615662 CACTGTGCCCGGCCTGTAGTGGG + Intronic
1136079115 16:27839994-27840016 CACTGTGCACAGCACAAAGTAGG + Intronic
1136105116 16:28024936-28024958 CAAAGTGCCCAGCACATAATAGG + Intronic
1136156169 16:28383715-28383737 CCTAGTGCTCAGCACATAGTAGG - Intronic
1136206917 16:28731573-28731595 CCTAGTGCTCAGCACATAGTAGG + Intronic
1136287253 16:29251830-29251852 CATGGTCCCCAGCAAATACTTGG + Intergenic
1136380874 16:29894889-29894911 CACTGTGCCCGGCCTATAGAGGG - Intronic
1136427854 16:30181171-30181193 AACAGTGCCCAGCACATAGTAGG + Intergenic
1137251055 16:46741218-46741240 AAGTGTGCCCAGCACATAGTGGG + Intronic
1137590911 16:49692916-49692938 CACTGTGCCAGGCACATAGTAGG + Intronic
1137627760 16:49920388-49920410 CTCAGTGCCCAGCACATAGTAGG - Intergenic
1137636443 16:49991089-49991111 CACTGTGCCCAGCCTAGTGTTGG - Intergenic
1138471372 16:57240622-57240644 CACAGTGCCCAGCACATATTAGG - Intergenic
1139084338 16:63565959-63565981 CATTGTGCCTGACATAGAGTAGG - Intergenic
1139500068 16:67355802-67355824 CACTGTCCCCAGCACACAGTGGG - Intronic
1139694152 16:68661597-68661619 CACTGTGCCCAGTACAAAGTAGG - Intronic
1139710039 16:68769175-68769197 AATTCTGCCCAGCATAGAGGAGG + Intronic
1140265159 16:73414322-73414344 CATAGTGCCTGGCACATAGTAGG - Intergenic
1141096746 16:81168341-81168363 CACAGTGCCCAGCACATAGCAGG + Intergenic
1141134046 16:81454213-81454235 CACTGTGCCCGGCACACAGTAGG - Intronic
1141141919 16:81502019-81502041 AATAGGGCCTAGCATATAGTAGG - Intronic
1141335478 16:83151014-83151036 CATGGTGACAAGCATATAGTAGG + Intronic
1141434739 16:83993588-83993610 CACTGTGTCCAGCACATAGTAGG - Intronic
1141596211 16:85098385-85098407 CGCTGTGCCTGGCATATAGTAGG - Exonic
1141895457 16:86956161-86956183 CAATGTGACCATCATAAAGTGGG + Intergenic
1142092867 16:88224463-88224485 CATGGTCCCCAGCAAATACTTGG + Intergenic
1142418226 16:89954609-89954631 CCTAGGGCCCAGCACATAGTAGG + Intronic
1142543826 17:684167-684189 CTTTGTTCCCATGATATAGTTGG - Intronic
1142722572 17:1786500-1786522 CACTGTGCCCAGCCTATCCTGGG + Intronic
1142727447 17:1826638-1826660 CTTTGTGCCAGGCACATAGTAGG - Intronic
1142948001 17:3451040-3451062 CATTGTAGACAGCATACAGTTGG - Intronic
1143156681 17:4841811-4841833 CACCGTGCCCAGCATATACTGGG - Intronic
1143766972 17:9144261-9144283 CCATGTGTCCAGCATCTAGTAGG + Intronic
1144326503 17:14186821-14186843 CAGTGTGCCCCACATACAGTTGG + Intronic
1144689239 17:17249201-17249223 AATGGTGCCTAGCAAATAGTAGG - Intronic
1144759510 17:17699513-17699535 CAGTGTGCCCAGCAATTACTAGG - Intronic
1145017230 17:19407285-19407307 CACTGTGCCCAGCACTTAGTAGG + Intergenic
1146146153 17:30418455-30418477 AATAGTGCCTGGCATATAGTAGG - Intronic
1146381960 17:32337170-32337192 CATTGTGCCCAGCCTACAGGTGG - Intronic
1146434762 17:32834089-32834111 GATGGTGCTCAGCATATTGTAGG + Intronic
1146504110 17:33389926-33389948 CATGGAGCCCAGCACAGAGTTGG - Intronic
1147319953 17:39640080-39640102 CACTGTGTCCAGCATACTGTAGG + Intronic
1147328676 17:39683518-39683540 CAAAGTGCCTGGCATATAGTAGG + Intronic
1148203907 17:45767757-45767779 CAGTGTGCCCAGCACATAGTAGG + Intergenic
1148348990 17:46925366-46925388 AATGGTGCACAGCACATAGTAGG - Intronic
1148838695 17:50480314-50480336 CATAGTGCCTGGCACATAGTAGG + Intronic
1148869185 17:50645930-50645952 AATGGTGCCTAGCACATAGTAGG - Intronic
1148997729 17:51725838-51725860 CACAGTGTCCAGCATAGAGTAGG - Intronic
1149019904 17:51950910-51950932 GATAGTGCACAGCATTTAGTAGG + Intronic
1149092385 17:52799562-52799584 CTTTGTACATAGCATATAGTTGG - Intergenic
1149344392 17:55719567-55719589 CATTATGCCTGGCATATAGTTGG + Intergenic
1149402509 17:56312708-56312730 CATAGTGCCTAGCACATAGTGGG - Intronic
1149434053 17:56618453-56618475 CATGGTGCCTGGCACATAGTAGG - Intergenic
1149440475 17:56669612-56669634 GTTTGTGCCCAGCACATGGTAGG + Intergenic
1149544028 17:57489730-57489752 CACTGTGCCCAGCACACAGTGGG - Intronic
1150494837 17:65599369-65599391 CACAGTGCCCAGCACATAGTAGG - Intronic
1150866476 17:68855922-68855944 CACTGTGCCCAGCCTAGAGTTGG - Intergenic
1153482281 18:5558749-5558771 AATTGTGCCTAACACATAGTAGG + Intronic
1154382747 18:13867396-13867418 CACTGTGCCCAGCTTAAATTTGG - Intergenic
1154938030 18:21080582-21080604 CCTTATGGGCAGCATATAGTTGG - Intronic
1154993377 18:21616972-21616994 CACTGTGCCCAGCCTATATCTGG + Intronic
1155193246 18:23449976-23449998 CATGGTGGCTGGCATATAGTAGG - Intergenic
1155261626 18:24049303-24049325 CATAGTGCCTGGCATGTAGTAGG - Intronic
1155473903 18:26218900-26218922 CATTGTGCCCAGCTGCAAGTAGG + Intergenic
1155528807 18:26744921-26744943 CACAGGGCCCAGCACATAGTAGG + Intergenic
1156108352 18:33692696-33692718 CATTTTGCCTAGCACATAGTAGG + Intronic
1156681213 18:39591042-39591064 CATTGTGCCTACCCCATAGTTGG + Intergenic
1157408219 18:47441455-47441477 CTTTGTGCTCAGCATAGAGCAGG + Intergenic
1157408651 18:47445386-47445408 CATAGTGCCTTGCATATAGTAGG + Intergenic
1157530964 18:48419993-48420015 CATAGTGCCCGGCATTTAGTAGG + Intergenic
1157946892 18:51990591-51990613 AATTGTGCCCATCATATTCTAGG + Intergenic
1158149240 18:54348662-54348684 CATGGTGCCTGACATATAGTAGG + Intronic
1158368212 18:56765151-56765173 TCTTGTGGGCAGCATATAGTGGG + Intronic
1158415574 18:57247179-57247201 CCATGTGCTCAGCATATATTAGG - Intergenic
1158533891 18:58290137-58290159 CTTTGTGCCAAGCATCGAGTGGG - Intronic
1158565933 18:58554291-58554313 CAGTCTGCCCAGCACAGAGTTGG + Intronic
1158577819 18:58654754-58654776 TATTGTAGGCAGCATATAGTTGG + Intergenic
1158846177 18:61445215-61445237 CATAGTGACCAGCACATGGTAGG - Intronic
1158921529 18:62196709-62196731 CATGGTGGCCTGAATATAGTTGG + Intronic
1159505929 18:69335448-69335470 TCTTGTGGGCAGCATATAGTTGG + Intergenic
1159942042 18:74415669-74415691 CACAGTGCCTGGCATATAGTTGG - Intergenic
1160439274 18:78876531-78876553 CATGGTGTCCAGCAGATAGGGGG - Intergenic
1161422456 19:4183393-4183415 CAGTGTGCCCAGTACAAAGTAGG - Exonic
1161609319 19:5232212-5232234 CATGGTGCCTGGCACATAGTAGG - Intronic
1161609429 19:5233005-5233027 CGTGGTGCCTGGCATATAGTAGG - Intronic
1162474807 19:10893637-10893659 CATTGTGCCCATTTTATAGATGG + Intronic
1162565760 19:11445279-11445301 CATGGGGCCAGGCATATAGTAGG + Intronic
1162722549 19:12670896-12670918 CACTGTGCCCAGCTGAGAGTAGG - Exonic
1163257577 19:16166609-16166631 TATGGTGCCCAACATGTAGTAGG - Intronic
1163257583 19:16166735-16166757 CATGGTGCCCAACACATAGTAGG - Intronic
1163601154 19:18249958-18249980 CACAGAGCCCAGCACATAGTAGG + Intronic
1163704673 19:18805215-18805237 CATTGTACCTGGCATATACTAGG + Intergenic
1164556937 19:29260387-29260409 CCCAGTGCCCAGCATATAGTTGG - Intergenic
1164732744 19:30518728-30518750 CTAGGTGCCCAGCACATAGTAGG - Intronic
1164945672 19:32291179-32291201 CATAGTGCCCAACACTTAGTAGG + Intergenic
1165298618 19:34951050-34951072 CTTTGTAGACAGCATATAGTTGG - Intergenic
1167029368 19:46947219-46947241 AACAGTGCCTAGCATATAGTAGG - Intronic
1167554146 19:50182577-50182599 CACAGTGCCCAGCATACGGTAGG + Intergenic
926292089 2:11539337-11539359 CATTGTGCCCAGCCAATAGCTGG + Intronic
927151076 2:20196547-20196569 CACTGTGCCTGGCACATAGTAGG + Intergenic
927260380 2:21082286-21082308 CACAGTGCCTAGCACATAGTTGG - Intergenic
927433676 2:23048538-23048560 CATTGTGCCTAGCACACAATAGG - Intergenic
927719622 2:25374187-25374209 CTTCGTGCCCAGCACACAGTTGG + Intergenic
928097132 2:28411666-28411688 CACTGTGCCCTGCACAAAGTAGG + Intronic
928427233 2:31189328-31189350 CATCGTGCCCTGCATATTGGAGG - Exonic
928430290 2:31212725-31212747 CATAGTGTCTAGCACATAGTAGG - Intronic
928485957 2:31731764-31731786 CCTTGTAGGCAGCATATAGTTGG - Intergenic
928797828 2:35045169-35045191 TATAGTGCACAGCACATAGTAGG - Intergenic
929400975 2:41581184-41581206 CAAAGTGCCTTGCATATAGTAGG - Intergenic
929634552 2:43504589-43504611 CACCATGCCCAGCCTATAGTAGG - Intronic
929644096 2:43610098-43610120 CACAGTGCCCAGAACATAGTAGG - Intergenic
930047875 2:47189335-47189357 CATGGTACCTAGTATATAGTAGG - Intergenic
930146733 2:48014880-48014902 CACAGTGTCCAGCATATAGTTGG + Intergenic
930166778 2:48210856-48210878 CACAGTCCCTAGCATATAGTAGG + Intergenic
930961330 2:57265911-57265933 CCTTGTAGGCAGCATATAGTTGG - Intergenic
931320876 2:61174072-61174094 AGCTGTGCCCAGCACATAGTGGG - Intergenic
931666191 2:64610948-64610970 CACTGTGCCCAGCCTATTGTTGG - Intergenic
931668974 2:64629892-64629914 AGCTGTGCCCAGCATATGGTAGG - Intergenic
931841351 2:66153051-66153073 TATTGTAGGCAGCATATAGTTGG + Intergenic
932166610 2:69513610-69513632 CACTGTGCCCAGCAGAAAGATGG + Intronic
932559689 2:72856167-72856189 CACAGTGACCAGCATGTAGTAGG + Intergenic
933059072 2:77712758-77712780 AATTGTGCCAGGCACATAGTAGG + Intergenic
934073907 2:88410845-88410867 TATTGTGTCTAGCACATAGTAGG + Intergenic
934749654 2:96785164-96785186 CACTGTGCCCAGCATTTACGGGG + Intronic
935018616 2:99208852-99208874 TCTTGTAGCCAGCATATAGTTGG + Intronic
935124212 2:100208674-100208696 CATGGTGCACAGCAGAAAGTGGG + Intergenic
935210640 2:100937075-100937097 CAGTGTGCCCAGCATAGAGTAGG + Intronic
936156654 2:110051332-110051354 CATGGTGCCTGGCATATGGTAGG + Intergenic
936188038 2:110320112-110320134 CATGGTGCCTGGCATATGGTAGG - Intergenic
936406339 2:112207896-112207918 TATTGTAGACAGCATATAGTTGG + Intergenic
936848329 2:116865425-116865447 CCCTGTACCCAGCACATAGTAGG - Intergenic
937390056 2:121478310-121478332 CACTGTGCCCAGCCTGTAGGTGG - Intronic
938933652 2:136109588-136109610 CACTGTGCCTGGCGTATAGTAGG - Intergenic
938965295 2:136382717-136382739 CCTTGCACCTAGCATATAGTAGG - Intergenic
938981250 2:136529312-136529334 CATAATGCCCAGCACATAGTAGG + Intergenic
939097737 2:137853996-137854018 CATGGTTCCCATCAAATAGTAGG + Intergenic
939097979 2:137857661-137857683 CATGGTTCCCATCAAATAGTAGG - Intergenic
939415758 2:141894759-141894781 CACTGTGCCCAGCATAAATTAGG - Intronic
939454477 2:142416134-142416156 CATAGAGCCCAACATATGGTAGG + Intergenic
939884162 2:147662994-147663016 CACAGTGCCTAGCATACAGTGGG + Intergenic
940712094 2:157174884-157174906 CATAGTTCCTAGCATGTAGTAGG + Intergenic
940760149 2:157729792-157729814 AGTTGTGCCAAGCACATAGTAGG + Intergenic
940997372 2:160164401-160164423 CACTGTGCCCAGCCTAAAATGGG - Intronic
941045861 2:160675358-160675380 CATTGTGGCCATCTTATAGAGGG + Intergenic
941123392 2:161558117-161558139 CACAGTGCCCAGCATATAATAGG + Intronic
941981349 2:171460822-171460844 CACTGTGCCCAGCTGATAGTGGG + Intronic
942070397 2:172310906-172310928 TACAGTGCCTAGCATATAGTCGG - Intergenic
942640774 2:178058676-178058698 CATGGTACCTAGCACATAGTAGG - Intronic
942935240 2:181548198-181548220 CAAAGTGCCTGGCATATAGTAGG + Intronic
943340517 2:186675059-186675081 CAGTGTGATCAGCATATAGAAGG + Intronic
943546167 2:189281893-189281915 CAGTGCGCCCAGCCTATAATGGG - Intergenic
943722768 2:191222289-191222311 CACTGTACCTAGCACATAGTAGG + Intergenic
943742401 2:191424332-191424354 CACAGTGCCTAGCATAGAGTAGG - Exonic
943764682 2:191648060-191648082 CATTGTCCTCACCATGTAGTGGG - Intergenic
943900231 2:193424634-193424656 CATAGTGCCCAACATATTCTAGG + Intergenic
944791606 2:203135292-203135314 AACTGTGCCTAGCACATAGTAGG + Intronic
945198535 2:207259337-207259359 CATTGTCCCCAGCAGAGAATAGG - Intergenic
945349140 2:208756624-208756646 CATAGATCCGAGCATATAGTAGG - Intronic
945478717 2:210319063-210319085 CCTAATGCCTAGCATATAGTAGG - Intergenic
945681814 2:212923284-212923306 CACTGTGCCCTGCACACAGTAGG + Intergenic
946236133 2:218325492-218325514 CATTGCGCCCAGCCCATATTTGG + Intronic
946645543 2:221829541-221829563 CATGCTGCCGAGCTTATAGTAGG + Intergenic
946824574 2:223663946-223663968 CACTGTGCCCAGCCTGTATTTGG - Intergenic
947333844 2:229059400-229059422 CCTTGTGCCTAGCACATAATAGG - Intronic
947363653 2:229372122-229372144 CACTGTGCCTGGCACATAGTAGG - Intronic
947599269 2:231435493-231435515 CACTGTGCCCGGCCAATAGTTGG + Intergenic
948647741 2:239418503-239418525 CATGCTGCCCAGCAAGTAGTGGG + Intergenic
948732438 2:239975590-239975612 CATAGTGCCCAGCACACAGAAGG + Intronic
1168998455 20:2149460-2149482 TATTGGGCCCAGCACATAGTAGG + Intronic
1169452797 20:5726557-5726579 CATTGTACCCGGCTGATAGTGGG - Intergenic
1169770349 20:9193105-9193127 CACAGTGCCCAGCACATGGTAGG - Intronic
1169885033 20:10389675-10389697 AACAGTGCCCAGCACATAGTGGG + Intergenic
1170372293 20:15662413-15662435 CATTGTGACTGGCACATAGTAGG + Intronic
1171116289 20:22527396-22527418 CACTGTGCCCAGCCTATTGCAGG - Intergenic
1171959965 20:31486168-31486190 CACTGTGCCCGGCACTTAGTAGG - Intergenic
1172012732 20:31855719-31855741 CACTGTGCCTGGCACATAGTAGG - Intronic
1172120586 20:32596451-32596473 CACAGTGCCCGGCACATAGTAGG + Intronic
1172122793 20:32608498-32608520 TCTTGTCCCCAGCACATAGTAGG - Exonic
1172164516 20:32890885-32890907 CATAGTGCCTGGCACATAGTGGG + Intronic
1172303980 20:33868713-33868735 CACAGTGCCCAGCACACAGTAGG + Intergenic
1172457659 20:35090660-35090682 CACTGTGCCCAGCCTCTGGTGGG + Intronic
1172801310 20:37578250-37578272 CGCTGTGCCCAGCACACAGTAGG - Intergenic
1172816461 20:37691067-37691089 AATTGTGCCTAGCATTGAGTAGG + Intergenic
1172929834 20:38578420-38578442 CACAGTGCCTTGCATATAGTAGG + Exonic
1173010006 20:39173721-39173743 AACTGTGCCTAGCACATAGTAGG - Intergenic
1173236598 20:41251644-41251666 TTTTGTGAACAGCATATAGTTGG - Intronic
1173354205 20:42271557-42271579 CATTGTGCCTGACACATAGTAGG + Intronic
1173464536 20:43270576-43270598 CACTGTGCCCAGCTCATAGTAGG + Intergenic
1173579468 20:44137086-44137108 CATTGTGCCCAGCACATAGTAGG + Intronic
1173908500 20:46646463-46646485 AGTGGTGCTCAGCATATAGTGGG - Intronic
1174279757 20:49430704-49430726 CATGGTGCCTGGCATATAGTCGG - Intronic
1174399289 20:50267372-50267394 CAGAGTGCCCAGCATGTGGTAGG - Intergenic
1174410790 20:50333780-50333802 CACAGTGCCTGGCATATAGTTGG - Intergenic
1174799961 20:53555196-53555218 CATTCTGCCCAGTACATCGTAGG - Intergenic
1174932266 20:54828934-54828956 CATAGTGCCTGGCATACAGTTGG + Intergenic
1175039724 20:56037289-56037311 TATAGTGCCTACCATATAGTTGG + Intergenic
1175072809 20:56348703-56348725 CATTGTGCCTGGCATTGAGTAGG + Intergenic
1175170369 20:57076123-57076145 CCTGGTGCCCAGCATTTGGTGGG - Intergenic
1175320764 20:58086498-58086520 CATAATGCCTAGCACATAGTAGG + Intergenic
1175463080 20:59169475-59169497 CACTGTGCCCAGCCTAAAATTGG - Intergenic
1177051067 21:16234592-16234614 CATGGTGCCTAGCAGATAGTTGG - Intergenic
1177072669 21:16530038-16530060 CATTGTAGACAGCATATAATTGG + Intergenic
1177519438 21:22199468-22199490 CCTTGTACACAGCATATATTTGG + Intergenic
1178335853 21:31742485-31742507 TTTTGTGGACAGCATATAGTTGG + Intergenic
1179346932 21:40567223-40567245 TACTGTGCCTAGCAAATAGTTGG + Intronic
1179541102 21:42083694-42083716 CATTGTGCCCGGCACATAGCAGG + Intronic
1179666047 21:42913298-42913320 CATAGTGCCTAGCATATAGTAGG - Intronic
1180890442 22:19284277-19284299 CCTTGTGCCTAGCATATGGATGG + Intronic
1181064983 22:20301244-20301266 CCTTGTGGCCAGGATGTAGTGGG + Intergenic
1181153635 22:20903154-20903176 CATTGTGCCTGGCACAGAGTAGG + Intergenic
1181765007 22:25085170-25085192 CACAGTGCCCAGCACAGAGTAGG - Intronic
1181930655 22:26398727-26398749 CACAGTGCCCAGCACAGAGTAGG + Intergenic
1182083612 22:27546109-27546131 CACACTGCCCAGCACATAGTAGG - Intergenic
1182392526 22:30010921-30010943 CACAGTGCCTAGCATACAGTAGG - Intronic
1182539829 22:31032888-31032910 CATTGTGGCCATCATTTATTAGG - Intergenic
1182909231 22:33966942-33966964 CACAATGCCCAGCATATAGTTGG - Intergenic
1183108824 22:35633318-35633340 CATAGTGGCCAGCACATAGTAGG + Intronic
1183214318 22:36469285-36469307 CATTGTGCCTGGCATACTGTGGG + Intronic
1183236428 22:36622207-36622229 GCTTGTGCCTAGCACATAGTTGG - Intronic
1183239189 22:36643361-36643383 GATAGGGCACAGCATATAGTTGG - Intronic
1183372276 22:37440183-37440205 AATAGTGCCCAGCACATAGTTGG + Intergenic
1183383173 22:37500607-37500629 CATGGTGCCCAGTACAAAGTGGG + Intronic
1183432073 22:37771995-37772017 CACAGTGCCCAGGATATAGTAGG - Intronic
1183537415 22:38411127-38411149 CATGGGGCCCAGCACATAGTGGG - Intergenic
1183609259 22:38886746-38886768 AATTATGCCCAGTACATAGTAGG - Intergenic
1183669515 22:39264273-39264295 CACCGTGCCCAGCACACAGTGGG - Intergenic
1183786656 22:40032931-40032953 CATGGTGACTGGCATATAGTAGG - Exonic
1183874354 22:40766226-40766248 AATTGTGACTAGCATTTAGTGGG + Intergenic
1184110320 22:42390289-42390311 GCTTCTGCCCATCATATAGTAGG + Intronic
1184153199 22:42650007-42650029 CACAGAGCCTAGCATATAGTAGG + Intergenic
1184272101 22:43390340-43390362 CACAGTGCCCGGCACATAGTAGG + Intergenic
1184461752 22:44641666-44641688 CACAGTGCCCAGCATATAGCAGG - Intergenic
1184493585 22:44824530-44824552 CACAGTGCCCGGCACATAGTAGG + Intronic
949952469 3:9240582-9240604 CGTAGTGCCCACCATCTAGTTGG - Intronic
950236983 3:11331087-11331109 CATTGTGCCTGGCAGAAAGTAGG - Intronic
950706607 3:14786321-14786343 CACAGTGCCCAGCACACAGTAGG + Intergenic
951493019 3:23293428-23293450 TATTGTGTCTGGCATATAGTAGG + Intronic
951596830 3:24327538-24327560 AATTGTGCCTGGCACATAGTAGG - Intronic
951796114 3:26540400-26540422 CAAAGTACCTAGCATATAGTAGG - Intergenic
951919919 3:27843128-27843150 CATTGTGCCTAGCATGGAGTAGG + Intergenic
952114604 3:30163646-30163668 AATAGTGCCTACCATATAGTAGG + Intergenic
952214666 3:31266009-31266031 TAATGTGCCTAGCATGTAGTAGG - Intergenic
952300467 3:32100235-32100257 CACAGTGACCAGCACATAGTAGG + Intergenic
952339107 3:32430497-32430519 CCTAGTGCCCAGCACATAGTAGG - Intronic
952523931 3:34189777-34189799 CATTTTGCTCAGCATTTGGTGGG + Intergenic
952616961 3:35285255-35285277 TCTTGTGGGCAGCATATAGTTGG - Intergenic
953035254 3:39205589-39205611 AAGAGTGCCCAGCATAGAGTGGG - Intergenic
953138684 3:40206740-40206762 CACAGTGCTCAGCACATAGTAGG + Intronic
953188782 3:40663990-40664012 CAGAGTTCCCAGCACATAGTAGG + Intergenic
955065261 3:55528481-55528503 CTCAGTGCCCAGCACATAGTAGG - Intronic
955325590 3:58007612-58007634 CATTGTGCCCAGCCCATTGCAGG + Intergenic
955397792 3:58569403-58569425 CTCAGTGCCCAGCACATAGTAGG + Intronic
955745318 3:62134755-62134777 CGCTGTGTCCAGCAAATAGTAGG + Intronic
955776568 3:62440142-62440164 AATGGTACCTAGCATATAGTAGG + Intronic
956320407 3:67990104-67990126 AATCATGCCCAGCATATTGTAGG + Intergenic
956860924 3:73322823-73322845 AATTCTGCCCAGCACACAGTAGG + Intergenic
956957400 3:74356599-74356621 CCTAGTGCCTAGCATATAGTAGG + Intronic
957246406 3:77722085-77722107 CTTAGTTCCCAGCACATAGTAGG + Intergenic
957417567 3:79926343-79926365 CACAGTGCCTAGCATTTAGTTGG + Intergenic
958689090 3:97438587-97438609 CAGTATGCCTAGCATATTGTAGG - Intronic
958934858 3:100245476-100245498 TATAGTGCCTGGCATATAGTAGG - Intergenic
959090893 3:101901553-101901575 CACAGTGCCTAGCATAAAGTAGG - Intergenic
959946973 3:112135260-112135282 TACAGTGCCCAGCACATAGTAGG - Intergenic
960240532 3:115336316-115336338 CATACTGCCCAGAACATAGTAGG - Intergenic
960623586 3:119659480-119659502 CATTGTTCCCTGAATACAGTTGG + Intronic
960661055 3:120059338-120059360 CAGAATGCCTAGCATATAGTCGG + Intronic
960857548 3:122118777-122118799 CATGGTGCCTGGCATATAGCAGG + Intronic
961850671 3:129814631-129814653 CCTTGTAGGCAGCATATAGTTGG - Intronic
962221707 3:133569919-133569941 CATAGGGCCCGGCATATAGTAGG + Intergenic
962351895 3:134662500-134662522 CATAGGGCCCAGCATAGAGTGGG - Intronic
962551874 3:136501891-136501913 CACTGTGCCCGGCCTATACTGGG - Intronic
962721696 3:138181615-138181637 CATTGTGCCTGGCACATAGTAGG + Intergenic
962734158 3:138309394-138309416 CACTGTGCCCAGCCAACAGTGGG - Intronic
963272806 3:143302304-143302326 CATACTGCCCAGAATACAGTAGG + Intronic
963573011 3:147020971-147020993 CCTTGTAGGCAGCATATAGTTGG - Intergenic
963631936 3:147744225-147744247 CACAGTGCCCAGCACATAGTAGG - Intergenic
963768416 3:149363130-149363152 AATAGTGCCTGGCATATAGTAGG - Intergenic
964009676 3:151876894-151876916 CACAGTGACCAGCAGATAGTAGG - Intronic
964493779 3:157266588-157266610 CATGGTGCCTGGCAAATAGTAGG + Intronic
964512220 3:157465212-157465234 AATAGTGCCTGGCATATAGTAGG - Intronic
964594641 3:158410597-158410619 CATAGTTCCTAGCATATAGAAGG + Intronic
964667330 3:159188798-159188820 CAATGTGCCCAGCTCATAGTAGG + Intronic
964727181 3:159825641-159825663 CACAGTGCCAGGCATATAGTAGG - Intronic
965329638 3:167355278-167355300 CATTGTGTCCAGCACATAGACGG - Intronic
965511841 3:169576280-169576302 TATTGTGCCTAGCATACTGTTGG - Intronic
965549163 3:169946748-169946770 CATGGTGCCCACCTTATAGCTGG + Intergenic
965622105 3:170652069-170652091 GAATGTGCCTGGCATATAGTGGG + Intronic
965729260 3:171753505-171753527 CATGGTGCTCAGCACATAGAAGG - Intronic
965925702 3:173976991-173977013 CATTGTGCCTGGCACATGGTAGG - Intronic
966160395 3:176961553-176961575 AATAGTGCCCAGCATTCAGTAGG - Intergenic
966398862 3:179527339-179527361 CGTTGTGCCCAGAATACAGTTGG + Intergenic
966415473 3:179685029-179685051 AACAGTGCCTAGCATATAGTAGG + Intronic
966437895 3:179908978-179909000 CATAATGCCCAGCACATAGTAGG + Intronic
966785829 3:183621846-183621868 CATAGTGTGCAGCACATAGTGGG - Intergenic
967007535 3:185398672-185398694 CATGGTGCCTAGCATGTAGCAGG + Intronic
967108398 3:186272056-186272078 CATGGTGCCTGGCACATAGTGGG + Intronic
967713490 3:192736712-192736734 CATTGTGCCCAGCATATAGCAGG + Intronic
967763198 3:193248322-193248344 TATTGTAGGCAGCATATAGTTGG + Intronic
969107332 4:4817570-4817592 CATAGTTTCCTGCATATAGTAGG + Intergenic
969242325 4:5908108-5908130 CACAGTGCCTGGCATATAGTAGG - Intronic
969302574 4:6305856-6305878 GTATGTGTCCAGCATATAGTGGG - Intergenic
970492587 4:16589993-16590015 AATTGTGCCTGGCATGTAGTAGG + Intronic
970500938 4:16676494-16676516 CATTGTGCCTTGCACAGAGTGGG - Intronic
970509159 4:16763183-16763205 CATAGTGCCAGGCATATAATAGG + Intronic
970671874 4:18406012-18406034 CATTGTACGTAGCACATAGTGGG - Intergenic
970882858 4:20952002-20952024 CATGGTGCCTAGCACAGAGTGGG + Intronic
970888288 4:21012188-21012210 CATTGTGCTTGGTATATAGTAGG + Intronic
971050626 4:22857972-22857994 CAATATGCCCAGCATGTAGTAGG + Intergenic
971348277 4:25831902-25831924 CATAGTGCCTTGCATACAGTAGG + Intronic
971369973 4:26010976-26010998 CATTTTGCCCAGCATTTTTTGGG + Intergenic
971627007 4:28934193-28934215 CATTAGGGCCAGCATACAGTAGG + Intergenic
971869151 4:32213591-32213613 AATGGTGCCCATCATATTGTAGG + Intergenic
972311140 4:37884650-37884672 CATGGAGCCCAACACATAGTAGG - Intergenic
972369321 4:38407516-38407538 AATAGTGCCTGGCATATAGTAGG - Intergenic
972692991 4:41417810-41417832 CACTGTGCCCAGCCTCTAGAGGG + Intronic
972863408 4:43200751-43200773 GATTGTGCCTGGCATATATTAGG - Intergenic
973064903 4:45777232-45777254 GATGATGCCCAGTATATAGTAGG + Intergenic
973740799 4:53917464-53917486 AATGGTGCCCAGCATGTAGTAGG + Intronic
973740809 4:53917535-53917557 AATGGTGCCTAGCATGTAGTAGG + Intronic
974831411 4:67193856-67193878 CACTGTGCTCAGCATATAGTAGG + Intergenic
975589811 4:75988684-75988706 CATTGTGCCTTACATATAGCAGG + Intronic
975681256 4:76878821-76878843 CATTGTGCCTAGAATAAAGCAGG + Intergenic
976222965 4:82772862-82772884 CATAGTGCCTGGCATCTAGTAGG + Intronic
976704115 4:88004142-88004164 TATTGTGCCTGGCATATAGTAGG + Intergenic
977664409 4:99629032-99629054 CATACTGCCCAGCACATACTTGG + Intergenic
977847731 4:101786000-101786022 CTCAGTGCCCAACATATAGTAGG + Intronic
978740769 4:112135593-112135615 CAAAGTGCCCAGTATGTAGTTGG - Intergenic
978811424 4:112853935-112853957 CATTATTCCTAGCATGTAGTTGG - Intronic
978991815 4:115092931-115092953 CATTGTAAACAGCATATACTTGG - Intronic
979021140 4:115500034-115500056 CATTGTGCCCGGCACGTATTAGG + Intergenic
979491191 4:121329925-121329947 CCTGGTGTCCAGCATATAGTAGG + Intronic
979912262 4:126382268-126382290 CATTGTGCCCTGCACCTATTAGG - Intergenic
980073925 4:128273425-128273447 CACTGTGCCTGGCATAAAGTAGG + Intronic
980176677 4:129354449-129354471 GATAGTGCCCAGCAAATAGTAGG - Intergenic
980634571 4:135483604-135483626 CTTGGTGCCAAGCATATGGTAGG + Intergenic
981515244 4:145600948-145600970 CTTTGTCCCCAGAAAATAGTTGG - Intergenic
981612999 4:146616163-146616185 AAGTGTGCCCAGTCTATAGTGGG + Intergenic
981815493 4:148826458-148826480 CATGGTGCCAGGCATATGGTAGG + Intergenic
981831412 4:149006411-149006433 CATTTTGCCTAGCACATAGTAGG - Intergenic
981909655 4:149964396-149964418 TATTGTTCCCAGAAGATAGTTGG - Intergenic
981995600 4:150970863-150970885 AATAATGCCCAGCACATAGTAGG - Intronic
982183515 4:152773006-152773028 CACTGTGCCCGGCCTAAAGTAGG + Intronic
982628467 4:157799965-157799987 TCTTGTGGCCAGCATATAATTGG + Intergenic
983677592 4:170314053-170314075 AATGGTGGCCAGCATGTAGTAGG - Intergenic
983884334 4:172963524-172963546 CATAGTGTCTAGCATATAGTAGG + Intronic
984916031 4:184725658-184725680 CAAAGTACCCTGCATATAGTGGG + Intronic
986965945 5:13271251-13271273 AATAGTGCCTAGCATGTAGTAGG + Intergenic
988642641 5:33058250-33058272 AATTGTGCCTGGCACATAGTAGG - Intergenic
988699715 5:33661209-33661231 AATAGTGCCTAGTATATAGTAGG + Intronic
989196495 5:38721761-38721783 CATTGTGCCTGGTACATAGTAGG - Intergenic
989524331 5:42435886-42435908 CTTTGTGCCCAGCATGATGTTGG - Intronic
990135363 5:52638224-52638246 CATGGTGCCCACCAAATAGAAGG - Intergenic
990208042 5:53451229-53451251 CATAGGGCCTAGCACATAGTAGG + Intergenic
991344266 5:65645994-65646016 CATGGTGCCTGGCACATAGTAGG - Intronic
991595896 5:68305203-68305225 AATAGTGTCCAGCAAATAGTAGG - Intergenic
991989875 5:72326930-72326952 CTTAGCACCCAGCATATAGTAGG - Intronic
992276101 5:75120844-75120866 TCTTGTGGGCAGCATATAGTTGG - Intronic
992497955 5:77311619-77311641 CATGATGCCCAGCACATAGTAGG + Intronic
993118926 5:83751367-83751389 CACTGTGCCCGGACTATAGTAGG + Intergenic
993346139 5:86785067-86785089 TCTTGTGCCTAGCACATAGTAGG + Intergenic
993680943 5:90877020-90877042 CAGTCTGTACAGCATATAGTGGG + Intronic
994093562 5:95828821-95828843 CACTGAGCCCAGCACACAGTAGG - Intergenic
994133014 5:96252363-96252385 CTCAGTGCCAAGCATATAGTAGG - Intergenic
994604548 5:101951365-101951387 CATGGTGCCTGGCACATAGTTGG - Intergenic
995049132 5:107682544-107682566 CATTGTGCACAGCATGTAGTAGG + Intergenic
995061197 5:107813469-107813491 CCCTGTGCCTAGCACATAGTGGG - Intergenic
995099454 5:108280749-108280771 TCTTGTGATCAGCATATAGTTGG - Intronic
995778250 5:115748283-115748305 CATGGTGCCAAGCACTTAGTAGG + Intergenic
996798385 5:127375775-127375797 CATTGTGCCTGGCATGTGGTTGG + Intronic
996942260 5:129022311-129022333 CACAGTGTCCAGCATATAGTTGG + Intronic
997498786 5:134354577-134354599 AATAGTGCCTGGCATATAGTAGG - Intronic
998122597 5:139591083-139591105 CACTGTGCCCAACCTATGGTGGG + Intronic
998197662 5:140089075-140089097 AATAGTACCCAGAATATAGTAGG - Intergenic
998254380 5:140573590-140573612 CACTGGGCCCAGCATACAGTGGG + Intronic
998392937 5:141799098-141799120 CATAGGGCCTGGCATATAGTAGG + Intergenic
998453813 5:142255063-142255085 CAGTGTGCTCAGCAAATAATAGG + Intergenic
998786579 5:145716244-145716266 AATAGTGCCCAGCACATGGTGGG + Intronic
998804075 5:145901442-145901464 CATTGTGTCAAGCACATAGTAGG - Intergenic
998849872 5:146342419-146342441 CATAGTGCCCTGTACATAGTAGG + Intergenic
998963727 5:147514640-147514662 CATTCTGCCTGGCATACAGTAGG + Intergenic
999492958 5:152069674-152069696 TACAGTGCCTAGCATATAGTAGG - Intergenic
999671793 5:153964953-153964975 CAGGGTGCCAAGCATATACTTGG + Intergenic
999837531 5:155390681-155390703 CATAGTGACTAGCACATAGTAGG + Intergenic
1000091206 5:157931139-157931161 AAATTAGCCCAGCATATAGTGGG - Intergenic
1000508684 5:162154378-162154400 CATAGTGCCTGGCATATAGTTGG + Exonic
1000520271 5:162286200-162286222 AAGTGTGCTCAACATATAGTAGG + Intergenic
1000692275 5:164338410-164338432 CAGTGTGACTAGCATTTAGTAGG + Intergenic
1001321974 5:170690093-170690115 CACGGTGCCCAGCACATAGTAGG + Intronic
1001427069 5:171629640-171629662 CATTGTGCCTGGCACATAGTGGG + Intergenic
1001572737 5:172741184-172741206 AATAGTGCCCGGCACATAGTAGG - Intergenic
1001590942 5:172864766-172864788 CACTGTGCCCAGCATATAATAGG - Intronic
1001601199 5:172929777-172929799 CCCAATGCCCAGCATATAGTAGG - Intronic
1001844491 5:174910020-174910042 CTCTGTGCCCAGCACACAGTAGG + Intergenic
1001858413 5:175032588-175032610 CGTTGTGCCTAGCACATAGTAGG + Intergenic
1002113280 5:176936200-176936222 CATTGTGACTAGCATGTAATAGG - Intronic
1002687728 5:181027491-181027513 TTTTGTGGGCAGCATATAGTTGG - Intergenic
1003013148 6:2445296-2445318 GAACGTGCTCAGCATATAGTGGG + Intergenic
1003052534 6:2792897-2792919 CATGGTGCCCAGCATATGGCAGG - Intergenic
1003442448 6:6155779-6155801 CATTGTTCTCAGCATTTTGTAGG - Intronic
1003897575 6:10622228-10622250 AATATTGCCCAGCATATACTGGG + Intronic
1004056658 6:12145845-12145867 GATTGTGCCTGGCAAATAGTAGG + Intronic
1004548694 6:16625601-16625623 CATCGTGCCTGGCATTTAGTAGG - Intronic
1004559670 6:16735941-16735963 CATAGTACTCTGCATATAGTAGG + Intronic
1004630182 6:17413539-17413561 CATTGTGCCTAGTAGACAGTGGG + Intronic
1004756460 6:18615795-18615817 CATTTTGCACAGCATATATGTGG + Intergenic
1004897346 6:20161559-20161581 CACTGTGCCCAACACATGGTAGG - Intronic
1005193989 6:23260924-23260946 CATTGTTCACAGTATATAGAAGG - Intergenic
1005503607 6:26451095-26451117 CATAGAGCCCAGCATAGAGACGG + Intronic
1006732323 6:36245616-36245638 CCCTGTGCCCAGCACACAGTAGG + Intronic
1007005696 6:38360302-38360324 AATGGTACCTAGCATATAGTAGG + Intronic
1007078694 6:39083967-39083989 CACAGTGCCCAGCATACAGCAGG - Intronic
1007304154 6:40891366-40891388 CACAGTGCCTAGCACATAGTAGG - Intergenic
1007338307 6:41171301-41171323 CATGGTGCCTGGCACATAGTAGG - Intergenic
1007441339 6:41863693-41863715 GATAGTGCCTAGCATATAGAAGG + Intronic
1007462417 6:42028121-42028143 CACTGTGCCTAGCATGTGGTAGG + Intronic
1007496950 6:42266722-42266744 AAAAGTGCCCAGCACATAGTAGG + Intronic
1007698706 6:43750820-43750842 AATAGTGCCTAGCACATAGTAGG + Intergenic
1008023053 6:46602096-46602118 CACAGTGTCCAGCATACAGTAGG + Intronic
1008247614 6:49197481-49197503 CTTTCTGCCCAGGACATAGTAGG + Intergenic
1008702200 6:54114766-54114788 AATAGTGCCTAGCATTTAGTAGG + Intronic
1009297524 6:61971949-61971971 AATTGTGCCTGGCATATATTTGG + Intronic
1010461956 6:76123812-76123834 CATTGTGCCATGTATATAGTTGG - Intergenic
1011068019 6:83350202-83350224 CATAGTGCCTGGCACATAGTAGG - Intronic
1011781508 6:90794936-90794958 CATAATGCCAAGCACATAGTAGG - Intergenic
1012921861 6:105228291-105228313 CACTGTGCCCAGCCAATAGAAGG - Intergenic
1013166732 6:107600834-107600856 TTTTGTGCCCTGCACATAGTAGG - Intronic
1013281428 6:108640846-108640868 AATTGTGCCCAGCACATAGTAGG - Intronic
1013403054 6:109817397-109817419 CAATGTGTCCAGCATATGGGAGG + Intronic
1014226559 6:118854639-118854661 CATTGTGCCCAGCCTCATGTAGG + Intronic
1014260585 6:119212126-119212148 CACTGTGCCCGGCCAATAGTAGG + Intronic
1014284662 6:119483144-119483166 CATGGTGCCCAGCACATAACAGG + Intergenic
1014463898 6:121731053-121731075 CACTGAGCCCAGCATATTCTTGG - Intergenic
1014637668 6:123868154-123868176 CACTGTGCCCAGCCTGTACTGGG + Intronic
1014705644 6:124743034-124743056 CAGTGTGTCCAGCACATTGTAGG + Intronic
1016195817 6:141338117-141338139 CCTTGTATGCAGCATATAGTTGG - Intergenic
1016466807 6:144333930-144333952 CACAGTGCCTAGCACATAGTAGG - Intronic
1016492219 6:144618679-144618701 CATTGTGCCAAGTACATAGTAGG - Intronic
1017111868 6:150940197-150940219 CAGAGTGCCCAGCACATAGTAGG + Intronic
1017170647 6:151451588-151451610 AATAGCGCCCAGCACATAGTAGG + Intronic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1017551684 6:155516521-155516543 TATTGTGAACAGCATATAGTTGG + Intergenic
1018310085 6:162499482-162499504 CATGGTACCCAGCAAATTGTAGG + Intronic
1018703277 6:166444889-166444911 CAGAGTACCCAGCATATAGCAGG + Intronic
1018884893 6:167926876-167926898 CACAGTCCCCAGCATATAGTAGG + Intronic
1020617204 7:10474562-10474584 AACTGTGCCTAGTATATAGTAGG + Intergenic
1020650404 7:10868201-10868223 CATGGTACCAAGCACATAGTAGG + Intergenic
1020650408 7:10868228-10868250 CATAGTGCCGAGAACATAGTGGG + Intergenic
1020866072 7:13564312-13564334 CACAGAGCCTAGCATATAGTAGG - Intergenic
1021478459 7:21089294-21089316 CACAGTGCCCAGCATGTGGTTGG + Intergenic
1021943920 7:25706589-25706611 CATTCTGCCCAGGATTTACTGGG - Intergenic
1022249751 7:28595387-28595409 CATAGTGCCTGACATATAGTAGG + Intronic
1022266038 7:28755921-28755943 CATGGAACCCAGCACATAGTAGG - Intronic
1022320382 7:29282312-29282334 CACTGTACCCTGCACATAGTGGG - Intronic
1022400288 7:30029601-30029623 CACAGTTTCCAGCATATAGTAGG - Intronic
1022408133 7:30111915-30111937 TATTGTGAACAGCATATGGTTGG - Intronic
1022809217 7:33852369-33852391 CACTGTGCCTGGCACATAGTTGG + Intergenic
1022851811 7:34271021-34271043 CATTGTGCCCAAGATGTAGGAGG + Intergenic
1023200397 7:37691220-37691242 TATTGTGAACAGCATATAGTTGG + Intronic
1023518987 7:41031966-41031988 CCCTGTGCCCAGTATCTAGTAGG + Intergenic
1023761932 7:43472467-43472489 AATCGTGCCTAGTATATAGTTGG + Intronic
1024803126 7:53104046-53104068 CTTTTTGGACAGCATATAGTTGG - Intergenic
1026339490 7:69423194-69423216 TCTCGTGCCCAGCACATAGTAGG - Intergenic
1026401972 7:70023131-70023153 CACTGTGCCCAGCCTCTAATTGG + Intronic
1027219272 7:76203630-76203652 CATTGTGCCCAGCATGGAGCTGG - Intronic
1027225609 7:76241826-76241848 CACAGTGCCTGGCATATAGTAGG - Intronic
1027293230 7:76737689-76737711 TATATTGCCCAGCACATAGTAGG - Intergenic
1027582313 7:80013681-80013703 CCTTGTAGGCAGCATATAGTTGG + Intergenic
1027628513 7:80574365-80574387 TATTGTAAGCAGCATATAGTTGG + Intronic
1028141218 7:87276821-87276843 TCTTGTGGGCAGCATATAGTTGG + Intergenic
1028383122 7:90221524-90221546 TCTTGTACCCAGCATATACTTGG + Intronic
1028598702 7:92576306-92576328 AATTGTGCCTAACAGATAGTAGG + Intronic
1028922497 7:96322975-96322997 CACAGTGCCTAGCACATAGTAGG - Intergenic
1029009531 7:97243922-97243944 CACTGTGCCCAGCCAAGAGTTGG + Intergenic
1029165884 7:98590111-98590133 CCTTGTGCCTTGCACATAGTAGG + Intergenic
1029598820 7:101551873-101551895 CACTGTGGCCAGCACATAGTAGG - Intronic
1029976103 7:104835506-104835528 AACTGTGCCTAGCACATAGTAGG - Intronic
1030631949 7:111905922-111905944 CAAAGTACCCAGCACATAGTAGG - Intronic
1030651532 7:112121079-112121101 CACTGTGTCTGGCATATAGTAGG - Intronic
1030924300 7:115432273-115432295 CATAGAGCCTATCATATAGTTGG + Intergenic
1030981487 7:116190005-116190027 TCTTGTAGCCAGCATATAGTTGG - Intergenic
1031977261 7:128102053-128102075 CCTTGTGCCCAGCAGAGAGTAGG - Intergenic
1032439896 7:131934611-131934633 CATAGTGCCTAGCATATTGTAGG - Intergenic
1032523886 7:132564622-132564644 CATAGTGCCTAGCACACAGTAGG + Intronic
1032566956 7:132956356-132956378 CACAATGCCTAGCATATAGTAGG + Intronic
1032609752 7:133400010-133400032 CATTGTGCCTAACACATAGATGG - Intronic
1032987494 7:137354621-137354643 CTTGGGGCCCAGCATACAGTGGG - Intergenic
1033374585 7:140745762-140745784 CATAGTGCTTTGCATATAGTTGG + Intronic
1033719042 7:144037439-144037461 CACTGTGCCTAGAATATTGTAGG + Intergenic
1035349024 7:158230904-158230926 TATTGTGGGCAGCTTATAGTTGG - Intronic
1035627824 8:1086500-1086522 TCTTGTGGGCAGCATATAGTTGG - Intergenic
1035862391 8:3043539-3043561 CATGGTGCCCAGCATAGAGTAGG + Intronic
1035933441 8:3810152-3810174 CATAGTGCCAGGCATATAGCAGG + Intronic
1037435305 8:18856372-18856394 CATAGTGGCCAGCACATACTGGG - Intronic
1037701078 8:21274261-21274283 CATAATGCCTAGCACATAGTAGG + Intergenic
1037955862 8:23057956-23057978 CATTGTGCCCAGCCAAGAGATGG - Intronic
1038657390 8:29466292-29466314 CATGGTACCTGGCATATAGTAGG + Intergenic
1038823504 8:30975672-30975694 CATAGTGTCTAGCATATGGTGGG + Intergenic
1039300753 8:36206240-36206262 AAATGTGCCTAGCACATAGTAGG + Intergenic
1039521373 8:38175231-38175253 CATAGTGCCCAGCTAATTGTAGG + Intronic
1040833684 8:51708374-51708396 CATTGTGCAGAGCCTACAGTAGG - Intronic
1041628814 8:60061832-60061854 GCCTGTGCCAAGCATATAGTAGG - Intergenic
1042119485 8:65469642-65469664 CAAAGCGCCCAGCACATAGTAGG + Intergenic
1042745016 8:72098058-72098080 CATTGTTCCCAGCATAAGGGGGG + Intronic
1042814842 8:72867062-72867084 CACTTTGCCTGGCATATAGTAGG + Intronic
1042945325 8:74148390-74148412 CATAGTGCCTGGCATGTAGTAGG + Intergenic
1043017056 8:74952214-74952236 AATAGTACCTAGCATATAGTAGG + Intergenic
1043063841 8:75541833-75541855 GATTATGCCCAGGATACAGTGGG - Intronic
1043198010 8:77324830-77324852 CATAGTGTCCAGCATATTATAGG + Intergenic
1043517044 8:81004465-81004487 AATTGTGCCTGGCACATAGTAGG - Intronic
1043614541 8:82109224-82109246 CACTGAGGCCAGCACATAGTAGG - Intergenic
1043933687 8:86119115-86119137 CAATGTGCCCAGAATACACTGGG + Intronic
1044400064 8:91759967-91759989 CAAGGTGCCTAGCATATAGTAGG + Intergenic
1044599800 8:93992162-93992184 CAAAGTGCCCAGCACATAGTAGG + Intergenic
1044782114 8:95753816-95753838 AATAGTACCCAGCACATAGTAGG + Intergenic
1045055729 8:98366871-98366893 CATGCTGCCTAGCATACAGTGGG - Intergenic
1045695483 8:104804826-104804848 GAATGTGCTCAGCATATATTGGG + Intronic
1046785208 8:118258472-118258494 CATGGTGCCAGGCACATAGTAGG - Intronic
1047164985 8:122428107-122428129 CACAATGCCAAGCATATAGTAGG - Intergenic
1047203894 8:122788161-122788183 CAGAGTGCCTAGCACATAGTAGG - Intronic
1047317972 8:123752101-123752123 CATAGTGCCCAGAACATAGTAGG - Intergenic
1048155318 8:131942604-131942626 CATTGTGCCTGGCACATAGTTGG + Intronic
1048293240 8:133196159-133196181 CACTGTGCCCAGAGTAGAGTGGG - Intronic
1048295335 8:133209718-133209740 CACTGTGCCCAGAACAGAGTTGG - Intronic
1048318280 8:133378013-133378035 AATTGTGCCTGGCATATAGCAGG + Intergenic
1048319132 8:133385080-133385102 CAGTGTGTCAAGCACATAGTAGG + Intergenic
1048598220 8:135889506-135889528 AACAGTGCCCAGCACATAGTAGG + Intergenic
1048708700 8:137183864-137183886 CATGGTGCCCAGCATGGTGTGGG - Intergenic
1050633955 9:7590303-7590325 CACAGTGGCCAGCATATAGTAGG - Intergenic
1050852956 9:10311593-10311615 CTTGGTGCCCAACACATAGTAGG - Intronic
1051191712 9:14519669-14519691 CATTTTGCCAGGCATATATTGGG - Intergenic
1051407814 9:16757673-16757695 CATTGTACCAGGAATATAGTAGG - Intronic
1051563336 9:18468132-18468154 CATTGTGCATTGCATACAGTAGG + Intergenic
1051586214 9:18729659-18729681 CATTGTGCCAAGCATTGTGTGGG + Intronic
1052430292 9:28357843-28357865 CATTGTTCCTAGCACCTAGTAGG + Intronic
1052514359 9:29460969-29460991 AACTGTGCCCAGCCAATAGTAGG + Intergenic
1053265175 9:36707594-36707616 CACAGTGGCTAGCATATAGTAGG + Intergenic
1053401730 9:37830372-37830394 AATTGTGCCTAGCATATGGTGGG + Intronic
1053518695 9:38754609-38754631 CACTGTGCCCAGCCTAGAGATGG + Intergenic
1053538606 9:38950177-38950199 CATGGTGCCCAGCATACAATAGG + Intergenic
1054627532 9:67413739-67413761 CATGGTGCCCAGCATACAATAGG - Intergenic
1054978152 9:71172188-71172210 CACTGTGCCCAGCGCATAGAAGG + Intronic
1055487492 9:76771406-76771428 AAGAGTGCCCAGCATATAGTAGG - Intronic
1055589224 9:77792981-77793003 TCTGGTACCCAGCATATAGTAGG + Intronic
1055799738 9:80021962-80021984 CACTGTGCCCAGCCTATTCTTGG + Intergenic
1056160597 9:83887991-83888013 CACTGTGCCCAGCCGGTAGTAGG - Intronic
1056991412 9:91415077-91415099 CCTTGTGCCCAGTACACAGTAGG - Intronic
1057074019 9:92125533-92125555 CACTGTGCCCAGCCTACAATAGG - Intergenic
1057085370 9:92205023-92205045 CACTGTGCCCAGCCTACAATAGG + Intergenic
1057175205 9:92992058-92992080 TCTTGTGGACAGCATATAGTTGG + Intronic
1057495712 9:95559554-95559576 CACTGGGCCTGGCATATAGTGGG - Intergenic
1057725948 9:97568252-97568274 CACAGTACCCAGCATATAATAGG - Intronic
1057835678 9:98443103-98443125 CATAGTGCTCAGCATATAGTAGG + Intronic
1058090056 9:100795657-100795679 CACTGTGCCTAGCCTATAGTTGG + Intergenic
1058504501 9:105654443-105654465 CAGTATGCCTAGCACATAGTCGG - Intergenic
1058721636 9:107769588-107769610 CACAGTGCCCAGCATCCAGTAGG - Intergenic
1058895498 9:109397284-109397306 CATTGTGCCTGGCACATAGTAGG + Intronic
1059226533 9:112678090-112678112 CACTGTGCCCAGCCTAAAATTGG - Intergenic
1059501030 9:114754351-114754373 TACAGTGCCTAGCATATAGTAGG + Intergenic
1059742306 9:117163942-117163964 CATAGTGCCTGGCATATAGCAGG + Intronic
1059811391 9:117859304-117859326 CATTTTCCCTAGCATCTAGTAGG - Intergenic
1059931864 9:119268777-119268799 AACTGTGCCCAGCACTTAGTAGG + Intronic
1060152472 9:121297670-121297692 GATTGTGCCTGGCATATAGTAGG - Intronic
1060274877 9:122174922-122174944 CACAGTGTCTAGCATATAGTAGG - Intronic
1060717301 9:125944395-125944417 CATAGTGCCTGACATATAGTAGG - Intronic
1060751028 9:126169645-126169667 CATTGTATCCGGCACATAGTAGG + Intergenic
1061093032 9:128437296-128437318 CATGTTGCCCAGCACACAGTAGG + Exonic
1061335018 9:129927539-129927561 AATTGTGCAAAGCATATATTTGG - Intronic
1061369603 9:130191075-130191097 CACTGAGCCCAGCACATGGTGGG - Intronic
1061620615 9:131809167-131809189 CTATGTGCACAGCACATAGTAGG + Intergenic
1062298236 9:135847057-135847079 CACCGTGCCCGGCCTATAGTAGG - Intronic
1186362716 X:8859285-8859307 CACTGTGCCCAGCCTATCTTTGG + Intergenic
1186366337 X:8898112-8898134 AACAGTGCCCAGCACATAGTAGG - Intergenic
1187238741 X:17493529-17493551 CACAGTGCCTGGCATATAGTAGG + Intronic
1187830729 X:23378759-23378781 AATTGTGCCTGGCATGTAGTAGG + Intronic
1187887409 X:23902460-23902482 CATGATGCCCAGCCCATAGTTGG + Intronic
1188023674 X:25186314-25186336 AATGGTGCCTGGCATATAGTGGG + Intergenic
1188163297 X:26829268-26829290 AATTGTGACCAGCACATAGTAGG - Intergenic
1188309135 X:28596090-28596112 CATTGTGCACAGCATATAGTAGG + Intronic
1188591041 X:31835456-31835478 CAATGTGCTCAGTATTTAGTTGG - Intronic
1189282920 X:39831869-39831891 CATTGTGCCCTGCCTGTAGTAGG - Intergenic
1189337309 X:40177670-40177692 CATTGTGGCTGGCATATAGTAGG + Intergenic
1189363247 X:40369419-40369441 CCTGGTGCCTGGCATATAGTAGG + Intergenic
1189987386 X:46566011-46566033 CATGGTGTCAAGCACATAGTAGG - Intergenic
1189994358 X:46624903-46624925 CATGGTGCCTGGCACATAGTAGG - Intronic
1190041350 X:47074829-47074851 CACTGTGCCTGGCCTATAGTAGG + Intergenic
1190101760 X:47527573-47527595 CATGGTGCCTAGCATACAGTAGG + Intergenic
1190337916 X:49273945-49273967 CACTGTGCCCAGCACACAGTAGG - Intronic
1191012554 X:55775792-55775814 CATAGTGCCTAGCAAGTAGTAGG + Intergenic
1192006149 X:67215075-67215097 TATTGTAGACAGCATATAGTTGG - Intergenic
1192236588 X:69300048-69300070 CAGAGTGCCTGGCATATAGTAGG + Intergenic
1192273486 X:69606733-69606755 CATAGTGCCTGGCACATAGTAGG + Intergenic
1192590381 X:72354884-72354906 CATAGGGCCCAGCACATACTAGG + Intronic
1193294621 X:79820209-79820231 CTTTGTGCCCAGCATAACCTAGG + Intergenic
1193658838 X:84232115-84232137 CATGGTGCCTTGCATATGGTAGG - Intergenic
1193701765 X:84771531-84771553 CACAGTGCCTTGCATATAGTAGG - Intergenic
1193871137 X:86799876-86799898 CATGGTACTGAGCATATAGTTGG - Intronic
1194084827 X:89513287-89513309 TGTTGTGTGCAGCATATAGTTGG - Intergenic
1194771660 X:97914443-97914465 CATTGTGCTCAGAATACAATTGG - Intergenic
1194925915 X:99823326-99823348 CATAGTGGCTGGCATATAGTGGG - Intergenic
1195720960 X:107867567-107867589 CATTGTGCTTGGCACATAGTAGG + Intronic
1195905904 X:109844159-109844181 GATAGTGCCCAGCACATAGTAGG - Intergenic
1195986519 X:110636632-110636654 CATAGTGCCTGGCATATAGTAGG - Intergenic
1196201531 X:112891256-112891278 CATAGTGCTGAGCATTTAGTTGG - Intergenic
1196373955 X:115010962-115010984 CATAGTGCCTGACATATAGTAGG - Intronic
1196491146 X:116268782-116268804 CACTGTGCCTATCATATTGTAGG - Intergenic
1196603768 X:117631928-117631950 CAGTGTGCCAGGCATAAAGTAGG - Intergenic
1196617937 X:117788838-117788860 CATAGTGCCTGGCATTTAGTAGG + Intergenic
1196758579 X:119179379-119179401 CATGGTGCCTGGCATATAGCAGG - Intergenic
1197622376 X:128764929-128764951 AATAGTGCCCAGCACAGAGTAGG + Intergenic
1197776863 X:130123944-130123966 CACTGTGCCCAGCCTATTCTAGG - Intergenic
1198085235 X:133276530-133276552 CATGGTGCCTAGCATATAGTTGG + Intergenic
1198139923 X:133792311-133792333 CACAGTGCCTAGCACATAGTAGG + Intronic
1198205163 X:134459013-134459035 CACAGTGCCCAGCACATAGTTGG - Intergenic
1198398111 X:136243414-136243436 CACTGTGCCCAGCCTATTATAGG - Intronic
1198438198 X:136637154-136637176 AATGGTGCCTGGCATATAGTAGG - Intergenic
1198560218 X:137841642-137841664 CACAGTGCCTGGCATATAGTAGG + Intergenic
1198668207 X:139047725-139047747 CATAGTACCTAGCATACAGTGGG + Intronic
1198673991 X:139112308-139112330 CACAGTGCCCAACATATAGTAGG + Intronic
1198856530 X:141023212-141023234 TGTTGTACACAGCATATAGTTGG - Intergenic
1198906162 X:141564155-141564177 TGTTGTACACAGCATATAGTTGG + Intergenic
1199267208 X:145842456-145842478 CGTAGTGCCCAGCATAGAGGAGG - Intergenic
1199503657 X:148537379-148537401 CTTGGTGCCCAGCACATAGAAGG - Intronic
1199531480 X:148852659-148852681 CATGGTGCCAGGTATATAGTAGG - Intronic
1199820294 X:151438896-151438918 TATTGTGCTCAGCAAATTGTAGG - Intergenic
1199969002 X:152844793-152844815 CATAGTGCCCAGCACAAAGTGGG - Intronic
1199989748 X:152979881-152979903 AATAGTGCCCTGCACATAGTAGG + Intergenic
1200437475 Y:3169172-3169194 TGTTGTGTGCAGCATATAGTTGG - Intergenic