ID: 922235217

View in Genome Browser
Species Human (GRCh38)
Location 1:223717572-223717594
Sequence CCCATCAGGGCCCAGGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 440
Summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 389}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922235206_922235217 4 Left 922235206 1:223717545-223717567 CCCTTCTCAGACAGGACCACCCA 0: 1
1: 0
2: 3
3: 16
4: 223
Right 922235217 1:223717572-223717594 CCCATCAGGGCCCAGGGAGCAGG 0: 1
1: 0
2: 4
3: 46
4: 389
922235203_922235217 14 Left 922235203 1:223717535-223717557 CCAATGCCTGCCCTTCTCAGACA 0: 1
1: 0
2: 1
3: 19
4: 316
Right 922235217 1:223717572-223717594 CCCATCAGGGCCCAGGGAGCAGG 0: 1
1: 0
2: 4
3: 46
4: 389
922235205_922235217 8 Left 922235205 1:223717541-223717563 CCTGCCCTTCTCAGACAGGACCA 0: 1
1: 0
2: 1
3: 24
4: 216
Right 922235217 1:223717572-223717594 CCCATCAGGGCCCAGGGAGCAGG 0: 1
1: 0
2: 4
3: 46
4: 389
922235207_922235217 3 Left 922235207 1:223717546-223717568 CCTTCTCAGACAGGACCACCCAT 0: 1
1: 0
2: 1
3: 10
4: 148
Right 922235217 1:223717572-223717594 CCCATCAGGGCCCAGGGAGCAGG 0: 1
1: 0
2: 4
3: 46
4: 389
922235202_922235217 30 Left 922235202 1:223717519-223717541 CCAGAGTGTGCAGGGTCCAATGC 0: 1
1: 0
2: 0
3: 8
4: 108
Right 922235217 1:223717572-223717594 CCCATCAGGGCCCAGGGAGCAGG 0: 1
1: 0
2: 4
3: 46
4: 389

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922235217 Original CRISPR CCCATCAGGGCCCAGGGAGC AGG Intronic
900147833 1:1166141-1166163 GCCAACTGGGCCCAGAGAGCTGG - Intergenic
900188620 1:1344133-1344155 CCTCTGAGGGCCCAGGCAGCAGG + Intronic
900492443 1:2959015-2959037 GCCAGCAGGGCCCAGGGCCCAGG - Intergenic
900621563 1:3589999-3590021 CCCATCACAGCCCATGGAGCTGG + Intronic
900705059 1:4075416-4075438 CCCACCATAGCCCAGAGAGCTGG + Intergenic
900798746 1:4725072-4725094 GCCCTCAGGGTCCAGGGAGCTGG + Intronic
901171880 1:7265028-7265050 AGCCTCAGGGGCCAGGGAGCCGG + Intronic
901221859 1:7587936-7587958 GCCATCTGGGCCGAGGGAGGCGG - Intronic
902176284 1:14653378-14653400 CCCAACACGCCCCAGGGAGCTGG - Intronic
902227760 1:15007522-15007544 CACATCTGGACCCAGGGAGCAGG + Intronic
902288378 1:15421301-15421323 CACATCAGAGCCCAGGGCACAGG + Intronic
902606517 1:17572281-17572303 CCCACAAGGCCCCATGGAGCAGG - Intronic
903728424 1:25470546-25470568 CTCATCAGGGCCTTGGGAGAAGG - Intronic
904029519 1:27525644-27525666 CCCCGCAGGGCCCAAGGGGCCGG - Intergenic
904049894 1:27632814-27632836 CCCCTGAGGGACCAGGGAGGGGG - Intronic
904405224 1:30283886-30283908 CCCATGAGGACCCCGGGAGGAGG + Intergenic
905267710 1:36766121-36766143 CCCACCACAGCCCACGGAGCAGG + Intergenic
905317772 1:37094561-37094583 CCCACCAGCCCCCAGGGAACAGG + Intergenic
905790700 1:40787788-40787810 CCCATAAGGGCTCAGCGAGCAGG - Intronic
906679744 1:47718067-47718089 CCTTTCTGGACCCAGGGAGCAGG + Intergenic
907496049 1:54845495-54845517 CCCACAAGGGCTGAGGGAGCTGG - Intergenic
907921964 1:58922346-58922368 CCACACAGGGCCCAGGGAGACGG + Intergenic
910258886 1:85276849-85276871 TCCGTCAGTGCCCAGGCAGCTGG + Exonic
911247510 1:95535148-95535170 CCCCTGAGGGCCGAGGAAGCTGG + Intergenic
912681797 1:111733709-111733731 CCCAAGAGGGCCCAGGGGGAGGG - Intronic
913375062 1:118142303-118142325 GTCATCAGGGGCCAGGGTGCAGG + Intronic
915977506 1:160400660-160400682 CCCCTCAAGGCCCCGGGGGCTGG - Exonic
918150797 1:181796687-181796709 CCGCTCAGGGGGCAGGGAGCGGG + Exonic
919943841 1:202306059-202306081 CACATCAGGGCCCAGTGGGATGG + Intronic
920275525 1:204801701-204801723 CCAAACATGGCCCAGGGAGGAGG - Intergenic
921179279 1:212619042-212619064 CCCAAAAGGGCCTTGGGAGCTGG - Intronic
922235217 1:223717572-223717594 CCCATCAGGGCCCAGGGAGCAGG + Intronic
922582742 1:226710800-226710822 CCCATCAGGGGCCTGGGTGAAGG - Intronic
922749302 1:228063226-228063248 CCTGTCAGGGCCAAGGGAGAAGG + Intergenic
922897384 1:229111037-229111059 CCCATCAGGGCCAGGTGAGGTGG + Intergenic
923190091 1:231611926-231611948 ACCAGCTGGGCACAGGGAGCTGG + Intronic
923800691 1:237205710-237205732 CCAATCTGTGCTCAGGGAGCAGG + Intronic
1063364179 10:5479908-5479930 CCCATCAGGGCCCTGGGCTTCGG - Intergenic
1063566094 10:7173026-7173048 CCCATGAGGACACAGGGTGCAGG + Intronic
1064318259 10:14277810-14277832 CTCAGCAGGGCCCAGAGAGAGGG + Intronic
1066233378 10:33460616-33460638 CCCATGAGGACCCAAGGAACAGG + Intergenic
1066703739 10:38156631-38156653 CCTATCAGGACCCAGTGAGAGGG - Intergenic
1067111348 10:43403259-43403281 CCCAGCAGGGCCAAGGCAGGCGG - Intronic
1067278349 10:44853478-44853500 ACCAGAGGGGCCCAGGGAGCTGG + Intergenic
1067894678 10:50166049-50166071 CCCTTCTGGGTCCATGGAGCAGG - Intergenic
1067954163 10:50774213-50774235 CCCTTCTGGGTCCATGGAGCAGG + Intronic
1070581029 10:77719674-77719696 TCCATCTGGTGCCAGGGAGCAGG - Intergenic
1070935200 10:80288644-80288666 CCCAGCAGTGACCAGGGTGCAGG + Intronic
1073572447 10:104591991-104592013 CCCTGCAAGGCCCAGGGAGCAGG - Intergenic
1073851943 10:107631811-107631833 CCCAGTAGGGCCCATGTAGCAGG - Intergenic
1074121520 10:110497491-110497513 CTGAGCAGGGCCGAGGGAGCCGG - Intergenic
1074853612 10:117457592-117457614 GCCAGCAGGGCTCAGGGACCAGG - Intergenic
1074886986 10:117701614-117701636 AGCATCAGGGCCCAGGGCCCAGG - Intergenic
1075292404 10:121241684-121241706 CCCAGTATGGCCCAGGGACCAGG + Intergenic
1076727566 10:132420661-132420683 CCCAGCAGGGCCTAGGCTGCGGG - Intergenic
1076841966 10:133050171-133050193 GCCATCACGGCCCCGGAAGCTGG - Intergenic
1077024867 11:434630-434652 CACATCAGGTCCCTGGGGGCTGG + Intronic
1077268806 11:1665649-1665671 TCCCTCTGGGCTCAGGGAGCTGG - Intergenic
1077271947 11:1685531-1685553 TCCCTCTGGGCTCAGGGAGCTGG + Intergenic
1077285225 11:1762604-1762626 CCCTCCAGGGACCAGGAAGCAGG + Intronic
1077289422 11:1782050-1782072 CCCCCCAGGCCCCAGGGAGCAGG + Intergenic
1077419553 11:2444184-2444206 CCCACCAGGGCCCTTGGACCGGG - Intergenic
1077506974 11:2934149-2934171 CTCATCAGGGGCCAAGGAGAAGG - Intergenic
1077777194 11:5284792-5284814 CCCATCTGGGCCCTGATAGCTGG + Intronic
1077918053 11:6623719-6623741 CCCATCAGGGCTCTTTGAGCTGG - Exonic
1078323130 11:10354798-10354820 CCCATGTGGGGCCAGGCAGCTGG + Intronic
1078453719 11:11458933-11458955 ACAAGCAGGGCCCAGGGAGCTGG - Intronic
1079137645 11:17785006-17785028 CCCACCAGGGCCAAGGGTGGTGG + Intergenic
1079322600 11:19463905-19463927 CTCACCATGCCCCAGGGAGCAGG + Intronic
1080977921 11:37364541-37364563 CACATGCGGGCCCAGGCAGCAGG - Intergenic
1081715746 11:45248878-45248900 AGCAGCAGTGCCCAGGGAGCAGG - Intronic
1081780750 11:45710203-45710225 GCCATCAGGGACCAGGGAAGAGG + Intergenic
1082796741 11:57383371-57383393 CCCTCCATGGCTCAGGGAGCAGG + Intergenic
1083309506 11:61777196-61777218 ACCTGCAGGGCCCTGGGAGCAGG - Intronic
1083721871 11:64607474-64607496 CCCCACAGGGCCTGGGGAGCGGG - Exonic
1083895199 11:65616265-65616287 CCCATGAGGGTCCCGGGAGGGGG + Exonic
1083994483 11:66265443-66265465 CCCATGAGGGCCCTGGGGCCAGG + Intronic
1083998702 11:66284546-66284568 CCCATCAGGCCCCAGGAACAAGG + Intronic
1084182707 11:67454712-67454734 CCCATCAGGGCTGGGGGAGGGGG - Intronic
1084433483 11:69124114-69124136 CCTATCCGGGCCCAGAGAGATGG - Intergenic
1084639416 11:70415744-70415766 CCCATCGGGGCCCCCGGAGCGGG - Intronic
1084725890 11:70941671-70941693 CACATGAGGGCACAGGGAGAAGG + Intronic
1085310466 11:75513760-75513782 CCCCTCAAGGCCCACAGAGCAGG + Intronic
1085385088 11:76153041-76153063 CCCTTCTGGCCCCAGGGACCAGG + Intergenic
1087021302 11:93606087-93606109 CCCAGCACGGCTCAGGGAGGAGG + Intergenic
1088552310 11:111025534-111025556 CCCTTCAGTGCACTGGGAGCAGG + Intergenic
1089389190 11:118088505-118088527 GCCCCCAGGGCCCAGGTAGCGGG - Intronic
1090788328 11:130069484-130069506 CCCAGCAGGGGCAGGGGAGCGGG + Intergenic
1090939056 11:131371880-131371902 CCCAGCAGGGCTCCGGGAGGAGG + Intronic
1091156882 11:133382523-133382545 CACATCACTGCCCAGGCAGCCGG + Intronic
1091173136 11:133536229-133536251 CCCATCTGGCCCTAGGAAGCTGG - Intergenic
1091260784 11:134232551-134232573 CCCAGCAGGGCACCTGGAGCAGG - Intronic
1091381916 12:67253-67275 CCCAGCGGGGCCCTGGCAGCAGG + Exonic
1091412800 12:255210-255232 GCAACCAGGGTCCAGGGAGCTGG + Intronic
1094000158 12:25686417-25686439 GCCAGCAGTGCTCAGGGAGCCGG - Intergenic
1096106513 12:48999337-48999359 CCCCTCCCAGCCCAGGGAGCCGG + Intergenic
1096621022 12:52865625-52865647 CACATCAGGCACCAGGGAGGTGG - Intergenic
1101441617 12:104708436-104708458 GGTATCTGGGCCCAGGGAGCTGG - Intronic
1102232729 12:111274737-111274759 CCCATCTGGGCCCAGGCTCCGGG - Intronic
1102464283 12:113119436-113119458 CCCATCTGTTCCCAGGGACCTGG - Exonic
1102841139 12:116124251-116124273 CCCATCAGGTCTCAAGGAGATGG - Intronic
1102953934 12:117047365-117047387 CCCAGCACGGCCTTGGGAGCTGG + Intronic
1103340927 12:120220815-120220837 ACCATCAGGGCCAAGGGTGCAGG + Intronic
1103433003 12:120904052-120904074 CGCCCCGGGGCCCAGGGAGCGGG - Exonic
1103484474 12:121273716-121273738 CCCACCAGGGGCAAGGGAGCTGG - Intronic
1103931581 12:124453547-124453569 GCCAGCAGGGGCCAGGGAGGAGG + Intronic
1104744568 12:131202848-131202870 TGGAGCAGGGCCCAGGGAGCCGG - Intergenic
1104789817 12:131474359-131474381 TGGAGCAGGGCCCAGGGAGCCGG + Intergenic
1104842329 12:131830994-131831016 CCCATCCGTGCCCAGGAACCAGG - Intronic
1104975011 12:132548392-132548414 CCCATCAGTCCTGAGGGAGCAGG + Intronic
1104992904 12:132636206-132636228 CCCACCAGGCCCCTGGGAGCTGG + Intronic
1105265223 13:18809199-18809221 CCCATCAGGGCCCTGTCACCAGG - Intergenic
1105289994 13:19047580-19047602 CCCCTCAGGGCCGTGGCAGCTGG - Intergenic
1105535560 13:21260949-21260971 CCCATCAGGGCCCACGGGGTCGG - Intergenic
1106501864 13:30336589-30336611 CCCACCAGAGCCCAGGCTGCTGG + Intergenic
1107822205 13:44296138-44296160 TCCCTCAGGACCCAGGGAGGTGG - Intergenic
1108259875 13:48645887-48645909 CCCTTCAGGTCACAGGGACCTGG + Intergenic
1114614793 14:24062645-24062667 CCCTTCAAGGCCCTGGGAGGTGG + Intronic
1116864052 14:50017133-50017155 GACATCAGCGCCCAGGCAGCAGG - Intergenic
1117348993 14:54862316-54862338 CACATCAGGGCCGAGTGAGGTGG - Intronic
1118012783 14:61627001-61627023 CACCTCAGGGCCCAGTGAGGAGG + Intronic
1118389943 14:65287546-65287568 CCCATCAGGGGCCAGAGTGTAGG + Intergenic
1119029950 14:71184148-71184170 CCCTTGTGGGCCCAGGGAGATGG + Intergenic
1119749674 14:77068315-77068337 CCCACCTGGGCCCAGGTAGGGGG - Intergenic
1119762019 14:77158297-77158319 CCAAGCAGGGGACAGGGAGCGGG + Intronic
1121422356 14:93824610-93824632 CCCAGCAGGGGAGAGGGAGCTGG + Intergenic
1121791876 14:96704915-96704937 TCCAGCAGGGCTAAGGGAGCTGG - Intergenic
1122115373 14:99524889-99524911 TCCCTCAGGACCCAGGGAGAAGG + Intronic
1122603661 14:102933678-102933700 CGCCACAGGGGCCAGGGAGCTGG - Exonic
1122630528 14:103105650-103105672 CCCAGCAAAGCCCAGGGTGCAGG - Intronic
1123034231 14:105465376-105465398 CCCATCACGACCCCAGGAGCAGG - Intronic
1123037519 14:105477502-105477524 CCCATCAGGGCCCAGTTGGTGGG + Intronic
1202833262 14_GL000009v2_random:58923-58945 CCCATCAGGGCCCTGTCACCAGG + Intergenic
1123767801 15:23499180-23499202 CCCATTAGGCCCCAGGAAGCTGG - Intergenic
1123783547 15:23647414-23647436 ACCATCAGGACCCCGGGAGTCGG + Exonic
1124062636 15:26308020-26308042 CCCTTCTGGGCCCAGACAGCAGG + Intergenic
1124371828 15:29108424-29108446 CACTGCAGGGCCCAGGGAGGGGG + Intronic
1124658129 15:31524890-31524912 TCCCTCGGGCCCCAGGGAGCAGG + Intronic
1128582199 15:68818282-68818304 CCCAACTGGGCTCCGGGAGCTGG - Intronic
1129689267 15:77704188-77704210 CTCATCAGGGCTCAGAGAGGTGG + Intronic
1129843853 15:78759335-78759357 ACCATTAGGGCGCAGGGGGCGGG + Exonic
1130557886 15:84935597-84935619 CTCAGCCAGGCCCAGGGAGCGGG - Intronic
1132605037 16:790092-790114 CCCATCAGTGCTCAGGGACCCGG - Intronic
1132699199 16:1215116-1215138 CCCCTCAGGGCTCTGGGGGCTGG + Intronic
1132725504 16:1336608-1336630 CACAGCAGGGGCCCGGGAGCTGG + Intronic
1132872926 16:2123664-2123686 CACAGCAGGGCCCAGGCATCTGG + Intronic
1132881614 16:2164043-2164065 CCCAGCATGCCCCAGGGATCTGG + Intronic
1133161651 16:3915900-3915922 CCCATCAGGAAACAGGGAGAAGG - Intergenic
1133235238 16:4384573-4384595 CCCAGCCAGACCCAGGGAGCAGG + Intronic
1133322487 16:4922970-4922992 CCCAGCTAGGCCCAGGGAGTGGG - Intronic
1134059646 16:11191395-11191417 GCCATCAAGGCCCAGGCAGACGG - Intergenic
1134063453 16:11212445-11212467 CTGATCAGGGGCAAGGGAGCTGG - Intergenic
1134069099 16:11249792-11249814 CCCACGACGGCCCAGGGATCTGG - Intronic
1134133466 16:11665270-11665292 CCCAGCAAGCCCCAGGGAGCTGG + Intergenic
1134552016 16:15142843-15142865 CACAGCAGGGCCCAGGCATCTGG + Intergenic
1135328237 16:21541501-21541523 CACATCTGTGCCCTGGGAGCGGG - Intergenic
1136079091 16:27839904-27839926 CCCTTCAGGGACCAGGAAACAGG - Intronic
1136135919 16:28256887-28256909 CCCGTCAGGGGTCAGGGAGAGGG - Intergenic
1136338586 16:29627474-29627496 CACATCTGTGCCCTGGGAGCGGG - Intergenic
1140407409 16:74719884-74719906 CCCACCAGGGACCATGGGGCAGG + Intronic
1140473202 16:75226231-75226253 CCCTTCTGAGCCCAGGGTGCTGG - Intergenic
1140926597 16:79589922-79589944 CGCGGCAGTGCCCAGGGAGCCGG - Intronic
1141025211 16:80540682-80540704 CCCACCAGGTGCCAGGGAGACGG - Intergenic
1141148731 16:81549754-81549776 CCCAGCAGGGCACAGGGTGCTGG + Intronic
1141164297 16:81650244-81650266 CCCAGCATTCCCCAGGGAGCGGG - Intronic
1141717513 16:85735305-85735327 CTCATCAGGGCCAAGGGTGGGGG - Intronic
1141943795 16:87296394-87296416 CCCACCTGGGACCAGGGAGCTGG + Intronic
1142067871 16:88073075-88073097 CTCAGCAGTGCCCGGGGAGCAGG - Intronic
1142144951 16:88489068-88489090 CCCAGGAGGCCCCAAGGAGCTGG + Exonic
1142169640 16:88614970-88614992 CCCATCTGGGCAGAGGGAACAGG - Intronic
1142177952 16:88653508-88653530 GCCGTCAGGGCTCAGGGAGGGGG + Intronic
1142290196 16:89190562-89190584 ACCCTCAGAGCCCAGGGATCAGG - Intronic
1143090487 17:4446790-4446812 CCCCCCACGCCCCAGGGAGCTGG - Intronic
1143289668 17:5819496-5819518 CCCATCAAGGACCAGAGAGCTGG - Intronic
1143377014 17:6472869-6472891 CCTCCTAGGGCCCAGGGAGCAGG - Intronic
1144677825 17:17173129-17173151 CCCACCAGGAGCCAGGCAGCCGG + Intronic
1144728871 17:17515358-17515380 CAGATCCGGGGCCAGGGAGCGGG + Intronic
1144890158 17:18489814-18489836 CCCATGAGGCCCCAGAGGGCTGG + Intronic
1145142058 17:20454503-20454525 CCCATGAGGCCCCAGAGGGCTGG - Intronic
1146171958 17:30641320-30641342 GACATCAGGGCCCAGAGAGGAGG - Intergenic
1146255176 17:31388117-31388139 ACCATGAGGTCCCTGGGAGCAGG - Intergenic
1146263646 17:31437417-31437439 CACAGCAGGGCGCAGAGAGCCGG - Intronic
1146303459 17:31709934-31709956 CCCCTCAGGGCCCAGCAGGCCGG + Intergenic
1146345417 17:32057356-32057378 GACATCAGGGCCCAGAGAGGAGG - Intergenic
1146479999 17:33197526-33197548 CCCATCTGGGCCCTGTCAGCTGG - Intronic
1146939930 17:36837294-36837316 GCCATCAGGGCCCTGGCAGCAGG + Intergenic
1147602516 17:41755119-41755141 CCCTTCCGGGCCCAGGCAGCTGG + Exonic
1147673670 17:42190977-42190999 CCCATAGGGCCCCAGGTAGCAGG + Intronic
1148217309 17:45840178-45840200 GCCAGCAGGCCCCAGGCAGCAGG - Intergenic
1148505997 17:48127618-48127640 CCCATCATGGAACAGGAAGCAGG - Intergenic
1148695254 17:49554953-49554975 TCCACAAGGGCCCAGGGTGCTGG + Intergenic
1148780061 17:50116293-50116315 CCCATTAGGTCCCATGAAGCAGG - Intronic
1150249352 17:63697705-63697727 CCCATCAGGGCCGAGGTAGTCGG + Exonic
1151313837 17:73310421-73310443 CCCCTGAGGGTCCAGGGTGCTGG - Intronic
1152029219 17:77831236-77831258 TCCCTCAGGACCCAGGGACCTGG - Intergenic
1152387134 17:79981359-79981381 CCCAGCAGGGCCCGGGCAGATGG - Intronic
1152575342 17:81137541-81137563 GCCAGCGGGGCCCAGGTAGCAGG - Intronic
1152799329 17:82323610-82323632 CCGCTCAGGGCCTAGGGAGCAGG + Intronic
1153555622 18:6310338-6310360 CCAATCTGGACCCAGGGAACTGG + Intronic
1154261083 18:12833459-12833481 ACCATCAGGTCTTAGGGAGCAGG + Intronic
1154423171 18:14252345-14252367 CCCATCAGGGCCCTGTCACCAGG + Intergenic
1156355903 18:36339643-36339665 CCCAGCAGGGGCCTGGGTGCAGG + Intronic
1157535298 18:48453168-48453190 CTCCTTAGGGCCCAGGGAGGTGG + Intergenic
1159003198 18:62991368-62991390 CCCACCAGGGCACAAGGGGCTGG - Intergenic
1160810352 19:1010491-1010513 CCCAGCAGGGCCCAGCGGGCTGG + Exonic
1160920954 19:1520334-1520356 CCAGGCAGGGACCAGGGAGCTGG + Intergenic
1160943426 19:1630465-1630487 CCCCTCAGGGTCCAGGGAAAAGG + Intronic
1161069851 19:2254535-2254557 CCCAGCAGGGCCAGGGGAGAGGG - Intronic
1161197154 19:2993369-2993391 CCCAGCCTGGCCCAGGAAGCAGG - Intronic
1161313074 19:3605223-3605245 GCCAGCAGGGACCAGGGGGCGGG + Intronic
1162744938 19:12792871-12792893 CCCACTGGGGTCCAGGGAGCAGG + Exonic
1163126933 19:15249386-15249408 CCCATCAGCCACCAGGGCGCAGG - Intronic
1163313171 19:16526003-16526025 CCCCTGAGGGGCGAGGGAGCTGG - Intronic
1163420598 19:17211817-17211839 CCCAGCAGGCCCCAGGGCGAGGG + Intronic
1163668351 19:18613412-18613434 ACCATCAGGCCTGAGGGAGCTGG - Intronic
1164474548 19:28565076-28565098 CCCCACATGGCCCAGGGAGGGGG + Intergenic
1164571930 19:29380879-29380901 CCACCCAGTGCCCAGGGAGCAGG + Intergenic
1165364404 19:35356009-35356031 CCCAGCAGGGGCTATGGAGCAGG - Intergenic
1165424194 19:35736999-35737021 CCCCACAGGGGGCAGGGAGCTGG + Intronic
1166225042 19:41389801-41389823 CCCATCAGAGTCCAGGGCGCAGG + Exonic
1166295658 19:41888064-41888086 CCCTGCAGAGCCCAGGGAGATGG + Exonic
1166312157 19:41969124-41969146 TCCACCAGGGGCCAGGGAGGAGG + Intronic
1167506734 19:49874832-49874854 CCCACCAGGGTGAAGGGAGCAGG + Intronic
1167529005 19:50003182-50003204 CCCAGCAGGGCCTGGGGAGGTGG - Intronic
1202639407 1_KI270706v1_random:68773-68795 CCCATCAGGGCCCTGTCACCAGG - Intergenic
925917818 2:8619308-8619330 CGCCCCGGGGCCCAGGGAGCAGG + Intergenic
926083618 2:10007636-10007658 CCCCTCAAGTCCAAGGGAGCTGG - Intergenic
926155676 2:10452604-10452626 CCCAGAAGGGCCCTGGGGGCAGG + Intergenic
926272166 2:11374982-11375004 CTCCTCAGGGCCCTGAGAGCCGG - Intergenic
927138464 2:20114142-20114164 CCCATCAGGGCCCTGGGAGAGGG - Intergenic
927940322 2:27099455-27099477 GCCATCAGGGCCCAGGGCGTCGG - Exonic
928104258 2:28457600-28457622 CCCACCTGGCCCAAGGGAGCAGG - Intronic
928366253 2:30705738-30705760 CCCAGCAGTGCCCAGGCAGTGGG - Intergenic
929091120 2:38218320-38218342 CCTATGAGGGCACAGGGAGAAGG - Intergenic
929581188 2:43082602-43082624 CCCCCCAGGGCCCAGGGGGCTGG + Intergenic
932861851 2:75302362-75302384 GCCATGAGGGCCCAGGAATCTGG - Intergenic
937071424 2:119066644-119066666 AACTTCAGGTCCCAGGGAGCAGG - Intergenic
937222621 2:120350525-120350547 CCCGTCAGAGACCTGGGAGCAGG + Exonic
938029902 2:127983037-127983059 CACCTGAGGGGCCAGGGAGCTGG + Intronic
938042725 2:128089643-128089665 TCCAGCAGGGCGAAGGGAGCAGG + Intergenic
938255736 2:129858544-129858566 CCCAGCTGGGCGCTGGGAGCAGG + Intergenic
939884273 2:147664367-147664389 CTCACCAGAGCCCAGGGAGGTGG + Intergenic
940972968 2:159913636-159913658 TCCACCAGGGCTGAGGGAGCTGG + Intergenic
941210436 2:162630910-162630932 CCGATCAGGTTCCAGGTAGCTGG + Intronic
944906795 2:204269823-204269845 CGTCTCAGAGCCCAGGGAGCAGG - Intergenic
946326138 2:218985491-218985513 CCCATCAGGGCACATGGCCCGGG - Exonic
947641107 2:231708289-231708311 CTCAGCAGGGCCGAGGGCGCGGG - Intronic
948463518 2:238141506-238141528 CCCATCATGGCCCTGGGACAGGG - Exonic
948495553 2:238346350-238346372 CCCACCAGGGCCTAGGGGACTGG - Intronic
948852242 2:240714162-240714184 CCCACCAGGGCCCCAGGTGCTGG + Exonic
948901767 2:240959920-240959942 CCCTCCAGTGCCCTGGGAGCTGG - Intronic
949051742 2:241901282-241901304 CCCTCCAGGCCTCAGGGAGCCGG + Intronic
1169201499 20:3712436-3712458 ACCCTCTGGGCCCAGGGACCAGG + Intergenic
1169785355 20:9354041-9354063 CTCATCAGGCAGCAGGGAGCTGG - Intronic
1170088770 20:12567084-12567106 CCCATCAAGGCCTAGGTGGCTGG - Intergenic
1170467981 20:16640046-16640068 CCTTTCAGGGCCAAGGAAGCTGG - Intergenic
1170710281 20:18784551-18784573 CCCATCAGGGCCCAACTTGCTGG + Intergenic
1170712843 20:18807799-18807821 CCCATGAGGGACAGGGGAGCTGG - Intergenic
1171481656 20:25459639-25459661 AGCATCAGAGCCCAGGGAGTTGG - Intronic
1171886058 20:30653139-30653161 CCCATCAGGGCCCTGTCACCAGG - Intergenic
1172187936 20:33042960-33042982 CCCATCTGGGCCCAGTGATAGGG - Intronic
1173062507 20:39675795-39675817 CCCTTGAAGTCCCAGGGAGCAGG + Intergenic
1173304459 20:41835182-41835204 CCAATCAGGCCCCAGGGAAAAGG - Intergenic
1173378074 20:42507808-42507830 CCGGTCAGGTCCCAGGGATCAGG + Intronic
1173886019 20:46459350-46459372 CCCGGCAGGGCCCCGGGAACCGG - Intergenic
1174062069 20:47839843-47839865 CACACCAGGCCTCAGGGAGCAGG + Intergenic
1174417819 20:50379202-50379224 CCCCTCAGGACCCAGGGAGCTGG - Intergenic
1174554926 20:51387423-51387445 GCCATCAGGGTCCTGGGAGCTGG - Exonic
1175717264 20:61263424-61263446 CACATCAGGGGCCAGGAAGGAGG + Intronic
1175971654 20:62689563-62689585 CCCAGCAGGGCCCAGCGAGCCGG + Intergenic
1176167550 20:63681984-63682006 CCCATCAGGGACATGGAAGCAGG - Intronic
1176283286 20:64327580-64327602 CCCAGCGGGGCCCTGGCAGCAGG - Intergenic
1176647736 21:9366382-9366404 CCCATCAGGGCCCTGTCACCAGG - Intergenic
1176850301 21:13907664-13907686 CCCATCAGGGCCCTGTCACCAGG - Intergenic
1179576711 21:42312672-42312694 CCCATCATTGATCAGGGAGCCGG + Intronic
1179948882 21:44698501-44698523 CCCATCAGGGCCCTGGGAGACGG - Intronic
1180362537 22:11913091-11913113 CCCATCAGGGCCCTGTCACCAGG + Intergenic
1180595124 22:16967981-16968003 CCCATGAGGTCCCCTGGAGCAGG - Intronic
1180606324 22:17061649-17061671 CCCATCAGAGCCCAGTGAGGGGG + Intergenic
1180980148 22:19874533-19874555 CCCCCCAGAGCCCAGGCAGCAGG + Intergenic
1181001607 22:19990327-19990349 GCCCTCAGGGCCCAGGCAGCTGG - Intronic
1181168002 22:20993540-20993562 ACCCTCAGGGCCCAGGAGGCAGG - Intronic
1181638538 22:24185304-24185326 CCCATCAGGGCCCAGGAGAGGGG + Intronic
1182829642 22:33294588-33294610 CACATCAAGGCCCATGGAGGTGG - Intronic
1184214746 22:43059337-43059359 CCCAAACGGGCCCTGGGAGCCGG + Intronic
1184368930 22:44070305-44070327 CCTAGCAGGGCCCAGGGAGGCGG - Intronic
1184482358 22:44755273-44755295 CACCTCAGTGCCCAGGGAGGTGG - Intronic
1184989563 22:48157697-48157719 CCCACCAGAGCCCACAGAGCTGG + Intergenic
1185140251 22:49096574-49096596 TCCATCAGGGCCCAAGGTACTGG - Intergenic
1185169760 22:49285980-49286002 CCCATGAGGGCACAGTGAGGTGG - Intergenic
949808179 3:7978002-7978024 CCAATCAGGGACTAGGGATCTGG - Intergenic
950529817 3:13546773-13546795 CGCCTCAGTGCCCAGGGAGCTGG + Intergenic
950672331 3:14534818-14534840 CCCCTGAGGCCCCAGAGAGCGGG - Intronic
950884130 3:16348055-16348077 CCCATCTGAGGCCAGGGAGCAGG + Intronic
952952916 3:38538912-38538934 CTCAGCAGGGCCCAGGCTGCAGG - Intronic
954151649 3:48660758-48660780 CGCATCAGGGCGCAGGATGCTGG - Exonic
954368080 3:50156592-50156614 CCCATCTCAGCCCAGGGAGTTGG + Intronic
954443774 3:50535771-50535793 TCCACCAGGGCCTTGGGAGCAGG - Intergenic
954629158 3:52038913-52038935 GGCATCTGGGCCCAGGCAGCAGG + Intergenic
954716861 3:52531327-52531349 CCCCTCAAGGCCCAGGGTTCTGG + Intronic
954799259 3:53177760-53177782 GCCACCAGGGCCCAGGTAGGAGG + Intronic
955063769 3:55516968-55516990 CAAATGAGGCCCCAGGGAGCTGG - Intronic
955326161 3:58010399-58010421 GCCATCTGGGCCCAGGAAGCAGG - Intronic
960586251 3:119323336-119323358 CCCATCCGGGCCCGAGGTGCTGG - Intronic
961386134 3:126524412-126524434 CTCACCCGGGCGCAGGGAGCGGG - Exonic
961446508 3:126983826-126983848 CCCAGCAGGGCCGCGGGGGCCGG + Intergenic
962630304 3:137269256-137269278 CCAGCCAGGGACCAGGGAGCTGG - Intergenic
963852408 3:150221709-150221731 GCCTTCAGGGTCCAGGGAGCGGG + Intergenic
963870657 3:150410281-150410303 CCCAGCCAGCCCCAGGGAGCGGG + Exonic
966744384 3:183262324-183262346 CCCAGCAGGCCCCAGTCAGCAGG + Intronic
966910519 3:184557127-184557149 CCCTCCAGGCCCCAGGCAGCTGG - Intronic
967869936 3:194221530-194221552 CCGATCTTGGCCAAGGGAGCTGG + Intergenic
1202739147 3_GL000221v1_random:38605-38627 CCCATCAGGGCCCTGTCACCAGG + Intergenic
968483143 4:845677-845699 CCCATGGGAGCCCAGGGAGGTGG + Intergenic
968544529 4:1191972-1191994 CCCATCAGAGCCCTGGAAACAGG - Intronic
968922182 4:3527996-3528018 CACATCAGGGGAAAGGGAGCTGG - Intronic
969311476 4:6355238-6355260 CTGATCAGGGCTCAGGGGGCAGG + Intronic
969571410 4:8010881-8010903 CCCAGCAAGTCCCAGGGAGAAGG + Intronic
969683358 4:8655661-8655683 ACCAGCAGGGCCCAGGGACGAGG - Intergenic
971497222 4:27279637-27279659 CCAATCATGGCTCAGGCAGCAGG - Intergenic
973369653 4:49235139-49235161 CCCATCAGGGCCCTGTCACCAGG - Intergenic
973391378 4:49560277-49560299 CCCATCAGGGCCCTGTCACCTGG + Intergenic
973774292 4:54230863-54230885 CCCGGCTGCGCCCAGGGAGCGGG + Intronic
984719763 4:182958825-182958847 GCCATCTGTGCACAGGGAGCAGG + Intergenic
985289933 4:188376920-188376942 CCCACCAGTGCCAAGGGAGGGGG + Intergenic
1202766766 4_GL000008v2_random:154642-154664 CCCATCAGGGCCCTGTCACCAGG - Intergenic
985548969 5:523849-523871 CCCCACAGGGACCCGGGAGCCGG + Intronic
985765883 5:1779385-1779407 ACCATCAGGGCCAAGGCACCGGG + Intergenic
986003513 5:3648890-3648912 CCCATCAGGAGCCAGGATGCTGG - Intergenic
986184318 5:5422275-5422297 CCCGTCCTGGGCCAGGGAGCAGG - Intronic
986358497 5:6952138-6952160 CCAAACAGGGCCCAGGGCCCTGG - Intergenic
986716106 5:10524776-10524798 ACCATCTGCGCCCAGGGGGCTGG + Intergenic
987294745 5:16539665-16539687 CACATCAGGGCCCCGGTACCGGG - Intronic
988245098 5:28670107-28670129 AACATCAGGGGCCAGGAAGCTGG + Intergenic
994251526 5:97542131-97542153 CCCCTCAGTGCCCAGGGCGGCGG + Intergenic
998173341 5:139885318-139885340 CACCACAGGGCCCGGGGAGCAGG + Intronic
999176429 5:149635094-149635116 CCCTTCACGCCTCAGGGAGCTGG + Intergenic
999275258 5:150325725-150325747 CCCAGGAGGGTCCAGGCAGCCGG - Intronic
999326722 5:150648676-150648698 CCCATCAGCACACAGGGTGCTGG - Exonic
1001000251 5:167999279-167999301 ACCATCTGGGCCCAGGGAGTTGG - Intronic
1001004983 5:168042212-168042234 CCAAGCAGAGCTCAGGGAGCAGG - Intronic
1001137812 5:169117006-169117028 TCCAGCAGGGGGCAGGGAGCAGG + Intronic
1002466215 5:179410165-179410187 CACATTAGGGCCCAGGAAGCTGG - Intergenic
1002534285 5:179867666-179867688 CCCACCTGGGCTCAGGGAGCAGG - Intronic
1002769452 6:278382-278404 CCCATTAGGGCTCTGGGACCAGG + Intergenic
1006194666 6:32231397-32231419 CCCAACTGGGGCAAGGGAGCTGG + Intergenic
1006642914 6:35497671-35497693 CCCGTGGGGGCCCGGGGAGCCGG - Intergenic
1006831423 6:36970505-36970527 CCCACCCCGGCCCAGGGAGCAGG + Intronic
1007616205 6:43181004-43181026 CAAATCAGGGGCCAGAGAGCAGG + Exonic
1011217182 6:85017526-85017548 TCCATCAAGGGCAAGGGAGCTGG - Intergenic
1012551374 6:100467220-100467242 CCCTCCCGGGCCCAGGGACCTGG + Intergenic
1015803183 6:137080998-137081020 CCTCCCAGGGCCCAGGCAGCTGG + Intergenic
1017106751 6:150895137-150895159 CCCTGCAGGGCCCAGGACGCTGG - Intronic
1018397855 6:163393972-163393994 ACCAGCAGGGCAGAGGGAGCTGG - Intergenic
1019056614 6:169228126-169228148 CCCATCAATGTCCACGGAGCAGG + Exonic
1019186708 6:170224711-170224733 CCCAGCGGGGCCCAGGAGGCAGG - Intergenic
1019204301 6:170346252-170346274 CCCATCAGCGTGCAGGGAGATGG - Intronic
1019287707 7:231870-231892 CCCATCTGTGCCCAGGGGCCTGG + Intronic
1019453866 7:1114572-1114594 CCCATCACGGCCTGTGGAGCAGG - Intronic
1019505034 7:1386422-1386444 CCCGTCGGTGCCCAGGGAGGTGG - Intergenic
1019698172 7:2459580-2459602 CCCACCAGGCCCCAGGGAGGTGG - Intergenic
1019725246 7:2598553-2598575 CCCATCAGAGCAGGGGGAGCGGG - Exonic
1020107381 7:5428340-5428362 CCCATCACGGCCTGGGGACCCGG + Intergenic
1020970489 7:14931820-14931842 CTGTTCAGGTCCCAGGGAGCGGG + Intronic
1021877492 7:25062320-25062342 CCCCTCAGGGCTGGGGGAGCTGG - Intergenic
1021918230 7:25456631-25456653 GACATCAGGGACCAGGGAGTAGG - Intergenic
1023310590 7:38882398-38882420 CCCCTCAGGGTCCAGGAATCAGG + Intronic
1023722354 7:43110066-43110088 CCCAGGAGGACCCAGGGAGGGGG - Intergenic
1023888138 7:44375211-44375233 CTCCACAGGGCCCGGGGAGCAGG - Intergenic
1023968696 7:44976764-44976786 CCCATCAGGACACAGGGCACAGG + Intronic
1024299484 7:47876373-47876395 CCCTGCAGGGCCCAGGGCTCTGG - Intronic
1026637866 7:72099958-72099980 CTCATCAGGGCTCAGGCATCTGG - Intronic
1026805630 7:73428561-73428583 CCCATCCTGCCCCAGGGAGCAGG + Intergenic
1029118607 7:98251779-98251801 CCCATCAATACCCAGGGAGAGGG + Intronic
1032165358 7:129540700-129540722 CCCAGGAGGGCCCGGGGAGCTGG - Intergenic
1032256685 7:130302818-130302840 CCCAGCATGGCACAAGGAGCTGG - Intronic
1032468388 7:132161135-132161157 CCCACCAGGGCCCAGAGGACAGG - Intronic
1032984740 7:137325446-137325468 CCCAGCAGGGCACATGGAGGAGG + Intronic
1033358939 7:140624171-140624193 CCCAACAGGGTCCTGGGAGAAGG - Intronic
1033572247 7:142641935-142641957 CCCATCCAGCCCCAGTGAGCTGG - Intergenic
1033684424 7:143625346-143625368 CCCACCAGGATCCAGGGAACAGG + Intronic
1033687600 7:143704565-143704587 CCCACCAGGATCCAGGGAACAGG + Intronic
1033700187 7:143832277-143832299 CCCACCAGGATCCAGGGAACAGG - Intergenic
1034672452 7:152868970-152868992 CCCATCAGTTCCCAGGAAACAGG - Intergenic
1034845187 7:154438056-154438078 CCCCTCAGGAACCAGGGAGCAGG + Intronic
1034971056 7:155419296-155419318 CCCATATGGACCCATGGAGCAGG + Intergenic
1035398265 7:158549045-158549067 CCCAGGGGGGCCGAGGGAGCAGG + Intronic
1035401552 7:158569527-158569549 CCCAGCAGGACCCTGAGAGCAGG - Intronic
1035583250 8:753335-753357 CCCACCAGGGCCCTGTGAGCTGG - Intergenic
1035597109 8:866834-866856 CCCAACAAGTCACAGGGAGCGGG - Intergenic
1036688226 8:10925505-10925527 CCCAGCAGGGCCCAGGACACAGG + Intronic
1037508964 8:19562154-19562176 CCCATCAGGGCCCAAGCCTCTGG - Intronic
1037720449 8:21439308-21439330 CCCATCAGGGTCCAGGGTCAGGG - Intergenic
1038056098 8:23859167-23859189 CCCCTCAGGGTGCGGGGAGCAGG + Intergenic
1038064914 8:23953915-23953937 TCCACCAGGGCCCTGGGAGGAGG + Intergenic
1039386217 8:37138069-37138091 CCCATCAGGGACCAAGTTGCAGG + Intergenic
1039492503 8:37958570-37958592 TCAATCTGGGCCCAGGGAGATGG + Intergenic
1039620308 8:38991301-38991323 GCCATCATGGCCCAGGGAGGCGG - Exonic
1039902371 8:41762207-41762229 AGCTTCAGGGCCCAGGGAGGAGG - Intronic
1042358191 8:67852852-67852874 ACCATCCTGGCCCAAGGAGCAGG - Intergenic
1042608959 8:70577128-70577150 CCTGACAGGGCCAAGGGAGCAGG - Intronic
1049256279 8:141615600-141615622 CCCATCAGAGAGCAGGGAGCGGG + Intergenic
1049328251 8:142035191-142035213 TCCATCAGTCCTCAGGGAGCAGG + Intergenic
1049359008 8:142202972-142202994 CACACCTGTGCCCAGGGAGCCGG - Intergenic
1049399236 8:142417482-142417504 CCCATAACGGCCCCTGGAGCTGG - Intergenic
1049402507 8:142435872-142435894 CCCACCAGCCCCCAGGCAGCAGG + Intergenic
1049471391 8:142776496-142776518 CCAAGCAGGGCCCTGGGGGCCGG + Intronic
1049587966 8:143440671-143440693 CCCACCCGGTCCCAGTGAGCAGG + Intronic
1049615217 8:143572952-143572974 CCCACCAGGGCCCTGAGAACAGG + Exonic
1049777711 8:144414142-144414164 CCCACCAAGACCCAGGGAGAGGG + Intronic
1052278542 9:26706310-26706332 CCCATCAGAGTCCAGGAGGCAGG - Intergenic
1052884766 9:33634042-33634064 CCCATCCAGCCCCAGTGAGCTGG - Intergenic
1053428018 9:38023794-38023816 CCCCTCAGGGCCCTGGATGCTGG - Intronic
1056326166 9:85480561-85480583 CCCATCAAGGCACAGTGAGGAGG - Intergenic
1056927118 9:90844332-90844354 GCCCCCTGGGCCCAGGGAGCAGG - Intronic
1057186661 9:93060999-93061021 CCCATGAGCGCCCTGGGAGAAGG + Intronic
1057206297 9:93174975-93174997 ACCATCAGGGCCAAGGGGGAAGG + Intergenic
1057388160 9:94622374-94622396 GCCATCATGGCCAAGGGCGCGGG - Intronic
1057501864 9:95602526-95602548 CCACTCAGGGCGCAGAGAGCAGG + Intergenic
1059277537 9:113108866-113108888 TCCATCAGGACCCATGGAACTGG + Intergenic
1059278714 9:113115685-113115707 TCCATCAGGACCCATGGAACTGG - Intergenic
1059422881 9:114203719-114203741 CCCATCAGCCCCCAGGAAGTGGG - Intronic
1059446907 9:114343707-114343729 CCCATTAGGACCCAGGATGCGGG - Exonic
1059657158 9:116367541-116367563 TCCACCAGGGACCAGGGAGTGGG + Intronic
1061006086 9:127929156-127929178 CACATCCGGGCACAGGGACCTGG - Intronic
1061081937 9:128376246-128376268 CACATCAGCCCCCAGGTAGCTGG - Intronic
1061664327 9:132151654-132151676 CCCCTCAGGGCCCAGGTCACTGG - Intergenic
1061804272 9:133129302-133129324 CCCACCATGGCCCGGGAAGCAGG - Intronic
1062138055 9:134940074-134940096 CCCATCAGCCCACAGGGGGCTGG + Intergenic
1062215809 9:135389234-135389256 CCAATCAGGGACCAGGAGGCAGG + Intergenic
1062514594 9:136926246-136926268 CCCAGCAGTGCCCATGTAGCAGG + Exonic
1203707876 Un_KI270742v1:69049-69071 CCCATCAGGGCCCTGTCACCAGG + Intergenic
1203547519 Un_KI270743v1:139521-139543 CCCATCAGGGCCCTGTCACCAGG - Intergenic
1185852794 X:3504843-3504865 TCCATCTTGGGCCAGGGAGCAGG + Intergenic
1187948281 X:24447656-24447678 CCCAGCAGTGTCCAGAGAGCAGG + Intergenic
1188432127 X:30116066-30116088 AGCAGCAGGGCCTAGGGAGCAGG - Intergenic
1196466244 X:115973891-115973913 CCCAGGAGGGCCCAGAGTGCTGG - Intergenic
1196889351 X:120277069-120277091 CCAGTCAGTCCCCAGGGAGCAGG + Intronic
1198284728 X:135178294-135178316 GACAGAAGGGCCCAGGGAGCAGG - Intergenic
1198728601 X:139703024-139703046 CCCATTTGGGACCAGGGAACTGG - Intronic