ID: 922236565

View in Genome Browser
Species Human (GRCh38)
Location 1:223726762-223726784
Sequence CATTTGTATCAGGGGCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 199}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922236565_922236578 17 Left 922236565 1:223726762-223726784 CCTCCCAGCCCCTGATACAAATG 0: 1
1: 0
2: 3
3: 16
4: 199
Right 922236578 1:223726802-223726824 CATGGGGAATTCCACTTTGGGGG 0: 1
1: 0
2: 0
3: 12
4: 126
922236565_922236574 1 Left 922236565 1:223726762-223726784 CCTCCCAGCCCCTGATACAAATG 0: 1
1: 0
2: 3
3: 16
4: 199
Right 922236574 1:223726786-223726808 AGGATGATTGTACATGCATGGGG 0: 1
1: 0
2: 1
3: 13
4: 213
922236565_922236576 15 Left 922236565 1:223726762-223726784 CCTCCCAGCCCCTGATACAAATG 0: 1
1: 0
2: 3
3: 16
4: 199
Right 922236576 1:223726800-223726822 TGCATGGGGAATTCCACTTTGGG 0: 1
1: 0
2: 1
3: 8
4: 126
922236565_922236580 30 Left 922236565 1:223726762-223726784 CCTCCCAGCCCCTGATACAAATG 0: 1
1: 0
2: 3
3: 16
4: 199
Right 922236580 1:223726815-223726837 ACTTTGGGGGTATCCTTTTCTGG 0: 1
1: 0
2: 0
3: 9
4: 114
922236565_922236572 -1 Left 922236565 1:223726762-223726784 CCTCCCAGCCCCTGATACAAATG 0: 1
1: 0
2: 3
3: 16
4: 199
Right 922236572 1:223726784-223726806 GAAGGATGATTGTACATGCATGG 0: 1
1: 0
2: 0
3: 11
4: 142
922236565_922236575 14 Left 922236565 1:223726762-223726784 CCTCCCAGCCCCTGATACAAATG 0: 1
1: 0
2: 3
3: 16
4: 199
Right 922236575 1:223726799-223726821 ATGCATGGGGAATTCCACTTTGG 0: 1
1: 0
2: 0
3: 15
4: 120
922236565_922236573 0 Left 922236565 1:223726762-223726784 CCTCCCAGCCCCTGATACAAATG 0: 1
1: 0
2: 3
3: 16
4: 199
Right 922236573 1:223726785-223726807 AAGGATGATTGTACATGCATGGG 0: 1
1: 0
2: 0
3: 14
4: 146
922236565_922236577 16 Left 922236565 1:223726762-223726784 CCTCCCAGCCCCTGATACAAATG 0: 1
1: 0
2: 3
3: 16
4: 199
Right 922236577 1:223726801-223726823 GCATGGGGAATTCCACTTTGGGG 0: 1
1: 0
2: 0
3: 8
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922236565 Original CRISPR CATTTGTATCAGGGGCTGGG AGG (reversed) Intronic
900270997 1:1788562-1788584 CATTTGTCTCAGTACCTGGGAGG - Intronic
900560451 1:3303235-3303257 CATGATTACCAGGGGCTGGGGGG - Intronic
900709904 1:4107176-4107198 CAACTGTATCAGGAGCTGGGAGG + Intergenic
901642612 1:10700549-10700571 CATGTGTGTCAGGGGTGGGGTGG + Intronic
902480850 1:16710779-16710801 CTTTGGGATCAGGGGCTGGTGGG + Intergenic
902649842 1:17829885-17829907 CAGCTGGGTCAGGGGCTGGGTGG + Intergenic
907596078 1:55721231-55721253 CAAATGTTTCAGGGGTTGGGGGG - Intergenic
907773860 1:57493300-57493322 GGTTGGTACCAGGGGCTGGGGGG - Intronic
910842665 1:91575656-91575678 AATTTGCAGCAGTGGCTGGGGGG + Intergenic
911209034 1:95120233-95120255 CATTGGTATCAGGCGCTGGATGG + Intronic
912105195 1:106264757-106264779 CATTTGTAGCAGTGTCAGGGGGG + Intergenic
912507391 1:110165593-110165615 CATGTGTAACAGGGCCTGGCTGG + Intronic
913017341 1:114752470-114752492 CACTTGGAGCAGGGGTTGGGGGG - Intronic
913701226 1:121376257-121376279 CATTTGTTTCAGGGTCTTGTTGG + Intronic
914041783 1:144056724-144056746 CATTTGTTTCAGGGTCTTGTTGG + Intergenic
914136307 1:144903762-144903784 CATTTGTTTCAGGGTCTTGTTGG - Intronic
914876214 1:151514148-151514170 CATGTGGATCAGGGGCCAGGAGG - Intronic
915051776 1:153083332-153083354 CTTTTGTATCAGGGTATTGGCGG - Intergenic
915239777 1:154512162-154512184 CATGGTTACCAGGGGCTGGGAGG - Intronic
916813135 1:168323792-168323814 CATCTGTAGGAGAGGCTGGGAGG - Intergenic
918187008 1:182136602-182136624 CATTCTTATCAGAGGCTGAGGGG + Intergenic
919766469 1:201130405-201130427 CAGTGGTAACAGGGGCTGAGGGG + Intergenic
920488652 1:206394979-206395001 CATTTGTTTCAGGGTCTTGTTGG + Intronic
920631684 1:207659066-207659088 CAATTGTAGCTGGAGCTGGGAGG - Intronic
921761856 1:218924039-218924061 TAATTGAATCAGGGGGTGGGGGG + Intergenic
922236565 1:223726762-223726784 CATTTGTATCAGGGGCTGGGAGG - Intronic
924760177 1:246977102-246977124 CATTTATATCTGGGGCTTGAGGG - Intronic
924905208 1:248444813-248444835 CATTTGTTTCAGGGGAGTGGAGG - Intergenic
924922680 1:248647236-248647258 CATTTGTTTCAGGGGAGTGGAGG + Intergenic
1062827310 10:582143-582165 TTTTTGTAGCAGGGGGTGGGTGG - Intronic
1065261805 10:23931563-23931585 CATTTGTGTCAGGCATTGGGAGG - Intronic
1067279784 10:44862482-44862504 CAGCTGTAGCTGGGGCTGGGAGG - Intergenic
1067664090 10:48258412-48258434 TATTTAAATCAGGGGCTGTGGGG - Intronic
1067833099 10:49621540-49621562 CATTAGTACCGGGGGGTGGGAGG + Intronic
1068186980 10:53598018-53598040 CATTTGTCTCAGGGAGTGGAAGG + Intergenic
1071790204 10:88945901-88945923 CATTTTCATCAGGGGCTGCATGG - Intronic
1074053865 10:109904467-109904489 CAGTTATTTCAGGGGCGGGGTGG - Intronic
1074735860 10:116431918-116431940 CATTTGCATCAAGACCTGGGGGG - Intronic
1075985353 10:126780281-126780303 CATCGGTAGCATGGGCTGGGTGG - Intergenic
1076145145 10:128112865-128112887 CCTTTGTAATAGGGCCTGGGCGG - Intronic
1076485419 10:130812613-130812635 CATTTGGGCCAGGGGCAGGGAGG - Intergenic
1080734456 11:34998721-34998743 CATTGGTTTCAGGAGATGGGGGG + Intronic
1084570907 11:69959418-69959440 CACGTGTGTCAGGGGCAGGGAGG - Intergenic
1086913832 11:92504770-92504792 TATGTGTATCAGGTACTGGGAGG + Intronic
1089014580 11:115155744-115155766 CTGTTGTGTCAGGGGCTGAGTGG - Intergenic
1090943199 11:131407139-131407161 CATTTCTATCAGTGGCTTGAGGG + Intronic
1090961102 11:131557725-131557747 CATTTGAATGAGGGGCTAGCAGG + Intronic
1091002696 11:131923846-131923868 CATTTGAAACTGGGGATGGGAGG - Intronic
1095728695 12:45480730-45480752 TATTTGTTGCAGGGGTTGGGAGG - Intergenic
1096194616 12:49642018-49642040 CAATAGTGTGAGGGGCTGGGCGG + Exonic
1098519173 12:71416537-71416559 AAATTATAACAGGGGCTGGGGGG + Intronic
1102194743 12:111017080-111017102 CACTTGAATCAGGGAATGGGAGG - Intergenic
1105462687 13:20607020-20607042 AATTTATATCAGGGGCAGGAAGG + Intronic
1107725603 13:43296153-43296175 CATTTGGATTTGGGGCTGGGGGG - Intronic
1108468657 13:50745385-50745407 GATGGTTATCAGGGGCTGGGAGG + Intronic
1115509612 14:34126724-34126746 CATTTCTATCAGGGGTTGTGAGG - Intronic
1120821653 14:88916894-88916916 CTTTTGCTTCAGGGGCTGTGAGG + Intergenic
1122893539 14:104744067-104744089 CATTGGCATCAGTGGGTGGGTGG + Intronic
1122994695 14:105256740-105256762 CACTTGTGCCTGGGGCTGGGAGG - Intronic
1123065236 14:105615732-105615754 CATTTGTCTCAGGGGCAGGAGGG - Intergenic
1123069434 14:105635168-105635190 CATTCGTCTCAGGGGCAGGAGGG - Intergenic
1124962015 15:34405748-34405770 CACTTGCATCAGAGCCTGGGAGG + Intronic
1124978638 15:34551969-34551991 CACTTGCATCAGAGCCTGGGAGG + Intronic
1125175951 15:36821960-36821982 CATTTTAATCAGGAGCTTGGAGG + Intergenic
1129341808 15:74891242-74891264 CATTTGTATCCAGACCTGGGAGG + Intronic
1129604183 15:77016778-77016800 CATTTGAGTCAGGTGCTGGAAGG - Intronic
1130254384 15:82319130-82319152 CCTTTGTATCTGGGCCTGTGGGG - Intergenic
1130600581 15:85270840-85270862 CCTTTGTATCTGGGCCTGTGGGG + Intergenic
1131438319 15:92440216-92440238 CATCTGTAAAACGGGCTGGGTGG + Intronic
1132456423 16:26192-26214 TATTTATAACAGGGGCTGTGTGG - Intergenic
1132525424 16:411798-411820 CATTTCTGGCAGGTGCTGGGTGG + Intronic
1132686242 16:1163303-1163325 CAGTTGGAGCAGGGCCTGGGAGG + Intronic
1136541745 16:30931158-30931180 CATTTCTAATAGAGGCTGGGGGG - Intronic
1139796372 16:69486250-69486272 CATTTGGTCCAGGTGCTGGGTGG + Intergenic
1140520862 16:75580291-75580313 CATTTGGAGCAGGGACTGGTGGG + Intergenic
1140928197 16:79601915-79601937 CATTTGCAACTGGGGGTGGGGGG - Intergenic
1141631144 16:85288747-85288769 CATTGGAATCTGGGGGTGGGGGG + Intergenic
1142124934 16:88405522-88405544 CATTTGCATCAGGGCCTTGGGGG + Intergenic
1143179472 17:4975077-4975099 TATTTGTATATGGGGCGGGGAGG - Intronic
1143329118 17:6120954-6120976 CATTTGTATCTGGGGGTGCCTGG - Exonic
1146505550 17:33401478-33401500 CATGACCATCAGGGGCTGGGTGG - Intronic
1149796750 17:59528063-59528085 GATTTGTTTTAGGGGCTGGAAGG - Intergenic
1153035057 18:754017-754039 CATTTCTCACAGGGACTGGGTGG + Intronic
1155379288 18:25201346-25201368 TATTTGAAGCAGGGCCTGGGAGG - Intronic
1156758376 18:40556647-40556669 AATTTGTAACAGAGGCAGGGCGG - Intergenic
1158557587 18:58488019-58488041 CATTTCTACCAGGCTCTGGGGGG + Intronic
1159812312 18:73030403-73030425 CATTTGTCTCAGGTGAGGGGAGG + Intergenic
1161042046 19:2115488-2115510 CATTTGTCACATGGGCTGTGGGG - Intronic
1163450817 19:17376456-17376478 CATGTGTATCCTGGGCTGGATGG - Intronic
1163773953 19:19207026-19207048 CTGTTGTAACAGTGGCTGGGAGG + Intergenic
1164532460 19:29058709-29058731 TATGTGTGTCAGGGGCTGGTGGG + Intergenic
1164837497 19:31366737-31366759 CATGTGCATCAGGGGCTCGGTGG + Intergenic
1165685164 19:37813480-37813502 CATTGGTTTCATGGGCTGGCAGG - Intronic
1166130753 19:40744291-40744313 CATTTGTACCAAGGGGTGGAAGG - Intronic
1166583411 19:43923762-43923784 CGTGGTTATCAGGGGCTGGGAGG - Intronic
929924437 2:46196884-46196906 GATTTGAATCTGGGTCTGGGTGG + Intergenic
931027629 2:58131108-58131130 CAATGGTATCAGAGGCTGGGGGG - Intronic
931255559 2:60569158-60569180 TCTCTGTATCAGGGGCTGGGTGG + Intergenic
931455864 2:62409435-62409457 CATTTGTATCTGGGTGTGGTGGG - Intergenic
931668439 2:64626410-64626432 GCTTTGTAACAGGGGCAGGGTGG - Intergenic
932312320 2:70753580-70753602 GATGTGTGTCAGGGGTTGGGGGG + Intronic
932446259 2:71783318-71783340 GATTTGTATCTGGAGATGGGTGG - Intergenic
935587664 2:104816345-104816367 CATTTGTATTAGGCGCTGAGTGG + Intergenic
936019788 2:108986105-108986127 CATTTGTCTCAGGGGCCAGTGGG + Intronic
937815897 2:126250575-126250597 CTTTTGTAACAGTGGCTTGGAGG + Intergenic
938200504 2:129368670-129368692 CATTTGTTTCAAGGGGTGGTTGG + Intergenic
939096287 2:137836941-137836963 CACCTGTATCACTGGCTGGGAGG + Intergenic
942353046 2:175074821-175074843 CATCTTTATCAGCAGCTGGGTGG + Exonic
942656349 2:178217977-178217999 CTTTTGTATCAGTGGTTGGCAGG + Intronic
944406729 2:199393118-199393140 CATTTGTAGCAGAGGGTGGGTGG - Intronic
945594341 2:211773178-211773200 CCTTGGTAGCAGAGGCTGGGAGG + Intronic
946390688 2:219415066-219415088 GATGTTTACCAGGGGCTGGGAGG + Intergenic
1173895333 20:46546353-46546375 CATCTCTATCAGGAGGTGGGTGG + Intronic
1174489079 20:50879632-50879654 CCCCTGTTTCAGGGGCTGGGAGG - Intronic
1174764373 20:53238585-53238607 CATTTGTTTAAGGAGCAGGGAGG - Intronic
1175390139 20:58621925-58621947 CTTTAGTAGCAGGGCCTGGGAGG - Intergenic
1178336164 21:31745424-31745446 TATTTGTGTTAGGGGGTGGGGGG - Intergenic
1179976624 21:44872097-44872119 CAACTGTATCAGTGGCTCGGGGG - Intronic
1180176789 21:46094515-46094537 CATTTGCATCTGTGGGTGGGAGG - Intergenic
1180689400 22:17698807-17698829 CATTGTTGTCGGGGGCTGGGAGG - Intronic
1180698463 22:17769202-17769224 CGTTTCTGCCAGGGGCTGGGTGG - Intronic
1181362372 22:22347939-22347961 CATATGTATCAGAGGTTTGGCGG - Intergenic
1182314797 22:29438481-29438503 CATAAGAATTAGGGGCTGGGAGG - Intergenic
1182518599 22:30872685-30872707 CTGTTGAATCAGGGGCAGGGAGG + Intronic
1182695152 22:32193559-32193581 CATAAGAATTAGGGGCTGGGAGG + Intronic
1184405741 22:44299419-44299441 CATTTGTAAAATGGGCTGAGTGG + Intronic
1185067772 22:48640601-48640623 CATTTCTTGCAGAGGCTGGGCGG + Intronic
949179440 3:1110769-1110791 GATTTGAATCAGGACCTGGGAGG - Intronic
949614772 3:5741100-5741122 CACTAGTGACAGGGGCTGGGGGG - Intergenic
950896862 3:16460568-16460590 CATTTCAAGCAGAGGCTGGGTGG + Intronic
951068330 3:18295117-18295139 CATTAGTTTCAGGGCCTGTGAGG - Intronic
951347776 3:21566855-21566877 CAGTGGTTTCAGGGTCTGGGAGG - Intronic
951541689 3:23788146-23788168 CATTTGAATCCGGGGGTCGGAGG - Intergenic
954394673 3:50287208-50287230 CATTTGGATCTGGGGCCTGGGGG + Exonic
954799461 3:53178803-53178825 CATTTGTGCCAGGGCCTGTGCGG + Intronic
955102887 3:55869362-55869384 CATTTGTATGAGGGGAGGAGAGG - Intronic
959721170 3:109491048-109491070 AATTTGTATCAGGGACTGATAGG - Intergenic
962866711 3:139453233-139453255 CCTTGGTATCTGGGGGTGGGAGG + Intronic
966744033 3:183258642-183258664 CATGGATATCAGGGGCGGGGGGG - Intronic
967453315 3:189651709-189651731 CCCTTGCATCATGGGCTGGGAGG + Intronic
969572409 4:8017182-8017204 TAGTTGTATGAGGGCCTGGGAGG - Intronic
970309676 4:14768855-14768877 CATTTGTAGCAGATGCTGCGGGG - Intergenic
971869698 4:32218873-32218895 TAATTGTATCAGGGACTTGGGGG + Intergenic
972361475 4:38329443-38329465 CATTTGTGTCTGAGGCTGGAAGG - Intergenic
975904018 4:79188238-79188260 TAATTTTATCAGGGGCAGGGAGG + Intergenic
976775002 4:88698147-88698169 CATTTGTAGAAGGGCCTGGATGG - Exonic
988177989 5:27752369-27752391 AATCTGTATCAGGCCCTGGGTGG - Intergenic
990982862 5:61617228-61617250 GATTTTTATCATGGGCTGGCTGG + Intergenic
992303156 5:75405901-75405923 CCATTGTATCAGTGGTTGGGGGG - Intronic
997552261 5:134763537-134763559 CATTTGTTACAGAGGCTTGGAGG - Intronic
997698436 5:135879742-135879764 CATGTGTATCAGGGTCTGGGAGG + Intronic
997702316 5:135911330-135911352 CCATTGAACCAGGGGCTGGGTGG + Intergenic
997867588 5:137478561-137478583 CAAATGTACTAGGGGCTGGGGGG - Intronic
1001117044 5:168948466-168948488 CATTTCTCTCAGGTGCTGAGAGG - Intronic
1001489373 5:172144849-172144871 CATCTGTAAAAGGGGGTGGGGGG - Intronic
1002442980 5:179273949-179273971 CATGGGGTTCAGGGGCTGGGTGG - Intronic
1002704594 5:181151709-181151731 CAGTTGAAGCTGGGGCTGGGAGG + Intergenic
1005049072 6:21666865-21666887 TCTTTATATGAGGGGCTGGGGGG + Intergenic
1005578195 6:27209740-27209762 TATTTGTATGTGGGGCTGTGGGG - Intergenic
1005681962 6:28216965-28216987 CATATGCATCAGTGGCTGGGTGG + Intergenic
1005736893 6:28756270-28756292 CTTTAGCATCAGCGGCTGGGCGG + Intergenic
1005969203 6:30748227-30748249 CATTTGTATGAGTGGTTTGGAGG - Intergenic
1007598804 6:43068725-43068747 CATTTGAATCCGGGGGTTGGTGG + Intronic
1008430305 6:51408946-51408968 CATTTTAATTTGGGGCTGGGAGG - Intergenic
1011347558 6:86388768-86388790 CAATTTAATCATGGGCTGGGTGG + Intergenic
1013634939 6:112020272-112020294 CAGTGGCATCAGGGGCTGGAGGG + Intergenic
1015291809 6:131546162-131546184 CCTTTGTTGCAAGGGCTGGGTGG - Intergenic
1016603242 6:145888203-145888225 CACTTGTGGCAGGTGCTGGGAGG + Intronic
1019194809 6:170274898-170274920 CATCTGTCTCTGGGGCTGGCAGG - Intergenic
1019549800 7:1596357-1596379 AGATTGTATCAGGGGCTGAGTGG - Intergenic
1020043028 7:5018475-5018497 CATCTGTCTCTGGGTCTGGGAGG - Intronic
1022012957 7:26324996-26325018 CATTGGTCTCAGAGGATGGGTGG + Intronic
1023373154 7:39531658-39531680 CTTTTTTATTGGGGGCTGGGAGG - Intergenic
1024457848 7:49629516-49629538 AATTTGTAACAGGTGCAGGGAGG - Intergenic
1024899637 7:54304058-54304080 CAATGGTGTCAGGTGCTGGGTGG + Intergenic
1026256679 7:68718283-68718305 AATTTGTATCAAGAGCTGGAGGG + Intergenic
1028318012 7:89427914-89427936 CATATATATCTGGGGCAGGGAGG + Intergenic
1028487298 7:91373893-91373915 TATTTGTGTCAGAGGCTGGAGGG - Intergenic
1029572479 7:101379359-101379381 CCTCTGCATCAGGGGCTCGGAGG + Intronic
1030168801 7:106581007-106581029 CATTTGTATGAGAGTCTGGGTGG + Intergenic
1031349153 7:120707301-120707323 CCTTTGTGTCAGGTGCAGGGAGG + Intronic
1033649412 7:143329497-143329519 CATTTGCACCAGGGGGAGGGTGG - Intronic
1033877583 7:145842040-145842062 CAGATGTACCAGGGGCTGGGTGG - Intergenic
1035546133 8:483648-483670 CCGTGGTATCTGGGGCTGGGTGG + Intergenic
1036590163 8:10161822-10161844 CATGGTTATCAGGGGCGGGGCGG - Intronic
1036610250 8:10343653-10343675 CATTTGTAAAGGGTGCTGGGGGG + Intronic
1037403052 8:18512939-18512961 CAGTTATTCCAGGGGCTGGGAGG - Intergenic
1039605970 8:38880969-38880991 CATGTGAATTAGGGGTTGGGGGG + Intergenic
1040540397 8:48348226-48348248 CACTTGTGCCAGGGGGTGGGGGG - Intergenic
1040995334 8:53395539-53395561 CACATGTCTCAGGGGCTGGTGGG + Intergenic
1041611163 8:59851177-59851199 CATGATTATCAGAGGCTGGGTGG - Intergenic
1041672304 8:60504008-60504030 CATTTGAATCTGGAGCTTGGGGG - Intergenic
1042044861 8:64638747-64638769 AATTTGTTTCAGGGGCTGGGAGG + Intronic
1042127142 8:65549618-65549640 CATTTGTCACAGAGTCTGGGTGG - Intergenic
1043259331 8:78177773-78177795 CATGTGCATCAGCGACTGGGCGG - Intergenic
1043462800 8:80477853-80477875 CAATTGTGACAAGGGCTGGGAGG + Intergenic
1045424737 8:102054178-102054200 CCATTGTCTCAGGGGCAGGGAGG + Intronic
1047170017 8:122483622-122483644 CATTTCCATCACGGGCTGGATGG - Intergenic
1048182492 8:132208929-132208951 TATTTGTATCAGGGTCTGGGAGG + Intronic
1049131267 8:140844983-140845005 CATTTGAATTAGGGACAGGGAGG - Intronic
1052002683 9:23305997-23306019 AATTTTTTTCAGGGGATGGGTGG + Intergenic
1055271197 9:74561004-74561026 CATTTGACTCAGGAGCTGGGAGG - Intronic
1056969526 9:91190921-91190943 TGTTTGTAAAAGGGGCTGGGGGG - Intergenic
1059360533 9:113738708-113738730 CATTTCTAACAGGCCCTGGGTGG + Intergenic
1059794418 9:117676534-117676556 TAGTTGTATCAGAGCCTGGGTGG - Intergenic
1060293861 9:122329927-122329949 CATTTGTATCAAGGCCTGGCAGG - Intergenic
1060398584 9:123333775-123333797 CATTTGAATCAGGATCTCGGGGG + Intergenic
1060816340 9:126637463-126637485 CATTTGTGTGTGGGGGTGGGGGG + Intronic
1062039722 9:134398688-134398710 CATCTGGAGCAGGGGGTGGGTGG + Intronic
1188152971 X:26701850-26701872 CAATTATATCAGAGGCTGTGAGG + Intergenic
1189713718 X:43842880-43842902 GAATATTATCAGGGGCTGGGGGG + Intronic
1192012425 X:67289227-67289249 CATTTGTGACCTGGGCTGGGAGG + Intergenic
1192203286 X:69080798-69080820 CATCTGTAGCTGGGGGTGGGGGG + Intergenic
1194685582 X:96909818-96909840 CATTTGAAACAGGGGATGTGTGG + Intronic
1197674524 X:129315050-129315072 CTTTGGTGCCAGGGGCTGGGAGG + Intergenic
1198030256 X:132747645-132747667 CATTTGTACAAGGGGGAGGGAGG + Intronic
1199746842 X:150777121-150777143 CATTTGTATCAGGGGAGCAGAGG + Intronic
1200399939 X:156013531-156013553 TATTTATAACAGGGGCTGTGTGG + Intergenic
1200964150 Y:9021071-9021093 CATTCGTATCACAGGCTTGGGGG + Intergenic