ID: 922243335

View in Genome Browser
Species Human (GRCh38)
Location 1:223771303-223771325
Sequence CCTTGTGATCAGAGTCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 145}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922243335_922243343 27 Left 922243335 1:223771303-223771325 CCAGCCAGACTCTGATCACAAGG 0: 1
1: 0
2: 0
3: 17
4: 145
Right 922243343 1:223771353-223771375 CATGCAGTCTTGATGCTAGGTGG 0: 1
1: 0
2: 0
3: 9
4: 99
922243335_922243340 2 Left 922243335 1:223771303-223771325 CCAGCCAGACTCTGATCACAAGG 0: 1
1: 0
2: 0
3: 17
4: 145
Right 922243340 1:223771328-223771350 TCTGTTGACTGCAAGGAAGCTGG 0: 1
1: 0
2: 1
3: 18
4: 253
922243335_922243338 -5 Left 922243335 1:223771303-223771325 CCAGCCAGACTCTGATCACAAGG 0: 1
1: 0
2: 0
3: 17
4: 145
Right 922243338 1:223771321-223771343 CAAGGCCTCTGTTGACTGCAAGG 0: 1
1: 0
2: 0
3: 21
4: 176
922243335_922243341 3 Left 922243335 1:223771303-223771325 CCAGCCAGACTCTGATCACAAGG 0: 1
1: 0
2: 0
3: 17
4: 145
Right 922243341 1:223771329-223771351 CTGTTGACTGCAAGGAAGCTGGG 0: 1
1: 1
2: 1
3: 19
4: 199
922243335_922243342 24 Left 922243335 1:223771303-223771325 CCAGCCAGACTCTGATCACAAGG 0: 1
1: 0
2: 0
3: 17
4: 145
Right 922243342 1:223771350-223771372 GGACATGCAGTCTTGATGCTAGG 0: 1
1: 0
2: 3
3: 18
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922243335 Original CRISPR CCTTGTGATCAGAGTCTGGC TGG (reversed) Intronic
900735214 1:4295412-4295434 CCTGCTGATCAGAGGCTGGAAGG - Intergenic
902871236 1:19314766-19314788 CCTTGTGTTCAGACTCTGCAAGG + Intronic
903263910 1:22145088-22145110 CCTTGTGATGAGAGGTTAGCTGG + Intergenic
906796154 1:48697932-48697954 AGTTGTGACCAGAGTCAGGCTGG - Intronic
910227469 1:84950730-84950752 GCTTGTGTTCAGAGACAGGCAGG - Intronic
911248603 1:95548787-95548809 TCTTCTGCTCAGAATCTGGCAGG + Intergenic
913253902 1:116937172-116937194 CCTTGGGAGCAGAGCATGGCTGG + Intronic
915879292 1:159649334-159649356 ACTTGTGAGCACAGGCTGGCTGG + Intergenic
915900941 1:159846375-159846397 CCTGGTGAGCAGAGTCAGCCAGG - Intronic
917494066 1:175524204-175524226 CCTTGTGTTCAGAGTCCAGATGG + Intronic
919500105 1:198327803-198327825 CCTCATGATTAGAGTCGGGCAGG + Intergenic
920516749 1:206590493-206590515 CCCTCAGATCAGACTCTGGCAGG + Intronic
922243335 1:223771303-223771325 CCTTGTGATCAGAGTCTGGCTGG - Intronic
1067458631 10:46441156-46441178 CCTTCTGCCAAGAGTCTGGCAGG + Intergenic
1068753061 10:60618778-60618800 CATTTGGATCAGAGTTTGGCTGG - Intronic
1073403438 10:103277053-103277075 GCTCCTGCTCAGAGTCTGGCCGG - Intergenic
1076136948 10:128051736-128051758 CCTTGTGCTCAGTGACAGGCAGG + Intronic
1076482642 10:130794841-130794863 CCGTGTGCTCAGCGTCTTGCAGG + Intergenic
1076519764 10:131074088-131074110 CGTTGTGACCGGGGTCTGGCTGG - Intergenic
1077322594 11:1948970-1948992 GCTTGAGATGAGAGGCTGGCAGG - Intronic
1077543564 11:3159094-3159116 CCTTGTGTTCAGAGGGTGGCTGG - Intronic
1081375864 11:42357642-42357664 CCTTTTGATCAGAGTTTGAGTGG - Intergenic
1081739694 11:45430077-45430099 CCTTGGAATAAGAGTCTGGGAGG - Intergenic
1083141912 11:60729057-60729079 CCTTTTGTTCACAGTCTGGATGG - Intergenic
1083553760 11:63609834-63609856 CCTGGTGGTCAAAGTCTGGGAGG - Intronic
1084640287 11:70421781-70421803 ACTTGTGATCTGTGTATGGCAGG + Intronic
1088527998 11:110777196-110777218 CCTTGAGATCAGGGATTGGCTGG + Intergenic
1089652339 11:119922446-119922468 CTTTGTGAGCAGAGTGTGGCTGG + Intergenic
1090560955 11:127931884-127931906 CGTTGTGCACAGAGTCTGACCGG - Intergenic
1090864757 11:130689873-130689895 CCCTTTGACCAGAATCTGGCTGG - Intronic
1202805611 11_KI270721v1_random:4283-4305 GCTTGAGATGAGAGGCTGGCAGG - Intergenic
1091685641 12:2559737-2559759 CCTTGTGATGAGGTTCTGCCCGG + Intronic
1093761370 12:22915137-22915159 CTTTGTGATCAGAGTCTCTGTGG + Intergenic
1093993713 12:25618576-25618598 CCTTGTGATGAGACTGTGGGAGG + Intronic
1095215959 12:39548142-39548164 CCTTCTGATCAGTGGCTGACTGG - Intergenic
1097456841 12:59809322-59809344 CCTTGTGATCTGAGTGTGGATGG + Intergenic
1098016299 12:66108186-66108208 CTTTGAGATGAGAGGCTGGCCGG - Intergenic
1104140801 12:125984189-125984211 CCTTGGGATCAGTATCTGGTGGG + Intergenic
1108640403 13:52378089-52378111 CTTGCGGATCAGAGTCTGGCTGG + Exonic
1113463902 13:110500695-110500717 TCTTGTGAGCAGAGGCTTGCAGG - Intronic
1114227778 14:20754507-20754529 TATTGTGATCACATTCTGGCTGG + Intergenic
1115864510 14:37729488-37729510 CCTTGTGCTCAGTCCCTGGCTGG - Intronic
1118273072 14:64361544-64361566 CCTTGCTTTCAGAGTTTGGCTGG + Intergenic
1118786341 14:69048635-69048657 CCTTGTGATCAGTAGCTGGCTGG - Intergenic
1123697970 15:22892622-22892644 CCTTGTGATAGGTGTCAGGCTGG - Intronic
1125737506 15:41937485-41937507 GCTGTTGATCAGAGCCTGGCTGG - Intronic
1128045398 15:64613484-64613506 CCTTGTCATGAGAGGCTAGCAGG - Intronic
1131046765 15:89321611-89321633 CCCTGTGATCTGGGTCAGGCAGG - Intronic
1132723321 16:1327509-1327531 CCTTGGGACCTGGGTCTGGCTGG + Intergenic
1135349755 16:21718759-21718781 CCTGGTGTTCAGAACCTGGCAGG + Intronic
1135630940 16:24035252-24035274 CCTTCTGATGAGATCCTGGCAGG + Intronic
1136420695 16:30130816-30130838 TGTGGTGATCAGAGGCTGGCAGG + Intergenic
1136682028 16:31973342-31973364 CATTGTCATCAGATTCTTGCAGG + Intergenic
1136782336 16:32914844-32914866 CATTGTCATCAGATTCTTGCAGG + Intergenic
1136887453 16:33939007-33939029 CATTGTCATCAGATTCTTGCAGG - Intergenic
1138078359 16:54065014-54065036 CATTGTGACCAGAGTCAGGCGGG - Intronic
1138704107 16:58896480-58896502 TTTTGTGAACAGTGTCTGGCAGG - Intergenic
1140230659 16:73114765-73114787 CCTTGTGATCAAAGACAGGCTGG - Intergenic
1140244983 16:73239929-73239951 CATTGTGACCAGAGGCTTGCAGG - Intergenic
1140445331 16:75022849-75022871 CCTTGTGCTGAGAGTCTAGGAGG + Intronic
1141246660 16:82314170-82314192 CCATGTGAACAGAGTCAGGCTGG + Intergenic
1141631468 16:85290277-85290299 CCTTGTGATGAGAAGATGGCAGG - Intergenic
1203085000 16_KI270728v1_random:1178831-1178853 CATTGTCATCAGATTCTTGCAGG + Intergenic
1149426496 17:56559553-56559575 TCTTGTGACCAGAGGCTTGCAGG - Intergenic
1149943604 17:60898211-60898233 CTTTTTGATTAGAATCTGGCTGG + Intronic
1150474354 17:65463381-65463403 CAGTGTGCTCAGAGGCTGGCTGG - Intergenic
1151202106 17:72476195-72476217 CTCTGTGATCAGAGTCTTGCAGG - Intergenic
1152272886 17:79335531-79335553 CCTAGAGATGAGAGGCTGGCTGG - Intronic
1152974372 18:199818-199840 TGTTGTGATCAAAGGCTGGCGGG + Intronic
1155629866 18:27880247-27880269 CCTTGTCATGAGAATCTGGTAGG - Intergenic
1156485016 18:37459654-37459676 CCTTGGCCTCAGAGTCTGGAGGG + Intronic
1160305922 18:77736512-77736534 CCTTGTGCTCAGAGTCAGGAGGG + Intergenic
1165314680 19:35047354-35047376 CCTTGTGGTCTGTGTGTGGCTGG + Intronic
1166205399 19:41265585-41265607 CCTGGTGTCCAGAGGCTGGCGGG + Intronic
1166273924 19:41737989-41738011 CCTTGTTATCAGATTTTAGCTGG + Intronic
928424939 2:31170155-31170177 CCTTTTGGGCTGAGTCTGGCTGG + Intergenic
928679122 2:33680837-33680859 CCTGGAGATAAGAGCCTGGCAGG + Intergenic
929945389 2:46367653-46367675 CCTTCTGCTCTGAGACTGGCTGG + Intronic
931071078 2:58650937-58650959 CCTGGTGAGCAGATTCTGCCTGG - Intergenic
931627999 2:64274158-64274180 CCCAGTGATCAGAGGCTGGCTGG + Intergenic
931746341 2:65294771-65294793 ACTTGTGAGCAGAGACTAGCAGG + Intergenic
936090685 2:109499597-109499619 CCTTATGCTTAGAGTCTGACAGG - Intronic
936754195 2:115685810-115685832 CCTTGTGTTCAAATTCTGGCAGG + Intronic
937047812 2:118861365-118861387 CCCTGTCATCAGAGGCTGGAGGG + Intergenic
937424662 2:121788868-121788890 TCTTGTGAGCAGAGGCTTGCAGG + Intergenic
946197109 2:218040226-218040248 ACTTGTGATTAGAGACTGCCAGG - Intronic
946213670 2:218167090-218167112 ACTTGTGATTAGAGACTGCCAGG + Intergenic
946518692 2:220442341-220442363 ACTTGTCATCACAGTGTGGCAGG - Intergenic
948904911 2:240974979-240975001 TCTTTTGATCAGTGTCTGGGTGG + Intronic
1169516646 20:6323255-6323277 TATTGTGACCAGAGTCTGACAGG - Intergenic
1170721881 20:18888566-18888588 TCTTGTGATCAAGGGCTGGCAGG + Intergenic
1173347739 20:42216287-42216309 CCTTGTGGTTATAGTCTAGCAGG - Intronic
1174273622 20:49387376-49387398 CCTTGTCCTCTGAGTCTGGCTGG + Intronic
1175279225 20:57792100-57792122 CCTTGTCCTCAGCGCCTGGCTGG + Intergenic
1175453924 20:59095382-59095404 CCTGGTGCTCAGTGTTTGGCTGG - Intergenic
1181730459 22:24842599-24842621 CATGGGGATCAGAGCCTGGCAGG + Intronic
1182710536 22:32320197-32320219 CCTTTTGATCAGTGTCAGGGTGG - Intergenic
1183150062 22:36029776-36029798 CCTTGTCCTCACAGTCTGGTAGG - Intergenic
1183263497 22:36811548-36811570 CCTTAAGATCTGAGTGTGGCAGG + Intronic
1184049375 22:41992872-41992894 CCTTATGGGCAGAATCTGGCTGG - Intronic
1184594616 22:45506285-45506307 CCTTCTGCTCAGCGCCTGGCTGG - Intronic
1184655008 22:45936682-45936704 CCTGGACATCAGGGTCTGGCTGG - Intronic
949737447 3:7190240-7190262 CATGGTGATCAGAGTAAGGCAGG + Intronic
952573163 3:34742299-34742321 CCTTGTGCTCAGTTTTTGGCTGG + Intergenic
953742549 3:45550026-45550048 CATTTTGAGCAGAGTGTGGCTGG + Intergenic
960602164 3:119469135-119469157 CCTTGGGCTCGGGGTCTGGCCGG + Intronic
964031893 3:152147804-152147826 CCTTATGCTTAGATTCTGGCTGG - Intergenic
966943914 3:184764291-184764313 GGGTGTGATCAGAGTCTGGTTGG + Intergenic
968722234 4:2216160-2216182 CCTTGTGCCAAGAGACTGGCTGG - Intronic
977334058 4:95673685-95673707 CCTTGTGTCTAGAGTTTGGCTGG - Intergenic
978751752 4:112256891-112256913 TATTGTGATCAGAGGCTTGCAGG - Intronic
978771366 4:112459372-112459394 CTTTGTGATTAGAGTGGGGCAGG - Intergenic
979291933 4:118987941-118987963 ACTTTAGTTCAGAGTCTGGCAGG + Intronic
983528283 4:168783277-168783299 CCTGGAGATCAGAGGCTGCCAGG - Intronic
985164935 4:187082969-187082991 CCCTGTGATCACAGGCTGGCAGG + Intergenic
992888739 5:81184854-81184876 CCTTGAGGTCAGAGACTGCCTGG - Intronic
993277094 5:85874000-85874022 ACTTGTCACCAGGGTCTGGCTGG - Intergenic
997365728 5:133324159-133324181 CCCTTTGAGCACAGTCTGGCAGG - Intronic
999725297 5:154431761-154431783 TGTTGTGATCAGAGGCTTGCAGG - Intergenic
1000340445 5:160273207-160273229 TGTTGTGATCAGAGCCTTGCAGG - Intronic
1001454265 5:171848648-171848670 CACTGTGGTCAGAGGCTGGCGGG + Intergenic
1002212171 5:177605560-177605582 CCCTGTGCACAGAGGCTGGCAGG - Intronic
1002318902 5:178363525-178363547 ATTTGGGACCAGAGTCTGGCTGG - Intronic
1002567855 5:180122161-180122183 CCTTGTGATGAGAGTCTCACAGG + Intronic
1002597538 5:180334186-180334208 CCTAGTGATCAGGGTCTTGAGGG - Intronic
1005814239 6:29538067-29538089 CCTGATGATCAAAGTCAGGCTGG + Intergenic
1006411190 6:33874589-33874611 CCTTGTAAGCAGATTCTGTCAGG + Intergenic
1006418745 6:33920454-33920476 CATTGTGAGCAGACTCTGGTTGG + Intergenic
1008077933 6:47165426-47165448 CGTTGTGATCATAGGCTTGCGGG - Intergenic
1008717386 6:54305554-54305576 CCTTATCTTCAGAGTCTGGAAGG + Intergenic
1010528085 6:76928022-76928044 CCCTGTGAACAGAGTGTGTCTGG - Intergenic
1014232698 6:118921862-118921884 CCTTGAGATTAGAAACTGGCAGG - Intronic
1015595474 6:134862078-134862100 CATTGTGACCAGAGACTTGCAGG - Intergenic
1018444437 6:163842222-163842244 CTGTTTGATCAGACTCTGGCTGG + Intergenic
1018493846 6:164327246-164327268 CCTTGTGAGCAGAGTCACGATGG + Intergenic
1019678547 7:2330583-2330605 ACTTGTGATCAGGGTCTGGGGGG + Intronic
1024954863 7:54906786-54906808 TGTTGTGAACAGAGACTGGCAGG - Intergenic
1032670689 7:134079840-134079862 CCTTGTGCTCTGAGGCAGGCTGG - Intergenic
1033991253 7:147290107-147290129 TATTGTGATCAGAGGCTGGCAGG - Intronic
1037434448 8:18847798-18847820 CCCTGGGATCAGAGTCACGCTGG + Intronic
1037912276 8:22750656-22750678 CCTTGTGATTGCATTCTGGCTGG + Intronic
1039847541 8:41336405-41336427 CTTTGTCATGAGAGGCTGGCAGG - Intergenic
1045810613 8:106216048-106216070 ACTTGTGTGCAGAGTATGGCTGG + Intergenic
1046616847 8:116487034-116487056 ACATGTGGTAAGAGTCTGGCTGG - Intergenic
1047798839 8:128287847-128287869 CCTTGAGTTCAGAGTCTAGCAGG - Intergenic
1048374304 8:133809284-133809306 CCTTTTGATCATAGGGTGGCTGG - Intergenic
1049594565 8:143477464-143477486 CCTGGAGGTCTGAGTCTGGCTGG - Intronic
1053305982 9:36985276-36985298 CCGTGTGATGAGTGTGTGGCAGG - Intronic
1056957002 9:91090594-91090616 CCTTGTGATCAGCTTCTTGAAGG - Intergenic
1058879132 9:109271515-109271537 ACGAGTGATCAGAGTCTGGAAGG - Intronic
1061405289 9:130390432-130390454 CTTTGTGTTGAGAGGCTGGCTGG + Intronic
1061618418 9:131794995-131795017 CCGTGGGACCTGAGTCTGGCTGG - Intergenic
1189419341 X:40842687-40842709 GCTTGTGATCAGCTTGTGGCTGG + Intergenic
1190814853 X:53920974-53920996 TCCTTTGAGCAGAGTCTGGCAGG + Intergenic
1192508670 X:71708478-71708500 CCTTGTGATTAGATTCAGGTAGG - Intergenic
1192511971 X:71726220-71726242 CCTTGTGATTAGATTCAGGTAGG + Intergenic
1192514726 X:71755285-71755307 CCTTGTGATTAGATTCAGGTAGG - Intergenic
1192518027 X:71773075-71773097 CCTTGTGATTAGATTCAGGTAGG + Intergenic
1192528011 X:71864250-71864272 CCTTGTGATTAGACTCAGGTAGG - Intergenic
1200361951 X:155616480-155616502 TCTTGTGCTCAGAGATTGGCTGG + Intronic
1200448496 Y:3294843-3294865 GCTTGTGACCAGAGCCTGGAAGG - Intergenic
1201574310 Y:15445616-15445638 TCTTTTGAGCAGTGTCTGGCAGG - Intergenic
1201574436 Y:15446901-15446923 CCTTTTCAGCAGTGTCTGGCAGG - Intergenic