ID: 922243710

View in Genome Browser
Species Human (GRCh38)
Location 1:223774481-223774503
Sequence TGCTGAACACCATTGGTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 78}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922243707_922243710 2 Left 922243707 1:223774456-223774478 CCGTATCACTACAACTTAGAACC 0: 1
1: 0
2: 0
3: 4
4: 91
Right 922243710 1:223774481-223774503 TGCTGAACACCATTGGTTGCAGG 0: 1
1: 0
2: 1
3: 8
4: 78
922243706_922243710 30 Left 922243706 1:223774428-223774450 CCAGTTGAATCAATCTGATTTAA 0: 1
1: 0
2: 0
3: 17
4: 162
Right 922243710 1:223774481-223774503 TGCTGAACACCATTGGTTGCAGG 0: 1
1: 0
2: 1
3: 8
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922243710 Original CRISPR TGCTGAACACCATTGGTTGC AGG Intronic
905697019 1:39982013-39982035 TGCTGAAAGCCATAGATTGCTGG - Intergenic
905932249 1:41797301-41797323 TGCTGAAGACCTTAGGTTGCAGG + Intronic
907317399 1:53581207-53581229 TGCTGAGCACCACTGGGTACTGG + Intronic
907955067 1:59220539-59220561 TGCTCAATACCAGTGGGTGCAGG + Intergenic
913163454 1:116165697-116165719 TGCAGAACACCCCTGGTTCCGGG + Intergenic
914342658 1:146773613-146773635 TGCTGAAGGCCATTGGCAGCCGG + Intergenic
914708042 1:150187618-150187640 TTCTGATCACCCTTTGTTGCGGG + Intergenic
919461824 1:197885465-197885487 TTCTGAACACCAGTGATTGAGGG + Intergenic
921833124 1:219750445-219750467 TTCTGACCACCATTGACTGCAGG + Intronic
922243710 1:223774481-223774503 TGCTGAACACCATTGGTTGCAGG + Intronic
923420372 1:233809012-233809034 TGATGTACACCAATGGTGGCTGG + Intergenic
1064300900 10:14121753-14121775 TGCTGAAAACCATTGGCTTTAGG + Intronic
1065928674 10:30459124-30459146 GGCTGAACTGCATTCGTTGCAGG + Intronic
1067282365 10:44882004-44882026 TGCTGTCCACCATTGGATCCAGG - Intergenic
1068716585 10:60195437-60195459 CGCTAAACACTATTGGTTGGAGG - Intronic
1071214648 10:83386113-83386135 TGTTGAATACCATTGGTTAATGG + Intergenic
1071949106 10:90682738-90682760 TGCTTAACACCACTGGAAGCAGG + Intergenic
1077429326 11:2508221-2508243 TGGTGACCACCATGGGTTGGTGG - Intronic
1079324570 11:19480539-19480561 TGCTGAACACCATTGTAAACAGG - Intronic
1079852310 11:25551169-25551191 TGTTGGACACCATTGGAAGCTGG + Intergenic
1085146826 11:74207820-74207842 AGCTGAAAACCATTGGAGGCTGG - Intronic
1085236010 11:75016137-75016159 TGCTGAACTCCATGGGTTTATGG + Intronic
1086088231 11:82978438-82978460 TTCTGAATACCTTTAGTTGCTGG + Exonic
1096760041 12:53833881-53833903 TGATGAACACCATTACTTACTGG - Intergenic
1098085990 12:66844609-66844631 TGCTGAAAACAATTGATTGCAGG + Intergenic
1117559305 14:56919518-56919540 TGCTGAAAACCAATTGCTGCTGG - Intergenic
1120879445 14:89403617-89403639 TTCTGAAAACCATTTCTTGCTGG + Intronic
1124708914 15:31988687-31988709 TCCTTAACACCATTTGTTGTTGG + Intergenic
1124900386 15:33817248-33817270 TTTTGAGCACCACTGGTTGCAGG + Intronic
1130681421 15:86000348-86000370 TGTTGGACACCAGTTGTTGCTGG - Intergenic
1139991326 16:70941715-70941737 TGCTGAAGGCCATTGGCAGCCGG - Exonic
1141109820 16:81263004-81263026 TGAGGAACACCAGGGGTTGCCGG - Intronic
1152011827 17:77723720-77723742 TGCTGAACACCCTTCAGTGCTGG + Intergenic
1152166008 17:78706803-78706825 TGCTTAACATCATTAGTTGTAGG - Intronic
1153524948 18:5985981-5986003 TGCTCAGCACCCCTGGTTGCTGG - Intronic
927516909 2:23677184-23677206 GGCTGCACACCAGTGGGTGCGGG - Intronic
928194107 2:29201999-29202021 TTCTAAACACCATGGGATGCCGG - Intronic
928926185 2:36581539-36581561 ACCTGAACACCATTGGTTAATGG - Intronic
943301865 2:186212653-186212675 GACTCAACACCATTGCTTGCAGG + Intergenic
944193019 2:197023515-197023537 TGCTAAACTCTATGGGTTGCTGG - Intronic
946666783 2:222058913-222058935 TGCAGTTCACCATTGGTTGCAGG + Intergenic
948971231 2:241428808-241428830 TTCTGGATACCAGTGGTTGCTGG - Intronic
1176117555 20:63439682-63439704 CGCTGACCACCATTGGCTACGGG - Exonic
952356970 3:32593312-32593334 TTCTGAACACAATAGGTGGCCGG - Intergenic
952851563 3:37733970-37733992 TGGTGAACACCATTTGTTTGGGG - Intronic
956832133 3:73061686-73061708 TGCTGAGAACCATTGGTTTAAGG + Exonic
957040392 3:75331661-75331683 TGCTGCTCACCATTGGGTGCTGG + Intergenic
961119322 3:124360084-124360106 CGCTGAACACCACTGGCTCCTGG - Intronic
962875468 3:139532852-139532874 TACTGAACAGCATTTGTTGTGGG + Intronic
964481176 3:157139755-157139777 TAGTTAACACCATTGGTTACTGG + Intergenic
970222074 4:13821650-13821672 TGATGAACAGCATAGGTTTCTGG - Intergenic
978173043 4:105696937-105696959 TGCTCAACATCATTAGTTACTGG - Intronic
983212601 4:164974448-164974470 TGCTCAAGACCAGTGGATGCAGG - Intronic
983592046 4:169424776-169424798 TGCTGAGAATCATTGGTTCCAGG + Exonic
985045046 4:185932184-185932206 AGCTGAACAGCAATGCTTGCGGG + Intronic
985475903 5:78846-78868 TGCTGATCACCATTTCTTACAGG + Intergenic
987340915 5:16937847-16937869 ATCTGAACACCAGTGGTTGCAGG - Intergenic
989005408 5:36805188-36805210 TGCTCAACATCATTGGTAACTGG - Intergenic
994525111 5:100897213-100897235 AGCTTGACACTATTGGTTGCAGG - Intronic
994733126 5:103518043-103518065 TGATCAACACCACTGGTTACAGG + Intergenic
999194826 5:149774764-149774786 TGCAGAACTCCATTTGTAGCTGG + Intronic
1001450047 5:171817613-171817635 TGCTGCACACCATTGATGCCTGG + Intergenic
1002044180 5:176532849-176532871 GGCTGAACACCATTGGTCCCTGG - Intronic
1005710592 6:28500464-28500486 TTCTTAACACCACTGGTAGCTGG + Intergenic
1009857095 6:69278693-69278715 TGGTGAAGACCATGGGTTCCAGG + Intronic
1010769411 6:79811448-79811470 TAATGAACACCTTTGGTTGATGG + Intergenic
1012538838 6:100335780-100335802 TCCTGGACAGCAGTGGTTGCAGG - Intergenic
1012698009 6:102413982-102414004 TGGTGGAAACAATTGGTTGCAGG - Intergenic
1015251343 6:131131320-131131342 TGCAGAACACCTTTGCATGCAGG + Intergenic
1015637718 6:135295170-135295192 TGCTTAACATCATTAGTTGTTGG + Intronic
1019558355 7:1643603-1643625 TGCTGAACCCCATGGCCTGCAGG - Intergenic
1020643798 7:10788965-10788987 TGCTGTACACCATTGGTGGTGGG + Intergenic
1025996078 7:66528318-66528340 GGCTGAACACCATTGGTAGCTGG + Intergenic
1026793379 7:73349792-73349814 TGCTGAACACGTGTGGGTGCTGG - Intronic
1026987723 7:74565152-74565174 GGCTGAACGCCATTGGTAGCTGG + Intronic
1032178178 7:129650207-129650229 TGCTGAACACCACTGGCTCTGGG + Intronic
1035583198 8:753087-753109 TTCTCAACACCTCTGGTTGCAGG - Intergenic
1036700294 8:11008806-11008828 CACTGAATGCCATTGGTTGCAGG + Intronic
1037014424 8:13884849-13884871 TGCTGAACACCATAAATTTCAGG + Intergenic
1040828070 8:51645404-51645426 TGCTCAACACCATCCGTTGATGG - Intronic
1045585566 8:103531466-103531488 TGCTGAACACCTGGAGTTGCTGG + Intronic
1047867314 8:129040703-129040725 TGCTGAAGACCATTGTATTCTGG - Intergenic
1055638918 9:78304262-78304284 GGGTGGCCACCATTGGTTGCAGG + Intronic
1056189656 9:84172547-84172569 TGCTAAAAAACATTGGTTTCAGG + Intergenic
1059830922 9:118095012-118095034 TGCAGAACACTATTAGTTGGAGG - Intergenic
1188132843 X:26458984-26459006 TGCTGATCTCAATTGGATGCTGG + Intergenic
1189237061 X:39495234-39495256 TGCTGAGCACCAATGATTGTTGG - Intergenic
1195343702 X:103928075-103928097 TGCTGAAGACAACTGGGTGCAGG - Intronic