ID: 922244615

View in Genome Browser
Species Human (GRCh38)
Location 1:223783392-223783414
Sequence CTGCTGTTGGTGAGGAAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 6, 3: 20, 4: 277}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922244615 Original CRISPR CTGCTGTTGGTGAGGAAGTA AGG (reversed) Intronic
900222419 1:1516293-1516315 CTGGTGTTGGTGAGGGCGTCTGG + Intronic
901069178 1:6508792-6508814 CTGCTATTGGGGATGAAGTGTGG - Intronic
901174064 1:7285747-7285769 CTGCTTTTGGGGTGAAAGTAGGG + Intronic
904489460 1:30849532-30849554 CTGCTGTTCGAGAGGCAGGAAGG - Intergenic
904961174 1:34334214-34334236 CTGCTATTGGAGAAGAAATATGG - Intergenic
905266726 1:36759498-36759520 ATGCTGTGGGTGAGGAATTCAGG + Intergenic
906100429 1:43256948-43256970 CAGCTGGTGAGGAGGAAGTATGG + Intronic
906155912 1:43613793-43613815 CTGTGGTGGGTGAGGAAGCAGGG + Intronic
911557555 1:99363436-99363458 CAAATGTTGGTGAGGAAGTGGGG - Intergenic
912826791 1:112911895-112911917 TTACTGTTGGTGAGGGAATAAGG - Exonic
913139597 1:115927570-115927592 CTGCTATTGATGAAAAAGTAAGG - Intergenic
913156170 1:116101133-116101155 TTGCTGCTGGTAAGGATGTAGGG - Intergenic
913223600 1:116679431-116679453 CTGCGGTGGGTGAGGATGAAAGG - Intergenic
914747024 1:150508558-150508580 CTCCTGCTGATGAGGATGTAGGG + Intronic
915008290 1:152661178-152661200 ATGTTGTAAGTGAGGAAGTAGGG - Intergenic
915073180 1:153288902-153288924 CGGCTGTTGGTGTGGAAGCGGGG - Intergenic
917199453 1:172499678-172499700 CTGCAGGAGGTGAGGAAGTGAGG + Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
918013649 1:180611213-180611235 CTGCTGTTGCTGGGGAAGAAAGG - Intergenic
921710668 1:218370080-218370102 CTGCACTTAGTGAGGAAGTCAGG + Intronic
922244615 1:223783392-223783414 CTGCTGTTGGTGAGGAAGTAAGG - Intronic
922574486 1:226652869-226652891 CATCTGTGTGTGAGGAAGTAAGG - Intronic
922883703 1:229002126-229002148 CTGCTTTTGGTGAGGACCTCAGG + Intergenic
923042205 1:230327430-230327452 CTGCTGTTTCTGAGGAAAGAAGG - Intronic
924047097 1:240042861-240042883 CTGCTTTTGGTGAAGAACTCAGG + Intronic
924329089 1:242924451-242924473 CTGCTGCTGGTGAGGGAGGAAGG + Intergenic
1063246837 10:4229244-4229266 CTGTGGTTGTTGAGGAACTATGG - Intergenic
1063659424 10:8023708-8023730 ATGCAGTTGGTGAGGAAGTATGG - Intergenic
1063918596 10:10909361-10909383 CCGCTGTCTGTGATGAAGTAGGG - Intergenic
1066217581 10:33302622-33302644 CTGCTGTTAATGAGGAGGTAGGG + Intronic
1066750571 10:38652168-38652190 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic
1066966479 10:42270944-42270966 CTGCTTTTGGTGAAGAAAAAAGG - Intergenic
1067401226 10:45975637-45975659 CTGGTGTTTGTGAGGAAAAAAGG - Intronic
1067869578 10:49945215-49945237 CTGGTGTTTGTGAGGAAAAAAGG - Intronic
1069802582 10:71091239-71091261 CTACTGAGGGTGAGGAAGGAGGG + Intergenic
1070142651 10:73749845-73749867 CTGCTCTTCTTGAGAAAGTAAGG - Intronic
1070218884 10:74419189-74419211 CTGTTGTTGGGGAGGAAGAATGG - Intronic
1070254281 10:74800679-74800701 CAGATGTTGGTGAGGATGCAGGG + Intergenic
1070795638 10:79214833-79214855 CTGCTGTTCATGAGGAAGGCGGG + Intronic
1070847964 10:79539287-79539309 CTGTGGTTGGGGAGGAAGGAGGG + Intergenic
1071874517 10:89830136-89830158 CTGCTGTTGGTCAGCAAGGCAGG - Intergenic
1072422826 10:95303835-95303857 CTGCTGAGGGATAGGAAGTAAGG + Intergenic
1074710906 10:116176744-116176766 TTGCTGGTTGTGAGGAAGGAAGG - Intronic
1076456953 10:130606780-130606802 CTGTTGTTGGTGAAGCTGTAGGG - Intergenic
1077093265 11:788966-788988 AGGCTCTTGGTGGGGAAGTAAGG + Intronic
1077112626 11:868689-868711 CAGCCGGTGGTGAGGAAGCATGG - Exonic
1077202552 11:1318554-1318576 CTGCTGTTGATGAGAACGTGAGG + Intergenic
1078770884 11:14350482-14350504 CTGCTTCTGGTGAGGGTGTAAGG - Intronic
1078908370 11:15708305-15708327 CTGCTGCTGCAGAGGAAGTAAGG - Intergenic
1079041350 11:17063233-17063255 CTGCTGGTGGGGAGGAAATGAGG - Intergenic
1081044941 11:38261683-38261705 CTGCTTATGGTGAGGAATTCAGG - Intergenic
1081458407 11:43247884-43247906 GTGCTGCTGGTGGGGAAGTACGG + Intergenic
1082167497 11:48965410-48965432 CTCCTGTTGTTCAGGAAGGAGGG - Intergenic
1083745180 11:64731787-64731809 CCACTGTTGGCGAGGAAGTTGGG + Intronic
1086289320 11:85289271-85289293 GTGCTGGTGGTGAGGAAAGAGGG - Intronic
1087128414 11:94648161-94648183 GTGGTGTTGGTGAGGGAGGAGGG + Intergenic
1087508576 11:99060170-99060192 AAGCTGTTGGTTAGGAAATATGG + Intronic
1088791859 11:113233267-113233289 GAGCAGTTGGTGAAGAAGTATGG + Exonic
1089256631 11:117197691-117197713 CTGCTGTTCCTGGGGAGGTAAGG - Intergenic
1089283037 11:117387649-117387671 GTTCTGTTGGTAAGGAAGAAAGG + Intronic
1089982843 11:122786776-122786798 CTGCTTTTGGTGAGTGAGAAAGG + Intronic
1090184969 11:124732121-124732143 CTGCTGTTTATGAGGAATTAAGG - Intergenic
1091289272 11:134428266-134428288 CTGCTGTTGGTGGGGTTGCACGG + Intergenic
1091490684 12:929972-929994 CTGCTGTGGGTGAGGAGGTAAGG - Intronic
1091589207 12:1833506-1833528 CTGGTGTTGATGAGGAGGTGTGG - Intronic
1093185066 12:16010500-16010522 CTGCTTTTGTTGAGGAATCAAGG + Intronic
1096645336 12:53030941-53030963 CAGCTCTTGGTGGGGAGGTAAGG - Intronic
1097804214 12:63947276-63947298 CAAATGTTGGTGATGAAGTAAGG - Intronic
1098085303 12:66836085-66836107 TTACTGTTGGTAAGGACGTAAGG + Intergenic
1099543229 12:83941619-83941641 CTGCTTCTGGTGAGGACTTATGG + Intergenic
1101212519 12:102548790-102548812 CTGCTGTGGGTGAGGAAAGGAGG + Intergenic
1101741170 12:107501284-107501306 CTGCTGTGGGAGAAGAGGTAGGG + Intronic
1102244696 12:111347940-111347962 CTCCTGTTGGGGATGAAGTGAGG - Exonic
1103413695 12:120730301-120730323 ATGCTGATGGTGAGAAAGGAGGG + Intronic
1103549430 12:121726089-121726111 TTGCTGTGGGTTAGGAAGAAGGG + Intronic
1104354964 12:128077284-128077306 CTGCTTCTGGTGAAGACGTAAGG + Intergenic
1104905556 12:132211823-132211845 CTGCTGTTGGGGACCAAGTTTGG - Intronic
1105444520 13:20441136-20441158 GTGCTGTAGGGGAGGAGGTAGGG + Intronic
1105725773 13:23160518-23160540 CTGCGGTCGCTGAGGAAGGACGG + Intergenic
1106130708 13:26937119-26937141 CTGCTTCTGGTGAGGAACTCAGG - Intergenic
1106262135 13:28077214-28077236 CTGCTTCTGGTGAGGAACTCAGG + Intronic
1107280326 13:38726097-38726119 CCGGTGTTGGTTAGGAAGGAGGG + Intronic
1108232251 13:48358461-48358483 CTGCTTTTAGTCAGGAGGTAAGG + Intronic
1109157165 13:58925349-58925371 CTGATATTGATAAGGAAGTAAGG + Intergenic
1111181275 13:84669149-84669171 TTGCTGCTTGTGAAGAAGTAGGG + Intergenic
1112345226 13:98583652-98583674 CTCCTGTTGGTGAAGATGTGGGG + Intergenic
1114673493 14:24427215-24427237 CTGTGGCTGGTGAGGAAGGAAGG - Exonic
1115482243 14:33872390-33872412 CTGCAGTTGATAAGGAAGTTTGG - Intergenic
1117240844 14:53830721-53830743 CTGGTGTTCCTGAGGAAGAAGGG + Intergenic
1118450794 14:65900230-65900252 CTGCTGCTGGTGAGGGCCTAAGG - Intergenic
1119220291 14:72900972-72900994 CTGGTGTTAGTGAGGGAGAAGGG - Intergenic
1120033446 14:79668686-79668708 TTGCTGTTGGTGTGTAAGGAAGG + Intronic
1121209836 14:92199963-92199985 CTGCTGGGGGAGAGGAAGAAGGG - Intergenic
1122442211 14:101739891-101739913 CTTCAGTAGGTGAGGAAGTTGGG + Intergenic
1123022373 14:105406745-105406767 GTGGAGTTGGTGAGGATGTAAGG + Intronic
1123155566 14:106221682-106221704 CAGATGTTGGTGAGGATGGAAGG - Intergenic
1125401320 15:39306653-39306675 CAACTATTGGTGAGGATGTAGGG - Intergenic
1126678545 15:51182773-51182795 CTTTTGTTGGTGAGGAAGAAAGG + Intergenic
1128035599 15:64522609-64522631 CTGATGGTGGTGAGTATGTAGGG + Intronic
1129022927 15:72539771-72539793 CTGTTGTTACTGAGGAAGTCTGG - Intronic
1132406528 15:101544628-101544650 CTGTTTTTGGTGGGGAAGGAGGG - Intergenic
1133747873 16:8701237-8701259 CTGCTGTTGTTAAAGAATTAAGG - Intronic
1133960056 16:10485622-10485644 AGGCTGTTGGGGAGGAAGGATGG - Intergenic
1134329243 16:13235368-13235390 TTGCTGTTGGTGATGAAGTATGG - Exonic
1134629799 16:15748448-15748470 CTGCTGATGGACAGGAAGTGAGG - Intronic
1135097546 16:19577211-19577233 CTGCTGTTGGTGAGGGCCTCAGG + Intronic
1136593377 16:31231454-31231476 CTGGTGGTGGTGAGAAAGTTGGG + Intergenic
1137439706 16:48487608-48487630 CTACTTGTGGTGAGGAAGCAAGG - Intergenic
1139220359 16:65175583-65175605 GAGCTGTTAGTGAGGAAGAATGG - Intergenic
1139389755 16:66599868-66599890 CAGCTGCTGGTGAGGATGTGGGG - Intergenic
1140938452 16:79697952-79697974 CAACTGTTGGTGAGAAAGGAAGG - Intergenic
1142269003 16:89079439-89079461 CTGTTTTTGGTGAGGCAGTGTGG + Intergenic
1142811174 17:2396301-2396323 CTGCTGGTGGTGGGGATGTTGGG - Intronic
1142934937 17:3321183-3321205 CTGTTGTTGGTGTGTAAGAATGG + Intergenic
1143582765 17:7836129-7836151 CTGCTGTTGGTGGCGGAGGAGGG + Intergenic
1143688036 17:8534987-8535009 GTGCGGGTGGTGAGGAAGGACGG + Intronic
1144252548 17:13433099-13433121 CTGCTGTTGGTAAGGTACAATGG - Intergenic
1149084588 17:52699913-52699935 CTCCTGTTGGTGAGGAATGAGGG - Intergenic
1150327987 17:64272146-64272168 TTTCTGTGGGTGAGGAATTATGG - Intergenic
1152281655 17:79388495-79388517 CTGCCTTTGGTGACTAAGTAAGG - Intronic
1152335916 17:79700234-79700256 CTGCGGTGGGGGAGGAAGTCCGG - Intergenic
1152907791 17:82978468-82978490 CTGCTGTGAGTGAGGAATTCCGG + Intronic
1153429343 18:4999080-4999102 CTGCTGCTGGGGATGAAGGAGGG - Intergenic
1153691673 18:7600683-7600705 CTGCAGCTAGTGAGGAAGCAGGG - Intronic
1153996819 18:10449989-10450011 TTGCTATTGGTGAGAATGTATGG + Intergenic
1154291508 18:13111975-13111997 CAGGTGTTGGTGAGGATGTGGGG + Intronic
1154306009 18:13231357-13231379 CTGCTCTTGGTGAGCATGTCGGG + Intronic
1155001801 18:21694968-21694990 GTTCTGTTGCTGAGGAAGAAGGG - Intronic
1157774379 18:50380547-50380569 CTGCTTTGGGTGAGGAGATATGG + Intronic
1158619640 18:59021555-59021577 CAGCTGTGGGTGAGGAAAGATGG - Intergenic
1158777159 18:60596983-60597005 CAGATGCTGGTGAGGATGTATGG + Intergenic
1158906560 18:62018824-62018846 CTTCTGTAGATGAGGAAGTGAGG - Intergenic
1159588169 18:70302050-70302072 CTGCAGCTGGTGAGGAAGGTGGG + Intronic
1160058968 18:75512210-75512232 CTGGTGTTCCTGAGGAAGAAGGG + Intergenic
1161015167 19:1979732-1979754 CGGCTGTGGGTGAGGGAGCAGGG - Exonic
1164547000 19:29174168-29174190 CTTTTGTTTGTGAGAAAGTAAGG + Intergenic
1166563680 19:43750221-43750243 CTGCAATTGATGAGGAAGGAGGG - Intronic
1167300104 19:48673116-48673138 CTGCGGTTGGTGAGGGATTGGGG - Intergenic
926237750 2:11059522-11059544 GCTCTGTTGGTGAGGAGGTAGGG + Intergenic
926300698 2:11599989-11600011 CTGATGTAGATGAGGAAGGAGGG + Intronic
927710471 2:25322657-25322679 CTGGGGTTGGTGAGGAAGTGGGG - Intronic
929282955 2:40102617-40102639 CAGCTGTCTGTGAGGAAGAAAGG + Intronic
929678656 2:43965902-43965924 CTACTGTTGGTGGGAGAGTATGG + Intronic
930335955 2:50046127-50046149 TTGAAGTTGGTGAGGAAGTAGGG + Intronic
931150196 2:59564703-59564725 CTGCTCATGGAGAGGAAGCAAGG - Intergenic
931698376 2:64889167-64889189 CTGCAGTTATTGAGGCAGTATGG - Intergenic
932421688 2:71605003-71605025 CAGCTCTTGGTCAGGAAGTGAGG + Intronic
932645774 2:73499945-73499967 CTGCTTCTGGTGAGGAACTCAGG - Intronic
933530956 2:83511176-83511198 CTGCTGCTGATGATGAAGGAGGG + Intergenic
933830240 2:86201167-86201189 CAGGTGTTGGTGAGGATGTGGGG - Intronic
934313571 2:91894325-91894347 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic
934555899 2:95286862-95286884 CTGCTGTTGGTGGGGACGTATGG + Intronic
934737484 2:96697207-96697229 CTGCTTTTGGTGACGATGTCTGG - Intergenic
937707070 2:124933328-124933350 CTGCTGTTGATGTGGAATCAGGG - Intergenic
939901854 2:147860169-147860191 CAGCTGGTGGTGAGGAATGAAGG - Intronic
940192193 2:151053776-151053798 CTGCTGTGGCTCATGAAGTAAGG - Intergenic
941365342 2:164604092-164604114 CAGCTGTTGATGAGAAAGTGTGG + Intronic
942593040 2:177566541-177566563 ATGGTGTTGGGGAGAAAGTAAGG - Intergenic
946411435 2:219517159-219517181 CTGGAGGGGGTGAGGAAGTAAGG + Intronic
946530996 2:220570294-220570316 TGGCTGTTGGGGAGGAAATAAGG - Intergenic
947363463 2:229369917-229369939 CTGGTGTGGGTGGGGAAGTGTGG - Intronic
947499862 2:230664147-230664169 ATGCTGTTAGTAAGGAAGAAGGG + Intergenic
949040356 2:241845235-241845257 CGGCTGTTGGCGAGGCAGCAGGG - Intergenic
1168796834 20:615962-615984 TTTCTGTTAGTGAGGAAGAAGGG + Intergenic
1168890948 20:1295111-1295133 CTGCTGTTAATGTGGAAGGAGGG + Intronic
1169494432 20:6101133-6101155 TTGATGTTGGTGAGGATGTGGGG + Intronic
1170990218 20:21294503-21294525 CTGCTGTAGTTAAGGAACTATGG - Intergenic
1173705289 20:45105769-45105791 CTGCTATTGGTAAGGAAGAAGGG + Intergenic
1177359105 21:20045952-20045974 CTCCTGTTGGAGAAGTAGTATGG - Intergenic
1178821821 21:35982420-35982442 CTGCTCTTGGTGGGGCAGTCAGG - Intronic
1179436942 21:41368817-41368839 CTGCCCTTGGTGACGAAGTCAGG - Intronic
1179663173 21:42891488-42891510 CTGGTGGTGGTGTGGAAGTGGGG + Intronic
1180540311 22:16440229-16440251 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic
1180700627 22:17779701-17779723 CTGCTGTTGGTGTCGCAGCAGGG - Intergenic
1181993212 22:26854089-26854111 CCTCTGGTGGTGAGGAAGAAAGG - Intergenic
1182448231 22:30402298-30402320 CTGCTGTTGGGGGAGAAGCATGG + Intronic
1185286433 22:50001930-50001952 ATGCTGTTGGTGAGACAGTGCGG + Intronic
949735334 3:7165164-7165186 TTGCGGATGGTGAGGAAGTTAGG - Intronic
950305600 3:11913505-11913527 CTGCTGGTGGTGTGGATGGAGGG - Intergenic
951143250 3:19194360-19194382 TTTTTATTGGTGAGGAAGTAAGG + Intronic
952047021 3:29334751-29334773 CTGCTGTTGCTGAGACAATATGG + Intronic
952389413 3:32866822-32866844 CTGCTGTTGGAGAGGAGTAATGG + Intronic
952705159 3:36369972-36369994 CTGCTCTTGCAGAGGAAGTGGGG + Intergenic
953085641 3:39664082-39664104 CTCCTGTTTCTGAGAAAGTAGGG + Intergenic
953752054 3:45616487-45616509 ATTCTGTGGGTGAGGAAGAAGGG - Intronic
954327405 3:49870993-49871015 CTGCTGTGGGAGAGGGAGTTGGG + Intergenic
955226383 3:57063708-57063730 CTGCTGGTAGTCAGGAAGGATGG + Intronic
955442556 3:58973273-58973295 GTGGTGTTGGTAAGGAATTAAGG - Intronic
956135227 3:66091831-66091853 CTGCTGTGGGCGAGGCAATAGGG + Intergenic
958510233 3:95038026-95038048 CTGTTGTTGGTGGGGGACTAGGG - Intergenic
958833567 3:99117837-99117859 CTTCTGTTTGTGAGGAAGGTGGG + Intergenic
959259443 3:104056505-104056527 CTAATGCTGGTGAGGAAGTTGGG + Intergenic
959448164 3:106466567-106466589 CAACTGTTTGTGAGAAAGTAAGG - Intergenic
960452935 3:117832435-117832457 CAGCTGGTGGAGAGGAAGGATGG - Intergenic
961530741 3:127538585-127538607 GAGCTGCTGGGGAGGAAGTATGG + Intergenic
961557396 3:127705946-127705968 CTAGTGTTGGCGAGGATGTAGGG + Intronic
964117273 3:153149320-153149342 GTGCTGTTCGTGAGGAATTAAGG - Intergenic
964407297 3:156362413-156362435 CTGCTGTTGTTGAGGCAGTGTGG + Intronic
965154167 3:165025377-165025399 CTGGTGTTCCTGAGGAAGAAGGG + Intronic
968695626 4:2024760-2024782 CTGTGGTTGGTTAGGAAGTCTGG + Intronic
971193075 4:24446210-24446232 CAGCTGTTGGTGAAGATGTGGGG - Intergenic
971419784 4:26464865-26464887 CTGCTGTTGGAGAAGAAGGGAGG - Intergenic
971701135 4:29977894-29977916 CTGCTGCTGGTGAGGACCTCAGG - Intergenic
973582808 4:52360874-52360896 GTGGTGGTGGTGGGGAAGTATGG + Intergenic
973792994 4:54395334-54395356 CTGCTACTGGTCAGGAAGGAGGG - Intergenic
973841350 4:54864343-54864365 CTGCTGTTGTTTAGGAATTCAGG - Intergenic
974337479 4:60569380-60569402 ATTCTGTTGGGGAGAAAGTAAGG - Intergenic
974670513 4:65024274-65024296 CTGCTTCTGGTGAGGAACTTAGG + Intergenic
976184548 4:82430779-82430801 CTGCTGTTGGGGAGGGCGGAGGG - Exonic
977124458 4:93147632-93147654 CTGCTGTTGGTGGTGAAGCCTGG - Intronic
977945773 4:102912376-102912398 CTGCTTTTGGTGAAGAAAAAAGG + Intronic
980176322 4:129349686-129349708 CAAATGTTGGTGAGGATGTAAGG - Intergenic
981077772 4:140607946-140607968 CTGCAGTTAGTGAGGAGGGAGGG + Intergenic
982916499 4:161216697-161216719 CAAGTGTTGGTGAGGAGGTAGGG + Intergenic
982917917 4:161236533-161236555 TGCCTGTTGGTGAGAAAGTATGG + Intergenic
985034037 4:185820535-185820557 CTGCAGTTGGGGAAGGAGTAGGG + Intronic
987261845 5:16212067-16212089 ATTCTGTTGGTGAGGAATTCAGG - Intergenic
989197910 5:38733871-38733893 CTCTTGTTGGTGAGGTAGTTGGG + Intergenic
989489287 5:42032002-42032024 CAGCTGTTTGGGAGAAAGTAAGG - Intergenic
990760032 5:59118752-59118774 CTGCCATTGGTGTGGAAGCAGGG - Intronic
991207834 5:64069777-64069799 GTTCTGTTGGTAAGGAAGAAAGG + Intergenic
995967121 5:117921113-117921135 CAGATGTTGGTGAGGATGTGGGG + Intergenic
996809777 5:127503795-127503817 CTGTAGTTGGAGAAGAAGTAGGG + Intergenic
997246208 5:132351597-132351619 CTGCTGTTGGTAAGGGAGTAGGG - Intergenic
997529674 5:134574091-134574113 CTGCTGGTGCTGAGGCAGGAAGG + Intronic
997582548 5:135026934-135026956 CTGCAGTGGGGGAGGAAGGAGGG - Intergenic
999387254 5:151163009-151163031 CTGCTGTAGCTCAGGAATTAAGG - Intergenic
1001136646 5:169108059-169108081 CTACTTTTGATGAGGAACTATGG - Intronic
1001187222 5:169586070-169586092 CAGCAGTTGGAGAGGAAGTAGGG - Intronic
1001658672 5:173373962-173373984 CTGATGTTGGTGTGGAAGCTTGG - Intergenic
1002092656 5:176814117-176814139 CTGCTGCAGGTGAGGGAGAAAGG - Intronic
1002536141 5:179876741-179876763 CAGCTGCTGGGGAGGAAGTATGG + Intronic
1004534716 6:16489518-16489540 CTGCTGGTGATGAGGAAATGGGG - Intronic
1005532709 6:26723419-26723441 GTTCTGTTGGTGAGGAAAGAGGG + Intergenic
1005538086 6:26778245-26778267 GTTCTGTTGGTGAGGAAAGAGGG - Intergenic
1007092523 6:39193142-39193164 TTGCTGGTGCTGAGAAAGTATGG + Intronic
1008417542 6:51260321-51260343 CTGCTGTAGGTGACTAATTATGG - Intergenic
1008600819 6:53092155-53092177 ATGATGGTGGTGAGGAAATAGGG - Intronic
1009006728 6:57797852-57797874 GTTCTGTTGGTGAGGAAAGAGGG - Intergenic
1009008940 6:57820615-57820637 GTTCTGTTGGTGAGGAAAGAGGG - Intergenic
1009690486 6:67025904-67025926 TTGGAGTTGGTGAGGATGTATGG - Intergenic
1009696390 6:67109408-67109430 CTGCTTCTGGTGAGGACCTAAGG - Intergenic
1011345693 6:86367777-86367799 CTGCTTTTGGTGAGGGACTCAGG - Intergenic
1013045299 6:106479570-106479592 CGAGTGTTGGTGAGGATGTAGGG - Intergenic
1014316717 6:119875836-119875858 CTGCTATTTGTCATGAAGTAGGG - Intergenic
1014980550 6:127941321-127941343 GTTCTGTTGGTGTGGCAGTAAGG - Intergenic
1016753370 6:147656712-147656734 ATTCTGTTGGAGAGGATGTAAGG + Intronic
1017261180 6:152389648-152389670 CAGATGTTGATGAGGAAGCAGGG - Intronic
1017740952 6:157406183-157406205 CTGCAGTTGGGGAGGGAGTGGGG + Intronic
1017846378 6:158262061-158262083 ATTCTGTTGGTGAGGAAGAAAGG + Intronic
1018044282 6:159952227-159952249 CTGCTGTTGGGGAGGATGCCTGG - Intergenic
1019595638 7:1857127-1857149 CTGCTGTTGGTGAGGAGTCCTGG - Intronic
1021365022 7:19767568-19767590 CTGATTTTGATGAGGGAGTAGGG + Intronic
1022316855 7:29253509-29253531 ATTCTGTTTGTGAGGAAGCAGGG + Intronic
1022585367 7:31603723-31603745 GGGCTGTGGGAGAGGAAGTAAGG - Intronic
1022780081 7:33572582-33572604 CAGATGTTGGTGAGGATGTGGGG - Intronic
1023789589 7:43742805-43742827 ATCCTGTTGGTGAGGCTGTAGGG + Intergenic
1023927527 7:44680786-44680808 GTTCTGTTGGTCAGGAAGCAAGG + Intronic
1025072804 7:55915699-55915721 CTGTGGTTGGTGTGGAAGGAGGG + Intronic
1026223367 7:68419585-68419607 CTTCTGTTGGCAAGGAAGAAAGG - Intergenic
1028074504 7:86494905-86494927 CTGCAGGTGATGAGGAAGAATGG - Intergenic
1028116233 7:87001139-87001161 CAGCTGATTGTGAGGAAGAAAGG + Intronic
1028516857 7:91687450-91687472 CAACTGTTGGTGAGGAAGTTGGG - Intergenic
1030768697 7:113444584-113444606 CAAATGTTGGTGAGGATGTAGGG + Intergenic
1031297147 7:120015057-120015079 CTGTTCTTTCTGAGGAAGTAGGG - Intergenic
1031457547 7:122001671-122001693 CTGATGTAGGTGAGCAAGCAAGG - Intronic
1031657718 7:124379389-124379411 CTGCTGGGGGTGGGGAGGTATGG - Intergenic
1034817863 7:154189106-154189128 CTGCAGGTTGTTAGGAAGTAGGG + Intronic
1035773581 8:2170090-2170112 CTCCTGGTGGTGAGGAGGTCAGG + Intergenic
1035914833 8:3607822-3607844 CTGGTGTTGGTGTGGCAGAAAGG + Intronic
1037876213 8:22549933-22549955 TTGCTGCTGGTGAGGGGGTATGG + Intronic
1038059117 8:23892650-23892672 CTGCTGTGGATGTGGAAGAAAGG + Intergenic
1038678981 8:29649289-29649311 TTGCTGGTGGTGAGGAAGATGGG - Intergenic
1039797573 8:40928204-40928226 CTTCTGTAGGGGAGGAGGTAGGG + Intergenic
1041532655 8:58888876-58888898 CAGCTGTTAGGGAGGAGGTATGG - Intronic
1041974795 8:63785209-63785231 CTGCATTTGGTGAGGCAGGAGGG + Intergenic
1043156541 8:76788185-76788207 TTCCTGTTGGGCAGGAAGTAAGG - Intronic
1048325874 8:133438363-133438385 CTGCTTTTGGGGAGAATGTAGGG - Intergenic
1049229373 8:141474118-141474140 CTGCTGTCGGTGAGGCTGCAGGG - Intergenic
1053146301 9:35714436-35714458 CTGATGATGGTCAGGATGTAGGG + Intronic
1053164386 9:35834370-35834392 ATGCTATTGGTGAGGAAGACTGG + Intronic
1053231609 9:36415156-36415178 TTGGTGTTGTTGAGGAAGAAGGG - Intronic
1055270040 9:74547579-74547601 CTGAAGTTGGTAAGGGAGTAAGG + Intronic
1055638133 9:78297447-78297469 ATGCAGTTGGTGAGGAAGCTCGG + Intronic
1057707434 9:97406285-97406307 CTGCTAGTGGTGAGGAATTGGGG - Intergenic
1057765484 9:97913848-97913870 CTGCTGTTTGCCAGGTAGTACGG + Intronic
1058506348 9:105669896-105669918 CTGGAGTTGGGGAGGAAGGAGGG + Intergenic
1060101863 9:120847639-120847661 CTGCTGTTAGGAAGGAAGTCTGG + Intergenic
1060469477 9:123935911-123935933 CAAGTGTTGGTGAGGAAGTGGGG - Intergenic
1061376408 9:130227398-130227420 CTGCTGTTGGTGTATATGTAAGG + Intronic
1061504409 9:131023419-131023441 CAAATGTTGGTGAGGAAGTTGGG - Intronic
1061990801 9:134157596-134157618 CTGCTGTTGGTGGGGGCGTGTGG + Intronic
1062180972 9:135191073-135191095 GTCCTGTTGGTCAGGAATTAGGG + Intergenic
1186722258 X:12317848-12317870 ATGCTGTTGGTGGGAATGTACGG + Intronic
1186899536 X:14038671-14038693 ATGCTGGTGGTGGGGAAGGAGGG + Intergenic
1188237193 X:27744863-27744885 CTGCTTTTAGTGAGGAACTCAGG - Intronic
1188364636 X:29300058-29300080 CTGCTTTTGTTGAGGAACTCAGG - Intronic
1188369838 X:29355660-29355682 TTGATTTAGGTGAGGAAGTATGG + Intronic
1189559969 X:42182450-42182472 TGGCTGTGGGTGAAGAAGTAGGG - Intergenic
1191662392 X:63665147-63665169 CTACTGTGAGTGAGGAAGTAGGG + Intronic
1195432311 X:104803082-104803104 CTGCTGTTGGGGAGGAAGAAAGG + Intronic
1197298158 X:124745196-124745218 GTGCTGGTGGAGAGGAACTATGG - Intronic
1201181486 Y:11351816-11351838 CTGCTTTTGGTGAAGAAAAAAGG + Intergenic
1201226467 Y:11823562-11823584 CTGCTGCTGGTGAGGGAGGAAGG + Intergenic