ID: 922248086

View in Genome Browser
Species Human (GRCh38)
Location 1:223819847-223819869
Sequence CAAGGCACTCCCCTTGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922248082_922248086 15 Left 922248082 1:223819809-223819831 CCTCATTCTGCAAATATTTCTAC 0: 1
1: 0
2: 1
3: 37
4: 341
Right 922248086 1:223819847-223819869 CAAGGCACTCCCCTTGAGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922248086 Original CRISPR CAAGGCACTCCCCTTGAGCT GGG Intronic
900993843 1:6109867-6109889 CGAGGCACTCCACTTCAGCCAGG + Exonic
901582295 1:10254831-10254853 CGTGCCACTCCCCTTCAGCTAGG + Intronic
902359264 1:15933320-15933342 CAGGACTCTCACCTTGAGCTTGG - Exonic
902797061 1:18806866-18806888 CATGTCACTGCACTTGAGCTTGG - Intergenic
902986778 1:20159488-20159510 CCAGGCACTCCTCGAGAGCTAGG + Intergenic
904633316 1:31860018-31860040 AAATTCACTCCCCTGGAGCTGGG - Intergenic
905899929 1:41574660-41574682 CAGGACAGTCCCCATGAGCTGGG - Intronic
906367674 1:45224280-45224302 CAAGCCACTGCACTTCAGCTTGG - Intronic
914723101 1:150305636-150305658 CAAGGCACTGCACTCCAGCTGGG - Intronic
916494792 1:165336679-165336701 CAAGATATTCCCCCTGAGCTGGG - Intronic
917854098 1:179087745-179087767 CTAGGCCCTCCCCAAGAGCTTGG + Intronic
918641085 1:186842084-186842106 CACGCCACTGCCCTTCAGCTTGG - Intronic
920293727 1:204942869-204942891 CAAGGGACTTCCCTTGTGCCAGG - Intronic
920386382 1:205572636-205572658 CCAGCTTCTCCCCTTGAGCTGGG + Intronic
921274315 1:213503439-213503461 CAAGGCATTCCCCTTCAGCAGGG + Intergenic
921746824 1:218749817-218749839 CCAGGCACTCCTCAAGAGCTAGG - Intergenic
922248086 1:223819847-223819869 CAAGGCACTCCCCTTGAGCTGGG + Intronic
1062909801 10:1205221-1205243 CCAAGCCCTCCCTTTGAGCTCGG - Intronic
1063797272 10:9526429-9526451 CACTGCACTCTCTTTGAGCTAGG + Intergenic
1064678753 10:17787667-17787689 CCAGGCACTCCACTGGTGCTGGG + Intronic
1066390550 10:34974516-34974538 CCAGGCACTCCCCGAGAGTTAGG + Intergenic
1066631343 10:37461716-37461738 CCATGCATTCCCATTGAGCTTGG + Intergenic
1071555334 10:86597283-86597305 CAAGGCCCTCGCCTTGAGGCTGG + Intergenic
1075594348 10:123717291-123717313 CAAGGCATTCCTCTTGATGTTGG - Intronic
1076718316 10:132379411-132379433 CCACGCACTCCCCGAGAGCTCGG - Exonic
1078526284 11:12103975-12103997 CAAGGCCCCCTCCTAGAGCTGGG - Intronic
1082718194 11:56640885-56640907 CAAGGCAATTCCCTTCAGCAGGG - Intergenic
1085821184 11:79795359-79795381 TGAGGCTCTCCCCATGAGCTGGG - Intergenic
1087884354 11:103460181-103460203 CAAGGTACTTCTCATGAGCTAGG - Intronic
1088085517 11:105974305-105974327 CAAGGCACTCGTCTTGTCCTAGG - Exonic
1088667448 11:112107760-112107782 CAAGGGACTCTCCTATAGCTAGG - Intronic
1089718940 11:120394261-120394283 CAAACCACTGCCCTTGAGCCTGG - Intronic
1090974043 11:131667004-131667026 CAAAGCACTCCCCTTCTGCTAGG - Intronic
1091896568 12:4109910-4109932 CAATGCACACACCTTGAGTTTGG + Intergenic
1093050395 12:14497917-14497939 CAAGGCACTTCCCTTGCCCATGG + Exonic
1094099021 12:26741245-26741267 GAAGGCACTGCCATTGAGCTGGG - Intronic
1096099058 12:48957715-48957737 CCAGGCACAACCCTGGAGCTTGG - Intergenic
1097118363 12:56715966-56715988 AAAGGCACTCCCCCAGAGATTGG + Exonic
1098748773 12:74270098-74270120 CCAGGCACTCCCCGAGAGTTAGG + Intergenic
1099879681 12:88453212-88453234 CAAGACACAGCCATTGAGCTAGG + Intergenic
1102529637 12:113536785-113536807 CCAGGCATCCCCCTGGAGCTTGG - Intergenic
1103303288 12:119944428-119944450 CATGCCACTACCCTTCAGCTTGG + Intergenic
1104293059 12:127486617-127486639 CCAGGCACTCCGCAAGAGCTAGG + Intergenic
1106034788 13:26033764-26033786 CAAGCCCCTCCCCTTGAACCTGG - Intergenic
1107036217 13:35905262-35905284 CAAGGCCCACCTCTGGAGCTGGG - Intronic
1107273348 13:38646861-38646883 CTAGTCACTGCCCTTGAGCCTGG + Intergenic
1107490372 13:40875588-40875610 CCAGGCACTCCACAAGAGCTAGG - Intergenic
1108552438 13:51559897-51559919 CAAGGCCCATCCCTGGAGCTGGG - Intergenic
1109803133 13:67402962-67402984 CCAGGCACTCCCCGAGAGTTAGG + Intergenic
1110458088 13:75712334-75712356 CCCTGCCCTCCCCTTGAGCTGGG + Intronic
1113664493 13:112131823-112131845 CCTGGCACTCCCCGGGAGCTGGG + Intergenic
1113732449 13:112651161-112651183 GAAGGCACTACCCTTGAGGGAGG + Intronic
1114539245 14:23442755-23442777 CAAGGCTCTGCCCTTGGGCAAGG - Intergenic
1115722179 14:36175163-36175185 CATGGCAGTCCTGTTGAGCTGGG - Intergenic
1116557639 14:46333063-46333085 TAAGGCACTCCACTTGATTTTGG - Intergenic
1119265338 14:73260803-73260825 GAAGCCACTGCCCTTGACCTGGG - Exonic
1121096414 14:91220791-91220813 CAAGGCACTCCCTTGGCCCTGGG - Intronic
1123573644 15:21642951-21642973 CAAGCCACTGCCCTGGAGCCTGG - Intergenic
1126211057 15:46100623-46100645 CAAGGCTCTCTTCTGGAGCTGGG - Intergenic
1127027089 15:54818889-54818911 CTAAGCACTCTGCTTGAGCTGGG - Intergenic
1127096162 15:55514062-55514084 CCAGGCACTCCCCGAGAGTTAGG - Intergenic
1128508930 15:68301848-68301870 CCAGGCACGCCCCTTGTCCTTGG + Exonic
1128931493 15:71708634-71708656 CAAGGAATTCATCTTGAGCTGGG + Intronic
1136007621 16:27341766-27341788 CAAGCCTCTGCCCTCGAGCTAGG - Intronic
1138876580 16:60958622-60958644 CTAGGCAATCCACTTGAGGTTGG - Intergenic
1139170553 16:64625939-64625961 CAAGAAACCCTCCTTGAGCTTGG + Intergenic
1139842864 16:69895714-69895736 CAAGTCACTGCCCTTCAGCCTGG + Intronic
1140987805 16:80175630-80175652 CATGTCACTCCCCTTGAGACTGG - Intergenic
1141657039 16:85421953-85421975 CACAGCACCCCCCTTGAGGTAGG + Intergenic
1142333023 16:89467842-89467864 CACGCCACTCCACTTGAGCCCGG - Intronic
1143969165 17:10780696-10780718 CATGCCACTGCACTTGAGCTTGG - Intergenic
1144851631 17:18246866-18246888 CAAGTCCCTCCCCTGGTGCTGGG - Intronic
1145864701 17:28233462-28233484 CCAGGCACTCCCCGAGAGTTAGG - Intergenic
1147629931 17:41923594-41923616 CAAGGCACTCTCCTAGGCCTTGG - Intronic
1150229860 17:63544008-63544030 CCAGGGTCTCCCCATGAGCTGGG + Exonic
1151875178 17:76863980-76864002 CCAGCCCCTCCCCTTGAGCAGGG + Intergenic
1156901240 18:42302512-42302534 CAAGGCCGGCCCCTTGATCTTGG - Intergenic
1157310310 18:46547608-46547630 CCAGGCACCTCCCTTGTGCTGGG - Intronic
1158752513 18:60279849-60279871 CATGCCACTGCACTTGAGCTTGG - Intergenic
1161864239 19:6822062-6822084 CATGGCCCTGCCCTGGAGCTTGG + Intronic
1162498272 19:11035559-11035581 CAAGTCCCCCCCCATGAGCTGGG + Intronic
1163363339 19:16861889-16861911 CATGCCACTGCCCTTGAGCCTGG + Intronic
1163966230 19:20749781-20749803 CCAGGCACTCCCCGAGAGTTAGG - Intronic
1166408230 19:42539088-42539110 CAAGGCCCTTCCCTTGAGGGTGG + Intronic
1168297042 19:55382384-55382406 CAAGGCACTCCCTGTCAGGTGGG + Intronic
1168331387 19:55571635-55571657 CAAGCCACTGCACTTGAGCCTGG + Intergenic
926578489 2:14608874-14608896 CACGGCACTGCCCTCCAGCTTGG + Intergenic
927888786 2:26735375-26735397 CGAGGCCCTCCCCTGCAGCTGGG - Intergenic
944223921 2:197330482-197330504 CATGCCACTGCACTTGAGCTGGG + Intergenic
946210329 2:218142720-218142742 CTAGGCAGTGCACTTGAGCTAGG + Intergenic
946933867 2:224699398-224699420 CAAGACACTTCCCTAGTGCTGGG - Intergenic
947595057 2:231405881-231405903 CCAGGCACTCCCCGAGAGTTAGG + Intergenic
1172110036 20:32539132-32539154 CATGGCCCTGCCCTTGGGCTGGG - Intronic
1175223763 20:57433112-57433134 CCAGGGCCTCGCCTTGAGCTGGG + Intergenic
1175367730 20:58467288-58467310 CCAGGCAGTCCCCCTGAGCCCGG + Exonic
1175453361 20:59089756-59089778 CAAGCCACTTCCCCGGAGCTTGG - Intergenic
1176688885 21:9880766-9880788 TAAGAAACTCCCCTTGGGCTGGG - Intergenic
1178337728 21:31758732-31758754 CAAGTCACCCCCCTTAATCTTGG + Intergenic
1178447853 21:32661823-32661845 CCAGGCACTCCCCGAGAGTTAGG + Intronic
1179458582 21:41517343-41517365 CAAGCCACTGCACTTGAGCCTGG - Intronic
1180073251 21:45449216-45449238 CCAGGCCCTCCCCTCGGGCTTGG - Intronic
1180870966 22:19147215-19147237 CCAGGCACTTCCCCTGAGCCAGG - Intergenic
1182127970 22:27830027-27830049 CAAGGCCCACCCCTAGAGTTAGG + Intergenic
1184184492 22:42855995-42856017 CAAGGCACTACACTTCAGCCTGG + Intronic
1184594203 22:45504055-45504077 TAGGGCACTCCCCTGGACCTGGG - Intronic
1185183792 22:49380343-49380365 AAAGGCAGTCACCTTGAGCTTGG - Intergenic
949116021 3:324680-324702 CAAGCCACTGCGCTTGAGCCTGG - Intronic
949158263 3:852206-852228 CCAGGCACTCCTCAAGAGCTAGG + Intergenic
951165888 3:19484854-19484876 CCAGGCACTCCCCGAGAGTTAGG - Intronic
953933245 3:47017619-47017641 CAAGGTACTCCCCTTGCTTTTGG - Exonic
957406340 3:79778041-79778063 CCAGGCACTCCCCGAGAGTTAGG + Intergenic
958714955 3:97768981-97769003 CAAGAGACTCTTCTTGAGCTTGG - Intronic
959741366 3:109724028-109724050 CAAGGGCCTTCCCTTGGGCTAGG - Intergenic
960895560 3:122501070-122501092 CATGCCACTGCCCTTCAGCTTGG - Intronic
961661362 3:128470275-128470297 CCAGGCACTCCCCTGGGTCTGGG + Intergenic
962344041 3:134606841-134606863 CACGGCACTCTCCTAGAGCCTGG + Intronic
964522266 3:157582146-157582168 CCAGGCACTCCCCAAGAGTTAGG - Intronic
965506520 3:169521293-169521315 CAAGACACTTACCCTGAGCTTGG - Intronic
966300715 3:178476678-178476700 CAAGCTACTCCCCTTGAAATAGG + Intronic
966798750 3:183742168-183742190 CAAGCCACTGCCCTCCAGCTTGG + Intronic
967213241 3:187187312-187187334 GGAGGCCCTTCCCTTGAGCTGGG - Intergenic
968133620 3:196207421-196207443 CCAGGCACTGTCCGTGAGCTCGG - Exonic
968314105 3:197707918-197707940 CAAGCCACTGCCCTCCAGCTTGG + Intronic
972517645 4:39823244-39823266 CAAGTCCCTCCCCATCAGCTTGG + Exonic
976054108 4:81043041-81043063 CATTGCACTTCCCTTGTGCTTGG + Intronic
977178051 4:93839356-93839378 CAAGCCAATCCCCTTGGTCTGGG - Intergenic
983588009 4:169376181-169376203 TAAGGCACTCCCTAGGAGCTTGG - Intergenic
986513384 5:8533491-8533513 CAGTCCACTCCCCTTGAGCATGG + Intergenic
993461624 5:88189699-88189721 CCAGGCACTCCCCAAGAGTTAGG - Intronic
995179184 5:109214373-109214395 AAGGGAATTCCCCTTGAGCTAGG + Intergenic
996549066 5:124711574-124711596 CCAGGCCCTCCCCTTTAGATGGG + Intronic
998606143 5:143636576-143636598 CAAGGCACTCATTTTGTGCTGGG + Intergenic
999383972 5:151141276-151141298 CAAGGCACTTCATTTGTGCTAGG + Intronic
1000628977 5:163570309-163570331 CAAGGCATTGCTCTTTAGCTGGG + Intergenic
1002604460 5:180374140-180374162 CAAGCCACTGCCCTTGAGCCTGG + Intergenic
1004271465 6:14199876-14199898 CAAGGAACTCCACTGGCGCTGGG + Intergenic
1004984790 6:21069233-21069255 GAAAACTCTCCCCTTGAGCTTGG - Intronic
1011565494 6:88668000-88668022 CCAGGCACTCCTCAGGAGCTAGG + Intronic
1013602209 6:111715442-111715464 CAAGCCCCTCCCCTTGAGTGTGG + Intronic
1014453026 6:121603879-121603901 GAATGCTCTCCCCTTGATCTTGG - Intergenic
1014546761 6:122744437-122744459 CCAGGCACTCCCCAAGAGTTAGG - Intergenic
1017434306 6:154401425-154401447 CCAGGAACTCACCTTGATCTTGG + Exonic
1025732883 7:64122002-64122024 CAAAGCACTGCACTTGAGCCTGG + Intronic
1030756639 7:113294449-113294471 CAAGAGGCTCCCCTTTAGCTAGG - Intergenic
1035326454 7:158069230-158069252 CATGCCACTGCCCCTGAGCTTGG - Intronic
1035441664 7:158906997-158907019 CTAAGCACTCCCCAGGAGCTGGG - Intronic
1038854082 8:31312508-31312530 CACAGTACTCCCCTTGAGCATGG - Intergenic
1041202829 8:55467447-55467469 CAATCCACTCCCCTTGAGTGAGG - Intronic
1042735201 8:71979705-71979727 CATTGCACTCTCCTTGGGCTTGG - Intronic
1046952357 8:120030742-120030764 TAATGCACTCGCCTTGTGCTGGG + Intronic
1048979260 8:139694413-139694435 CCAGGCACACCCCTTAAGCCTGG - Intronic
1049059050 8:140261822-140261844 CAAGCCACTCCTCCTGATCTGGG - Intronic
1050761039 9:9071245-9071267 CAATGCTCTCCCCTTGAGTTTGG + Intronic
1053780441 9:41601134-41601156 TAAGAAACTCCCCTTGGGCTGGG + Intergenic
1054168383 9:61811291-61811313 TAAGAAACTCCCCTTGGGCTGGG + Intergenic
1054669146 9:67769527-67769549 TAAGAAACTCCCCTTGGGCTGGG - Intergenic
1055023214 9:71692063-71692085 CAAGCCACTGCACTTCAGCTTGG + Intronic
1058128203 9:101220837-101220859 CAAGGCTCTACCCTGGAGCAAGG + Intronic
1061271632 9:129547066-129547088 CAAGGGACACCCCATGAGCTGGG + Intergenic
1062084120 9:134640016-134640038 AAAGGAACTCCACTTGTGCTTGG + Intergenic
1062722598 9:138052178-138052200 CCAGGCTCTAACCTTGAGCTTGG - Exonic
1185567955 X:1110041-1110063 CACGGCACTCCACTTTAGCCTGG - Intergenic
1185974231 X:4701309-4701331 CAATGCATTCCTCTTAAGCTAGG - Intergenic
1190314619 X:49142458-49142480 CCAGGCACTCCTCGAGAGCTAGG - Intergenic
1192541057 X:71973541-71973563 TAAGCCACTGCCCTGGAGCTGGG + Intergenic
1199601819 X:149545543-149545565 CAGGCCACTGCCCATGAGCTTGG + Intronic
1200948422 Y:8868460-8868482 CCAGGCACTCCCCAAGAGTTAGG + Intergenic
1202037451 Y:20649020-20649042 CCAGGCACTCCTCGAGAGCTAGG + Intergenic