ID: 922249577

View in Genome Browser
Species Human (GRCh38)
Location 1:223836307-223836329
Sequence GGAAACACAATTCCGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922249577 Original CRISPR GGAAACACAATTCCGAAGGA AGG Intronic
902103945 1:14017762-14017784 GGAAACAGAATTCCAACGCACGG - Intergenic
903129623 1:21270243-21270265 GGAACAACAATTCCGAAGTCTGG + Intronic
903161465 1:21492006-21492028 GGAGACAAAATTCCCAAGCAGGG + Intergenic
904538941 1:31219679-31219701 GGAGACACATTCCCAAAGGAAGG + Intronic
909184007 1:72461928-72461950 GGAGAAACAATTCCTAAGTAAGG + Intergenic
909494112 1:76259020-76259042 GGAAACAGAATTGAGAAGGTAGG - Intronic
909717151 1:78722816-78722838 TGAAACAAAATTCTCAAGGAAGG + Intergenic
915029637 1:152867062-152867084 GGAAAAACAATTATGAAGGATGG + Intergenic
915984640 1:160452372-160452394 GGAAACAAAATTACCAAGGCTGG - Intergenic
918610757 1:186488216-186488238 ATAAACACAATTCAGAAAGAAGG - Intergenic
920597084 1:207282836-207282858 GGGAACAAAATTCAGCAGGAGGG + Intergenic
920659539 1:207903499-207903521 GGAAACACAGTTAATAAGGATGG - Intronic
921456430 1:215377554-215377576 AGAAACTCAATTCCAAAAGAAGG + Intergenic
922249577 1:223836307-223836329 GGAAACACAATTCCGAAGGAAGG + Intronic
922379269 1:225005775-225005797 GGAAAAACAATACTGAAAGAAGG + Intronic
922975234 1:229778671-229778693 GGAAACACAATTCCAAATGGTGG + Intergenic
1063104018 10:2976840-2976862 GAAAATACAATTCCGTGGGATGG + Intergenic
1064402675 10:15034503-15034525 GGAAATACAATGAAGAAGGAAGG + Intronic
1064489522 10:15836944-15836966 GGAAACACAATTTGGAAGAAAGG + Intronic
1068263838 10:54621650-54621672 GTAAAAACAATGCTGAAGGAGGG - Intronic
1069202487 10:65638460-65638482 AGAAAGAAAATTCAGAAGGAGGG + Intergenic
1071197493 10:83178029-83178051 GGAAACACAATCATGGAGGAAGG + Intergenic
1072641824 10:97216726-97216748 GGAAACACAATTATGGTGGAAGG - Intronic
1075015271 10:118906004-118906026 GGAGACAAAATACAGAAGGAGGG + Intergenic
1078708656 11:13769102-13769124 GGAAACACAATGTTGAAAGATGG + Intergenic
1080837142 11:35949723-35949745 GGAAGCACAATTCTTAAGGAAGG - Intronic
1090965619 11:131595523-131595545 GGAAACACAATTGCTTGGGATGG - Intronic
1093426639 12:19035375-19035397 GGAAATAAAATTCCTAGGGATGG - Intergenic
1094474092 12:30827988-30828010 CGAAACAGAATTCCAAAGGCAGG - Intergenic
1096878630 12:54649101-54649123 GAAAACACAAGTCCGCAGGAAGG - Intergenic
1101234282 12:102772687-102772709 GGAAACACTATTCCTGGGGATGG - Intergenic
1104438874 12:128778889-128778911 GGAAACACTATTCCAAGGCAGGG + Intergenic
1104950567 12:132438010-132438032 GGAAACAGAATTCCCAGAGACGG + Intergenic
1104987472 12:132604931-132604953 GGAAACCCAAGTTTGAAGGATGG - Intronic
1107242273 13:38250770-38250792 GGTAATACAATACCAAAGGAAGG + Intergenic
1109811406 13:67517718-67517740 GGTAGCTCAATACCGAAGGACGG - Intergenic
1112782857 13:102920749-102920771 GGAAACTGAACTCAGAAGGAAGG + Intergenic
1115505141 14:34086620-34086642 GGAAACACAATCATGGAGGAAGG + Intronic
1116752885 14:48909114-48909136 GGGAACAAAATCCTGAAGGAGGG - Intergenic
1121134568 14:91484592-91484614 GAAAACAGAATTCCTAAGAAAGG + Intronic
1121362506 14:93274470-93274492 GGAAACACTTTTCCAATGGAGGG + Intronic
1121749167 14:96333077-96333099 AGTAAAACAATTCCGAAAGAAGG - Intronic
1122824509 14:104363075-104363097 GGAAATCCACTTCCGCAGGAGGG - Intergenic
1130519529 15:84651686-84651708 GGAAACACAGATCTGAGGGAAGG - Intronic
1131465404 15:92650934-92650956 GGAGACAAAAATCGGAAGGAGGG - Intronic
1131868102 15:96733274-96733296 GTAGGCACAATTCCGAAGGAAGG - Intergenic
1132378369 15:101348042-101348064 GGTAACACAACCCAGAAGGAAGG - Intronic
1133673209 16:8044687-8044709 GGAAACAAAATTCCTAATGCTGG + Intergenic
1141019495 16:80481868-80481890 GGAGACACAATTCCAGGGGAAGG - Intergenic
1141026191 16:80551052-80551074 AGAAGCACAAGTCCGAGGGATGG - Intergenic
1149062535 17:52439892-52439914 GGAAATACCATTCTGAAGGTAGG - Intergenic
1149578222 17:57728803-57728825 GGACACAGAACTCCCAAGGAAGG + Intergenic
1155625816 18:27833476-27833498 AGAAACACAATTGAGAAGGTGGG - Intergenic
1157950739 18:52034191-52034213 AGAAACACAGATCCGAATGAGGG - Intergenic
1159819751 18:73125215-73125237 TGAAGCACAATTGCTAAGGAGGG + Intergenic
1168437390 19:56330884-56330906 GGAAACACCATTCTGAAGATTGG - Intronic
1168562435 19:57395499-57395521 GGAAACACAATCCTGGCGGAAGG + Intronic
931150155 2:59564369-59564391 GGGAACACACTTCCGAATGAAGG - Intergenic
933949620 2:87317374-87317396 GGAAACACAATTATGGTGGAAGG + Intergenic
935868690 2:107420907-107420929 GGAAACACAATCATGATGGAAGG + Intergenic
936330573 2:111544223-111544245 GGAAACACAATTATGGTGGAAGG - Intergenic
936479527 2:112872636-112872658 AGGAAAACAATTCCTAAGGAAGG + Intergenic
938243745 2:129761940-129761962 GGAATCACAAGGCAGAAGGAGGG + Intergenic
939474353 2:142667539-142667561 GGAAATATATTTCTGAAGGATGG + Intergenic
940105179 2:150091480-150091502 GGAAACTCAGTTCCTAATGAGGG - Intergenic
940418677 2:153453181-153453203 GGAAACACAATTCTGGATGTTGG + Intergenic
942586618 2:177486402-177486424 GAAAACACTATTACAAAGGAAGG - Intronic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
1169643299 20:7779192-7779214 GGAAACACAATTACGATAGAAGG - Intergenic
1171509877 20:25673445-25673467 GGAAATGCTATTCCTAAGGAAGG + Intergenic
1172758947 20:37308468-37308490 TGAAACCCAACTCTGAAGGACGG - Intronic
1173903822 20:46611218-46611240 GGAAACCCAAATCCGAAGGAAGG - Intronic
1175450204 20:59059188-59059210 GGGAACACATTTTCTAAGGATGG + Intergenic
1182427129 22:30279782-30279804 GGAACCAGAATTCCAAAAGAAGG - Intergenic
1183252980 22:36743530-36743552 GGAAAAACAAAACTGAAGGAAGG + Intergenic
949135205 3:556235-556257 GGAGACACAATTATGATGGAAGG + Intergenic
951180490 3:19653678-19653700 GGAAACACAATCATGACGGAAGG + Intergenic
951445310 3:22772901-22772923 GGAAACATCATTCTGGAGGATGG + Intergenic
951478767 3:23136685-23136707 GGAAAAAGAATTCCCAAGGAAGG + Intergenic
953835299 3:46338201-46338223 GGAAACACAGTTATGATGGAAGG + Intergenic
956207848 3:66772435-66772457 GGAAACAAACTTCCCAAGAAAGG - Intergenic
959047475 3:101490431-101490453 GGAAACAGAAATCAGAAGAATGG + Intronic
959126104 3:102291816-102291838 GGAAATACAATTCCTTAAGAAGG + Intronic
959897944 3:111626511-111626533 TGAAATACAATGCCAAAGGATGG - Intronic
962510126 3:136090579-136090601 GGAAAAACAATACAGAAAGAGGG + Exonic
967647062 3:191938372-191938394 GAAAACACAATTCATAATGAGGG - Intergenic
972064585 4:34924887-34924909 GAAAACAATATTCCAAAGGAAGG + Intergenic
972175022 4:36393133-36393155 GGAAACACAGTTCCAGATGAGGG - Intergenic
972422198 4:38898730-38898752 GGAAAGACTATTCCAAAGGAAGG + Intronic
973738109 4:53892440-53892462 GGAAACAAAATGGGGAAGGAGGG - Intronic
978486299 4:109257903-109257925 GGAAAGAGAATTTCAAAGGAAGG + Intronic
978839125 4:113188744-113188766 GGAAACTAGATTCTGAAGGAAGG - Intronic
980761956 4:137246218-137246240 GGAAACAAAATCCCGAGGAAAGG + Intergenic
981227911 4:142318473-142318495 GGAAAATGAATTCCTAAGGAAGG - Intronic
986045549 5:4034047-4034069 GGAAAAACAATTGAAAAGGAGGG + Intergenic
986812126 5:11371519-11371541 GGAAACAGAGTTCAGAAGGAAGG - Intronic
988640859 5:33039939-33039961 GGAAACAAAATTATGAATGAAGG + Intergenic
989386097 5:40855933-40855955 GGAAACACAATCATGATGGAAGG - Intronic
990209506 5:53467285-53467307 GGAAACACATTTCCCAGGTAGGG - Intergenic
992086152 5:73280238-73280260 GCAAACAGAATTCAGAAGGGAGG + Intergenic
995950061 5:117701069-117701091 GGAAACACAGCTTGGAAGGAGGG + Intergenic
996146533 5:119983714-119983736 AGAAACACAAATCCAAAGGAAGG - Intergenic
1003021505 6:2513881-2513903 GGAACCTGAATCCCGAAGGATGG - Intergenic
1005065047 6:21809529-21809551 AGAAAAACAATTTCAAAGGAAGG - Intergenic
1011872400 6:91912199-91912221 GGAAACATGCTTCCGAAGTAAGG + Intergenic
1014951356 6:127559227-127559249 GGAAACACAATCATGGAGGAAGG - Intronic
1015552139 6:134422719-134422741 GGCAATACAATTCCCAAGTACGG + Intergenic
1015889119 6:137951665-137951687 GGAAAGACAACTCGGAAAGACGG - Intergenic
1018707239 6:166471795-166471817 GGAAAGACACTTCAGAAGGTGGG - Intronic
1021089196 7:16462373-16462395 GGAAAAACTATTCCCAAAGAAGG + Exonic
1022842909 7:34181857-34181879 GAAAAAACAATTTCAAAGGAGGG + Intergenic
1023531388 7:41158917-41158939 TGAAACAGTATTCCTAAGGAAGG + Intergenic
1029890813 7:103928546-103928568 GGAAACAGAATTTCCAACGAAGG + Intronic
1031773936 7:125883233-125883255 GGAAAGACAATTTCCAAGGTTGG - Intergenic
1032600160 7:133285270-133285292 GGAAATACAATACAGAAGAAAGG - Intronic
1033001466 7:137509747-137509769 GGAAAGAAAATTCTGAAGGCTGG + Intronic
1033212708 7:139471938-139471960 GGAAGCACAATACAGAAGGTGGG + Intronic
1034372323 7:150610204-150610226 GGAAACACAAAACCAAAAGAGGG + Intergenic
1035833106 8:2719874-2719896 GGAAAAAAAATTCCCAAAGAGGG - Intergenic
1038416767 8:27402422-27402444 GGATACATAATTCTGGAGGAGGG + Intronic
1038697070 8:29816107-29816129 GAAAACACATTTCAGAAGGAAGG - Intergenic
1042491187 8:69400025-69400047 GAATATACAATTCCAAAGGAGGG - Intergenic
1042890372 8:73603370-73603392 AGAAACAAAATTTAGAAGGATGG - Intronic
1044023921 8:87144313-87144335 GGAAACACAATTACTAAGCATGG + Intronic
1044077578 8:87842005-87842027 AAAAACACAATTCCATAGGAAGG + Intergenic
1046144177 8:110135750-110135772 GGAAACACAATTACTAACCATGG + Intergenic
1048239070 8:132723242-132723264 AGAAACACACTTTAGAAGGATGG - Intronic
1048648548 8:136449519-136449541 GGGAACCCAATTCCAGAGGAAGG + Intergenic
1049915448 9:313051-313073 GCAAACACAATCCAGAAGGGTGG - Intronic
1052207516 9:25860941-25860963 TGAATCACAATTCTGAAGGCTGG - Intergenic
1057756811 9:97845829-97845851 AGAAACCCACTTCCCAAGGAAGG + Intergenic
1058940230 9:109806656-109806678 GGAAACACACTTCTGGTGGAAGG + Intronic
1058950421 9:109898330-109898352 GGAAAGAAAATTCAGGAGGATGG - Intronic
1059249483 9:112876111-112876133 GGAAATAAAATACTGAAGGACGG + Intronic
1060281206 9:122216848-122216870 GGAAACATAGTTACAAAGGAGGG + Intronic
1187258380 X:17661789-17661811 GGAAGGACAATTCCCAAAGAGGG - Intronic
1191608476 X:63086409-63086431 GGCAACACAGATCTGAAGGAGGG - Intergenic
1196534468 X:116826103-116826125 CAAAACAAAATTCAGAAGGAAGG - Intergenic