ID: 922251582

View in Genome Browser
Species Human (GRCh38)
Location 1:223853943-223853965
Sequence ATGTGCTAGAGGAAGCATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922251582_922251584 -3 Left 922251582 1:223853943-223853965 CCTTCATGCTTCCTCTAGCACAT No data
Right 922251584 1:223853963-223853985 CATGCTGTAGCATAGCTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922251582 Original CRISPR ATGTGCTAGAGGAAGCATGA AGG (reversed) Intergenic
No off target data available for this crispr