ID: 922256677

View in Genome Browser
Species Human (GRCh38)
Location 1:223898500-223898522
Sequence CATTGGGTGGGGGGTAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922256666_922256677 10 Left 922256666 1:223898467-223898489 CCTTCTGATTCTCCAGGACAGAG No data
Right 922256677 1:223898500-223898522 CATTGGGTGGGGGGTAGAGTGGG No data
922256668_922256677 -2 Left 922256668 1:223898479-223898501 CCAGGACAGAGGATAGCACTACA No data
Right 922256677 1:223898500-223898522 CATTGGGTGGGGGGTAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922256677 Original CRISPR CATTGGGTGGGGGGTAGAGT GGG Intergenic
No off target data available for this crispr