ID: 922257813

View in Genome Browser
Species Human (GRCh38)
Location 1:223908212-223908234
Sequence ATGGCTCCACACTGCCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922257808_922257813 15 Left 922257808 1:223908174-223908196 CCCACAGCCGACTGCTGGGTGCG No data
Right 922257813 1:223908212-223908234 ATGGCTCCACACTGCCATCTTGG No data
922257809_922257813 14 Left 922257809 1:223908175-223908197 CCACAGCCGACTGCTGGGTGCGC No data
Right 922257813 1:223908212-223908234 ATGGCTCCACACTGCCATCTTGG No data
922257810_922257813 8 Left 922257810 1:223908181-223908203 CCGACTGCTGGGTGCGCAGCAGA No data
Right 922257813 1:223908212-223908234 ATGGCTCCACACTGCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922257813 Original CRISPR ATGGCTCCACACTGCCATCT TGG Intergenic
No off target data available for this crispr