ID: 922270252

View in Genome Browser
Species Human (GRCh38)
Location 1:224026319-224026341
Sequence GAGTGACCCTGAGCCCTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922270252_922270253 9 Left 922270252 1:224026319-224026341 CCTGGGAGGGCTCAGGGTCACTC No data
Right 922270253 1:224026351-224026373 CTTTCCCATGCGCTGCTGTGAGG 0: 3
1: 0
2: 3
3: 8
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922270252 Original CRISPR GAGTGACCCTGAGCCCTCCC AGG (reversed) Intergenic
No off target data available for this crispr