ID: 922273611

View in Genome Browser
Species Human (GRCh38)
Location 1:224056659-224056681
Sequence ACTCATATACAGATGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922273611_922273618 26 Left 922273611 1:224056659-224056681 CCTTCCACCATCTGTATATGAGT No data
Right 922273618 1:224056708-224056730 TGATGATGGAACCCATACCATGG No data
922273611_922273616 12 Left 922273611 1:224056659-224056681 CCTTCCACCATCTGTATATGAGT No data
Right 922273616 1:224056694-224056716 AAAGACAACCAAGATGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922273611 Original CRISPR ACTCATATACAGATGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr