ID: 922275216

View in Genome Browser
Species Human (GRCh38)
Location 1:224071242-224071264
Sequence TCGGAAAGTACTGTGATTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922275210_922275216 8 Left 922275210 1:224071211-224071233 CCTGGGCTCAAGCAGTCCACCCA 0: 69
1: 1954
2: 11665
3: 32523
4: 66793
Right 922275216 1:224071242-224071264 TCGGAAAGTACTGTGATTGCAGG No data
922275207_922275216 27 Left 922275207 1:224071192-224071214 CCTAGGCTGGTCTCAAACTCCTG 0: 19126
1: 38854
2: 56666
3: 50459
4: 31838
Right 922275216 1:224071242-224071264 TCGGAAAGTACTGTGATTGCAGG No data
922275212_922275216 -8 Left 922275212 1:224071227-224071249 CCACCCACCTTTGTCTCGGAAAG No data
Right 922275216 1:224071242-224071264 TCGGAAAGTACTGTGATTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922275216 Original CRISPR TCGGAAAGTACTGTGATTGC AGG Intergenic
No off target data available for this crispr