ID: 922279381

View in Genome Browser
Species Human (GRCh38)
Location 1:224108513-224108535
Sequence CTTTGCAAGACAGTGGTCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922279381_922279385 -3 Left 922279381 1:224108513-224108535 CCCGAGACCACTGTCTTGCAAAG No data
Right 922279385 1:224108533-224108555 AAGGTCCTATTGTAGTCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922279381 Original CRISPR CTTTGCAAGACAGTGGTCTC GGG (reversed) Intergenic
No off target data available for this crispr