ID: 922279382

View in Genome Browser
Species Human (GRCh38)
Location 1:224108514-224108536
Sequence CCTTTGCAAGACAGTGGTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922279382_922279385 -4 Left 922279382 1:224108514-224108536 CCGAGACCACTGTCTTGCAAAGG No data
Right 922279385 1:224108533-224108555 AAGGTCCTATTGTAGTCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922279382 Original CRISPR CCTTTGCAAGACAGTGGTCT CGG (reversed) Intergenic
No off target data available for this crispr