ID: 922279385

View in Genome Browser
Species Human (GRCh38)
Location 1:224108533-224108555
Sequence AAGGTCCTATTGTAGTCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922279384_922279385 -10 Left 922279384 1:224108520-224108542 CCACTGTCTTGCAAAGGTCCTAT No data
Right 922279385 1:224108533-224108555 AAGGTCCTATTGTAGTCTGTTGG No data
922279382_922279385 -4 Left 922279382 1:224108514-224108536 CCGAGACCACTGTCTTGCAAAGG No data
Right 922279385 1:224108533-224108555 AAGGTCCTATTGTAGTCTGTTGG No data
922279380_922279385 7 Left 922279380 1:224108503-224108525 CCATCTCATACCCGAGACCACTG No data
Right 922279385 1:224108533-224108555 AAGGTCCTATTGTAGTCTGTTGG No data
922279381_922279385 -3 Left 922279381 1:224108513-224108535 CCCGAGACCACTGTCTTGCAAAG No data
Right 922279385 1:224108533-224108555 AAGGTCCTATTGTAGTCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922279385 Original CRISPR AAGGTCCTATTGTAGTCTGT TGG Intergenic
No off target data available for this crispr