ID: 922280490

View in Genome Browser
Species Human (GRCh38)
Location 1:224118826-224118848
Sequence ATTTTCCAAGGTAAGTTCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 263}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922280490 Original CRISPR ATTTTCCAAGGTAAGTTCTA TGG (reversed) Intronic
900909560 1:5585380-5585402 AGTTTCCTAGGGAAGTTCTCGGG - Intergenic
902791769 1:18773771-18773793 ATTCTCCACGGCAACTTCTATGG - Intergenic
906013202 1:42549115-42549137 ATCTTACAAGGTAATTTCTGAGG - Intronic
907930203 1:58992003-58992025 ATTTTCAAAGGTTCTTTCTAAGG - Intergenic
910051273 1:82977060-82977082 ATTTCCCAAGATATGTTCAATGG + Intergenic
910958420 1:92733132-92733154 GGTTTCCAAAGTAAGTTCTAAGG - Intronic
911138686 1:94472538-94472560 ATTTCCCAAAGTATGTTCTGTGG + Intronic
911292811 1:96078844-96078866 ATTTTCAAAGGTAGGTTATTGGG + Intergenic
911526717 1:98996595-98996617 ATTTTCCAAAGTCTGTTATAAGG + Intronic
911903746 1:103538657-103538679 ATGTTCTAAGTTATGTTCTAAGG - Intronic
912695450 1:111838322-111838344 ATTTTCCCAGGTATGTGCTATGG + Intronic
921382069 1:214534251-214534273 AGTTTCCAAGGTAGGTTCTGTGG - Intronic
922137336 1:222842564-222842586 ATTTTCCAAAGTATGTTCCATGG + Intergenic
922280490 1:224118826-224118848 ATTTTCCAAGGTAAGTTCTATGG - Intronic
923839607 1:237654127-237654149 ATTCTCCAAGATAATTTATATGG + Intronic
1063273639 10:4539642-4539664 ATTGGCCAAGGTAAGTTACATGG + Intergenic
1064593624 10:16921003-16921025 ATTTTGCAAGGGAAGTTTGAAGG - Intronic
1065061637 10:21908370-21908392 ATTCTTTAAGGTATGTTCTAAGG + Intronic
1065508145 10:26450325-26450347 GTTTTCAATGGTAACTTCTAGGG - Intronic
1070035869 10:72723565-72723587 ATCTTCGATGGTAAGTTATATGG - Intronic
1071068150 10:81661099-81661121 ACTTTCCAAGGTGAATTCAAAGG + Intergenic
1072092540 10:92142740-92142762 ATTTTGAAAGGAAAGATCTAGGG - Intronic
1072153676 10:92704334-92704356 ATTTTCAAATGTAAATTTTATGG - Intergenic
1072989176 10:100174178-100174200 CTTTTCCTAGGGAAGTTCTCTGG - Intronic
1074434113 10:113419106-113419128 TTTTTTCAAGGTAAAGTCTATGG + Intergenic
1074781863 10:116808037-116808059 ATTTCCCAAGGTAGTTTCTGAGG + Intergenic
1074858830 10:117493877-117493899 ATTTTTCAAGGCAATTTCTTTGG - Intergenic
1075665272 10:124225352-124225374 ATTCTCCAAGGTCATTTCAAGGG + Intergenic
1075932776 10:126313429-126313451 ATTTTCAAAGTTAAATTCAAGGG - Intronic
1076663538 10:132071262-132071284 ATTATCCAAAGTACGTTCTCTGG - Intergenic
1079815354 11:25049851-25049873 ATTTTTCAAGGTATATTTTATGG + Intronic
1080485277 11:32699859-32699881 ATTTTTTAATCTAAGTTCTAGGG - Intronic
1080493280 11:32791315-32791337 ATTTCCCAAAGTATGTTCTAAGG + Intronic
1080493309 11:32791556-32791578 ATTTTCCAAAGTATGTTCTTTGG - Intronic
1081139479 11:39481073-39481095 ATTTTCCAAAATAAACTCTATGG + Intergenic
1081370660 11:42298148-42298170 CTTTTCCCAGGTGAGTTTTATGG + Intergenic
1083091643 11:60206062-60206084 CTATTCCAAGGTACTTTCTATGG + Intronic
1085794612 11:79527262-79527284 ATTTTTCATGGCAAGTTGTATGG + Intergenic
1086099804 11:83087231-83087253 AATATACAAGGTAGGTTCTAGGG + Intergenic
1086595181 11:88562057-88562079 GTTTTCCAAAGTAAGTTCTTTGG + Intronic
1087148748 11:94838698-94838720 AATTTACAAAGTAAGATCTAGGG - Intronic
1087564583 11:99837818-99837840 ATTATTTAAGGTCAGTTCTATGG + Intronic
1088176782 11:107061671-107061693 CTTTTCCAAGTTAATTCCTAAGG - Intergenic
1089077559 11:115750577-115750599 TTTTTCCCAGGTAAGTTCAGTGG - Intergenic
1089370681 11:117953943-117953965 AGTTTCCAAGGCAAGGACTATGG - Intergenic
1091098631 11:132848378-132848400 ATTTTCCAAGGTGAGTGGAAAGG - Intronic
1091339702 11:134800807-134800829 ATTTTACAAGGTAACTGCTGAGG - Intergenic
1093119156 12:15246616-15246638 ACTGTGGAAGGTAAGTTCTATGG + Intronic
1093432874 12:19104078-19104100 TATTTCCAAGGTTAGTTGTAAGG + Intergenic
1093726120 12:22510703-22510725 ATTTTAAAAGGAAAGTTCTATGG + Intronic
1093747848 12:22763426-22763448 ATTTGCCAAAGTATATTCTATGG - Intergenic
1094241694 12:28234020-28234042 ATTTTGCAAGATGAGTTCTGTGG - Intronic
1094278502 12:28707692-28707714 ACTTTCCAAGGTAATTTCCAGGG + Intergenic
1095675411 12:44911658-44911680 ATTTACTATGTTAAGTTCTAGGG + Intronic
1096830481 12:54310008-54310030 TTTTTTCCAGGAAAGTTCTATGG - Intronic
1097300822 12:58017158-58017180 ATTTTACTAGGGTAGTTCTAGGG + Intergenic
1097637028 12:62135110-62135132 CTTTTCCATGGTAAGCTCTATGG + Intronic
1097675073 12:62591402-62591424 TTTTTCCAAGATATGTACTAAGG + Intronic
1097728661 12:63102955-63102977 ATTTTCCTAGGTATGTACTTAGG - Intergenic
1099026956 12:77476551-77476573 ATTTATGAAGGTAAGTTCTAAGG + Intergenic
1100062837 12:90602604-90602626 ATTTTTCAAGGCAAGTGATAAGG + Intergenic
1101286336 12:103317099-103317121 ATTTTTCAAGAAGAGTTCTAGGG + Intronic
1103034154 12:117642823-117642845 AGTTTCCAAGTTGAGTTTTAAGG + Intronic
1103614500 12:122143480-122143502 ATTTTCCAGGGGAAATTCCAAGG - Exonic
1105044101 12:132987178-132987200 ATTTCTCCAGCTAAGTTCTAAGG - Intronic
1106877760 13:34093448-34093470 ATTTTCTAATGTGACTTCTAAGG - Intergenic
1107550442 13:41469583-41469605 ATTTTCCCAGGTTAGATCCAGGG + Intronic
1107552647 13:41491867-41491889 ATTTCCCAAGGCATGTTCCAAGG - Intergenic
1108179098 13:47823288-47823310 ATTTCCCAAGGTGGGTTTTATGG - Intergenic
1108276444 13:48814848-48814870 ATTTTCCAAAGTATTTTCCATGG - Intergenic
1109319088 13:60787487-60787509 ATTTTCCAAGATAAATTCAGTGG - Intergenic
1109733624 13:66451397-66451419 AATTTCCAAGGTAGCTGCTATGG + Intronic
1109765648 13:66893024-66893046 ATTCTCCAAAATAAGTTGTATGG + Intronic
1110264671 13:73523729-73523751 ATTTGCCAGGGTATGTACTAGGG + Intergenic
1111166181 13:84460674-84460696 ATTTTCAAAGCTAAGCTTTAGGG - Intergenic
1112552132 13:100431387-100431409 GTTATCCAAGTTAAGTTTTAAGG + Intronic
1114980765 14:28160526-28160548 AATTTTTAAGGTAAGTTCTAAGG - Intergenic
1115414014 14:33110565-33110587 ATTTCCCAAAGTATATTCTAAGG - Intronic
1115959335 14:38817387-38817409 ATTTTCCAAGCTGAGTTATTTGG + Intergenic
1117237325 14:53792147-53792169 AGTTCCCAAAGCAAGTTCTATGG - Intergenic
1117896716 14:60495121-60495143 CTGTTCCAATGTAAGATCTATGG - Intronic
1118160153 14:63280551-63280573 ATTTTTAAAGGTAAGCTGTAAGG + Intronic
1120310578 14:82822298-82822320 AATTTCCAAGGAAAATTCTATGG - Intergenic
1120328668 14:83059990-83060012 ATTTTCCTAGGTGTGTTCTATGG - Intergenic
1120344821 14:83272970-83272992 ATTTTACAAGGTAAATTATTTGG - Intergenic
1120401895 14:84042852-84042874 ATTCTCAAAGGTAAGTACTTAGG + Intergenic
1122158600 14:99766672-99766694 ATTTTCCAAGAGAAATTCAATGG - Intronic
1122258330 14:100497128-100497150 ATTTGCCAAGGTTAGCTTTATGG + Intronic
1125069727 15:35539349-35539371 ATTTTCTAAAGTATGTTCTGCGG + Intronic
1127367777 15:58307890-58307912 ATTTTCCAAGGGAAATTTCAGGG - Intronic
1127611997 15:60646154-60646176 GTTTTCCACTGTAAGTTATAGGG + Intronic
1130154338 15:81336743-81336765 ATGGTCCAAGGTAAGAACTATGG - Intronic
1137887893 16:52126351-52126373 ATTTTCCAAGGTAAATGTTATGG - Intergenic
1138039453 16:53647140-53647162 ATTTCCCAAAGTATGTTGTAAGG + Intronic
1139139214 16:64240642-64240664 ATTTTGCAACTTAAATTCTAAGG - Intergenic
1139813584 16:69646072-69646094 ATTTTCCAATGTAAGAACAATGG - Intronic
1140302517 16:73772140-73772162 ATTTTCAAAGGAAAGGTCTGTGG - Intergenic
1140772678 16:78219746-78219768 ATATTCCAGGGTGAGTTCTTGGG - Intronic
1144071299 17:11673393-11673415 ATTTAAGAAGGTAAGTCCTAAGG - Intronic
1144368073 17:14563799-14563821 AATTACCAAGGTAACTTCTTGGG + Intergenic
1144401555 17:14907976-14907998 AATTTCCAATGTAACTGCTATGG - Intergenic
1144513059 17:15894075-15894097 ATTTTCCAAAGTATGTTCTGTGG - Intergenic
1145125621 17:20297776-20297798 ATTTTCCAAAGTATGCTCTGTGG - Intronic
1146020077 17:29270194-29270216 ATTGTCCAAGCTTAGTTGTATGG + Intronic
1146291075 17:31607693-31607715 GCTTTCCAAGTGAAGTTCTAAGG + Intergenic
1146537077 17:33661869-33661891 AGATACCAAGGTAAGTTCTATGG - Intronic
1150236728 17:63599428-63599450 TTTTTAAAAGGTAAGTGCTAAGG + Intergenic
1150487551 17:65554403-65554425 ATTTTCTAAGGCAAGATCAAGGG + Intronic
1150665741 17:67135568-67135590 ATTTTACATGGTAAGTTGAATGG - Intronic
1150883261 17:69055764-69055786 ATTTTCTAAGGTGTGTTTTATGG - Intronic
1151157992 17:72140361-72140383 AATTTCCAAGGTCATTTCAAAGG + Intergenic
1151166250 17:72205993-72206015 ATGATCCAAGAGAAGTTCTAAGG - Intergenic
1153812207 18:8762210-8762232 ATTTTCCAAGAGAAGTTTCAAGG + Intronic
1154973461 18:21433735-21433757 AATTTTCTAGGTAATTTCTAAGG + Intronic
1155040610 18:22062419-22062441 ATATTCTAAGGTAAGCTCTTTGG - Intergenic
1155098598 18:22585422-22585444 ATATTTAAAGGTAAGTACTAAGG + Intergenic
1155441309 18:25865359-25865381 ATTTTGCAAGTTAAGTCTTACGG + Intergenic
1156738249 18:40290652-40290674 CTTTTCCAAGGCCAGTTATAAGG - Intergenic
1157059589 18:44272347-44272369 ACTCTCCAGGGTAAGTACTAGGG + Intergenic
1157374099 18:47147793-47147815 AGTTTAAAAGGTACGTTCTATGG - Intronic
1158265121 18:55653110-55653132 ATTTTCCAAAGTAATCTCTTAGG + Intronic
1158544276 18:58382341-58382363 GTTTTCCAAAGTAAGTGTTAGGG - Intronic
925230884 2:2232968-2232990 ATTTTTCAAGCTAAATTCTATGG - Intronic
926809061 2:16740387-16740409 ACTTTCCCAGGTAAGTTTAATGG - Intergenic
930495290 2:52134181-52134203 ATTTTCCAAATCATGTTCTAAGG + Intergenic
931031769 2:58183986-58184008 AACTTCTAAGGTAACTTCTAAGG + Intronic
931076717 2:58723552-58723574 ATTTTCCAAAGTGTGTTTTATGG + Intergenic
933069596 2:77840419-77840441 ATTTTCCAATGTGTGTTCTCTGG + Intergenic
933450542 2:82444415-82444437 ATTTTCCCAGGTTAGTACTTGGG + Intergenic
934566255 2:95343195-95343217 ATATTCCAAGGTAAGAGCCAGGG + Intronic
935533488 2:104264308-104264330 ATTATCCAAGATAAATACTATGG + Intergenic
935719049 2:105963672-105963694 ATTTTCCAAGTAAAGGTCAATGG - Intergenic
935726689 2:106029743-106029765 ATTTTCAAAGGGAAGTTTTAAGG - Intergenic
936531837 2:113281757-113281779 ATTTTAAAAAGTGAGTTCTAAGG - Intergenic
938554633 2:132413923-132413945 AATTTCCAAGGAAAGCTCTATGG + Intergenic
939431805 2:142119269-142119291 CATTTCCAAGGTAATTTCTCTGG + Intronic
939927976 2:148197580-148197602 GTTTCCCAAGTTAAGTTCCATGG - Intronic
939997944 2:148937698-148937720 ATTTTCCAAAGTGTGTTCTGTGG + Intronic
940221389 2:151355494-151355516 AACTTCCAAGGTAAGTTCATAGG + Intergenic
940400385 2:153242071-153242093 ATTGTTCAAGATAATTTCTAGGG - Intergenic
941301304 2:163805871-163805893 ATTTTACAAGGCAGCTTCTAAGG - Intergenic
942361558 2:175178006-175178028 ATATTCCAATGTAATTTTTATGG - Exonic
942718328 2:178920353-178920375 ATTTTACAAAGTAACTACTATGG + Intronic
942995060 2:182250795-182250817 TTTCTCCAAGGTAAGACCTACGG + Intronic
943489371 2:188531337-188531359 ATTTGCAAAAGTAATTTCTAAGG + Intronic
943551441 2:189345231-189345253 AATTTCCAACATCAGTTCTATGG + Intergenic
945548330 2:211186771-211186793 ATTTTACAAGGTAAAGTCTCAGG + Intergenic
945582961 2:211619822-211619844 TTTTTCAAAGGCAAGTGCTAGGG + Intronic
948674318 2:239588158-239588180 ATTTTCCCAGGAAATTTCAAGGG - Intergenic
1169041009 20:2495402-2495424 ATTTTCCAAGGCAAGTTACAAGG - Intronic
1169308669 20:4516937-4516959 ATTTTACCAGGAAAGTTCTATGG - Intergenic
1169548491 20:6676073-6676095 ATTTTCAAAGGTAAACTTTAAGG - Intergenic
1169733169 20:8809083-8809105 ATTTCCCGAGGTCAGTTCAATGG + Intronic
1170193531 20:13667420-13667442 ATTTTTTAATGTAAGTTTTATGG + Intergenic
1174549338 20:51350404-51350426 ATTTTTCAAGATGAGTGCTAGGG - Intergenic
1177067138 21:16453798-16453820 ATTTTCCAATGTAATTTCCCAGG + Intergenic
1177560775 21:22749297-22749319 ATTTGCCAAGGTAACTTGTCTGG + Intergenic
1179065340 21:38019569-38019591 ATTTTAAAAGAAAAGTTCTATGG - Intronic
1182618770 22:31606421-31606443 ATGTTCCAAGGTGAGGTATAAGG + Exonic
1182994376 22:34799311-34799333 ATTTTCCAAGTTATCTTCTTTGG - Intergenic
1183150577 22:36034038-36034060 CTTGTCCAAGGTAAGATATATGG - Intergenic
1184530253 22:45051111-45051133 ATTTTCCATGGTACATTCTTGGG - Intergenic
949687526 3:6592862-6592884 ATTTTTTAATTTAAGTTCTAGGG - Intergenic
949786426 3:7746639-7746661 TTTTTCCAAAGTATGGTCTATGG - Intergenic
950180712 3:10911300-10911322 ATTTTCCTTGGCAACTTCTAGGG + Intronic
950350455 3:12345863-12345885 ATTTTTCAAGATCAGTTATATGG - Intronic
950890151 3:16397727-16397749 ATTTTCCGAAGTATGTGCTATGG + Intronic
951023610 3:17806700-17806722 ATTTTCCAAATTCAATTCTAAGG - Intronic
951057609 3:18165659-18165681 ATTTTCAAATGTAAATACTAGGG - Intronic
955422935 3:58758078-58758100 ATTTCCCAAGGTGTGTTCTGTGG - Intronic
956119885 3:65955646-65955668 TTTTTCCAAGGGAAATTGTAAGG - Intronic
956250110 3:67226762-67226784 ATCTTCCCAGTTAAGGTCTATGG + Intergenic
956473107 3:69589747-69589769 ATTTTCCAAGGTTATCTCTTAGG - Intergenic
956480357 3:69667956-69667978 ATTTCCCAAGATATGTTCTAAGG + Intergenic
957246733 3:77724902-77724924 ATTTTCCAAGGGTAGTTCACAGG - Intergenic
957248459 3:77741821-77741843 ATTTTTATATGTAAGTTCTAAGG + Intergenic
958101976 3:89023710-89023732 ATCTTGCAAAGTAAGGTCTATGG - Intergenic
958508411 3:95013010-95013032 ATTGTCCAAAGTAAGTTACATGG + Intergenic
959391319 3:105777779-105777801 AATTTCCATGTTAAGTTCTGGGG + Intronic
959403437 3:105931484-105931506 ACTTTCCTAAGTAATTTCTATGG - Intergenic
960082288 3:113554209-113554231 ATTTCCCAAAGTATGTTCGATGG + Intronic
960087157 3:113603708-113603730 ATATTCCAAGGAAAATACTAGGG + Intronic
960848276 3:122024334-122024356 ATTTCCCAAAATAAGTTCTGTGG - Intergenic
963367856 3:144362044-144362066 ATTTTCCCATTTAAATTCTAAGG - Intergenic
964843331 3:161018802-161018824 ATTTTCCAAGGTATGTTCCTTGG + Intronic
965344058 3:167525751-167525773 ATTTTTAAAAGTAAGTTGTATGG - Intronic
965402133 3:168224522-168224544 ATTTCCCAAAGTAGGTTCTGTGG + Intergenic
967477742 3:189940883-189940905 ATTTTTCAAGGTATCTTCTTAGG + Intergenic
970502198 4:16689484-16689506 CTTTTCAAAGATAAGCTCTATGG + Intronic
970528126 4:16953580-16953602 CTTTCCCCAGGGAAGTTCTAGGG - Intergenic
971349083 4:25840698-25840720 ATTTTCCAAGGTATAATCTCAGG - Intronic
972122520 4:35723019-35723041 ATTTACTAAGGTACGTTTTATGG - Intergenic
972535111 4:39993465-39993487 ATTCTAGATGGTAAGTTCTATGG - Intergenic
972758129 4:42072637-42072659 ATTTACCAAGGTTTGTTTTATGG + Intronic
975353675 4:73374116-73374138 GTTTTCCAAGTTATGTTCTATGG - Intergenic
975760998 4:77619600-77619622 ATCTTCCTGGGTCAGTTCTAGGG - Intergenic
976576531 4:86678693-86678715 AATTTCCAAGGAAAAATCTAAGG + Intronic
977101249 4:92817852-92817874 ATTATTTAATGTAAGTTCTATGG + Intronic
978426541 4:108588629-108588651 AGTTACAAAGGCAAGTTCTAAGG - Intergenic
978691464 4:111517483-111517505 ATTTTAAAAGTTAAGATCTAGGG + Intergenic
979101625 4:116623924-116623946 ATTTTCTAATGTAAATTTTATGG - Intergenic
983444037 4:167825864-167825886 GTTTTCTAAGGTAAATGCTATGG + Intergenic
984165946 4:176303481-176303503 TTGTTCCAAGGTAAGTTTTGGGG - Intergenic
984287133 4:177745114-177745136 ATTTTCCAAAGAAATTTTTAAGG + Intronic
985697587 5:1349593-1349615 ATTTTTTAATTTAAGTTCTAGGG + Intergenic
986013976 5:3741222-3741244 ATTTGCCAAAGTCAGTTCAAGGG - Intergenic
986759998 5:10871275-10871297 ATTTTCCAATGTAATTTGTAAGG - Intergenic
987467552 5:18290491-18290513 ATTTTCCATGGGATATTCTATGG + Intergenic
988025282 5:25678551-25678573 CATTTCCAAGGTAACTTCTAAGG - Intergenic
988133171 5:27133465-27133487 AATGTCCAAGGTAGGTTGTATGG + Intergenic
988868541 5:35362046-35362068 TTTCTCCATGGTAAGTGCTAAGG + Intergenic
989332180 5:40272971-40272993 ATTTTCCAAGGGTGGTTCCACGG + Intergenic
990365353 5:55064912-55064934 ATTTTAAATGGTAAATTCTATGG - Intergenic
991469228 5:66950065-66950087 ATTTTCAAAGGGGAGTTCTAAGG - Intronic
992352590 5:75945679-75945701 ATTTGTCAAGGTTTGTTCTATGG - Intergenic
993153156 5:84186499-84186521 ATTTTTTAAGGTAATTTCAATGG + Intronic
993403287 5:87479461-87479483 ATTTGTCAAGGTAAGTCATATGG - Intergenic
994930722 5:106180344-106180366 AATTTGCAAGGTAAATACTAAGG - Intergenic
995693734 5:114856983-114857005 CTTTGCAAAGGTCAGTTCTAAGG + Intergenic
995955051 5:117767499-117767521 ATTTTCCCAGTTAATTTTTAAGG - Intergenic
1000147124 5:158464457-158464479 GTTTTCCAAGGTGAGCTCTTTGG + Intergenic
1000459490 5:161497119-161497141 ACCTCCCAAGATAAGTTCTATGG + Intronic
1000666098 5:163998944-163998966 ATTTCCCAAGGTATGATCTGTGG + Intergenic
1000736923 5:164915020-164915042 ATCTTCCAATGTAAATTATAAGG + Intergenic
1000922481 5:167155263-167155285 ATTTTCCAAGCTGTGTTCTATGG + Intergenic
1003451432 6:6237227-6237249 ATTTGCCAAGTTATGTTGTAAGG + Intronic
1006285404 6:33089581-33089603 ATTTTCCAATGTAAATCATATGG + Intergenic
1012196848 6:96353566-96353588 ATTTCACTAGGTAATTTCTAAGG + Intergenic
1012240893 6:96870348-96870370 ATTGTCAGGGGTAAGTTCTATGG - Intergenic
1012523157 6:100144923-100144945 ACTTTGCAGGGTTAGTTCTAGGG - Intergenic
1013580615 6:111530627-111530649 AATTTCTAAGGCAACTTCTAAGG - Intergenic
1014392487 6:120880079-120880101 ATTTTTTAAGGTATGTTTTATGG - Intergenic
1015080682 6:129222354-129222376 TTTTTTTAAGTTAAGTTCTAGGG + Intronic
1017069026 6:150556459-150556481 AATTTCCAAAATAAGATCTAAGG - Intergenic
1017712635 6:157183889-157183911 ATTTTCCAAGTTAGGTTTTTGGG - Intronic
1020721934 7:11756291-11756313 ATTTTGGAAGGTGACTTCTAGGG + Intronic
1020889228 7:13857954-13857976 ATTTGCCAAGGCAAATTCTGAGG + Intergenic
1022229602 7:28401425-28401447 TTTTTATAATGTAAGTTCTAGGG + Intronic
1022847220 7:34222267-34222289 CTTTTCCAAGGGTAGTTCTCGGG + Intergenic
1024373523 7:48612729-48612751 GTTTTCTAGGGTAAGTTCTTAGG + Intronic
1025129032 7:56366225-56366247 ATTTTCGAAGGTAATTTATTTGG - Intergenic
1026581548 7:71622776-71622798 ATTCTCCCAGGCGAGTTCTAAGG + Intronic
1026671865 7:72397792-72397814 CTTTTCTAAAGTAAGTCCTAAGG - Intronic
1028103613 7:86851185-86851207 ATTTTCCAAGGTGTGTTCCACGG - Intronic
1028295031 7:89118643-89118665 AATTTTCAAGGTAAGGTCAAAGG - Intronic
1028737155 7:94228773-94228795 ATTTTCTAAAGCAAGTCCTATGG - Intergenic
1030328123 7:108243461-108243483 ATTTTCCAAGGTAAAGTACAAGG - Intronic
1034110801 7:148536030-148536052 ATTTTCCAAAATGAGATCTAGGG + Intergenic
1035226496 7:157436204-157436226 ATTTTCGTATGTAACTTCTACGG + Intergenic
1036404193 8:8440555-8440577 AGTTTCAAAGGTAAGCTCTGAGG + Intergenic
1036933173 8:12976061-12976083 ATTTTCCAAGTCTAGTTCTCTGG - Intronic
1037313684 8:17581453-17581475 GTTTTCAAAGGTAGGTGCTATGG + Intronic
1037678023 8:21068667-21068689 ATTTTTCAAGGTAAGTGAAATGG + Intergenic
1038935576 8:32246623-32246645 ATTTTTCAAAGTAATTTTTAAGG - Intronic
1040825518 8:51616379-51616401 TCTTTCGAAGGTAAGTTGTAGGG - Intronic
1041355632 8:56996657-56996679 ATTTTCCAGGGTAAATTTGAAGG - Intergenic
1043076801 8:75711464-75711486 ATTTTGCATTGTAATTTCTAGGG - Intergenic
1044790051 8:95837911-95837933 ATTTTCCAAAGTATGTTCTGTGG + Intergenic
1044914602 8:97099065-97099087 ATTTTCCAAGATGAGTTTTCTGG + Intronic
1045407150 8:101878318-101878340 ATCTACCAATGTAATTTCTATGG - Intronic
1046523828 8:115359182-115359204 AATTTCCAAGACAAGTTCTCTGG + Intergenic
1046675814 8:117107011-117107033 ATTTATCAAGGAAAGTGCTATGG - Intronic
1046905056 8:119563569-119563591 ATTTGCCAAAGGAAGTACTAAGG + Intronic
1049915577 9:314716-314738 TTTCTCCAAAGAAAGTTCTATGG + Intronic
1050630878 9:7557187-7557209 ATTTTTCAATGTGAGTGCTATGG - Intergenic
1051001312 9:12286046-12286068 GTTTGCCAAGGGAATTTCTAAGG - Intergenic
1051599167 9:18854948-18854970 ATTTTCCAGGGTAAGTCTCAGGG + Intronic
1055299683 9:74870113-74870135 ATTTCCCAAAGTAGGTTCTACGG + Intronic
1055349719 9:75373890-75373912 AATTTCAAAGGTAAGGTGTAGGG - Intergenic
1055566321 9:77572235-77572257 GTTTTCCAAGAAAAGATCTAAGG + Intronic
1055694184 9:78865130-78865152 ATTTTTTAAGCTAAGTTCTATGG - Intergenic
1056092876 9:83221546-83221568 GTTTTCCAAAGTATGTTCTGTGG - Intergenic
1056238778 9:84622734-84622756 ATTTCCCAGGGTAAGTGGTAGGG + Intergenic
1056847133 9:90049445-90049467 ATTTTCTAAGGTTTGTTTTATGG + Intergenic
1059827473 9:118047308-118047330 ATTTCCCAAAGTATATTCTAGGG + Intergenic
1186171211 X:6879021-6879043 ATTTTCCATGGTCAGTTTCATGG + Intergenic
1186591867 X:10939141-10939163 ATTTCCCAAAATGAGTTCTATGG - Intergenic
1187625083 X:21102349-21102371 ATTTTTCAACATAAGTTTTATGG + Intergenic
1187872375 X:23775323-23775345 ATTTCAGAAGCTAAGTTCTAGGG + Intergenic
1187873268 X:23781927-23781949 ATTTTCGAAGGTAAGGTCTTTGG - Intergenic
1188399078 X:29722290-29722312 ATTTTTCAAGTAAAGTTTTAAGG - Intronic
1188860944 X:35255072-35255094 ATTTACCAAGGTTTGTTTTATGG - Intergenic
1191589290 X:62863222-62863244 ATTATCCAAGGAAATTTCTCCGG + Intergenic
1191786788 X:64924849-64924871 ATTCTCCAAGCTATGTTTTAGGG - Intronic
1192284969 X:69725936-69725958 ATTTTCCAGTGTAAGTGATATGG + Intronic
1192319543 X:70078478-70078500 ATTTTCCAAGGTGGCTTCAAAGG - Intergenic
1193242953 X:79194440-79194462 AATCTCCATGGTAACTTCTAAGG - Intergenic
1194901375 X:99515630-99515652 ATTTTCCAAGGTTAAAACTAAGG + Intergenic
1195065865 X:101237536-101237558 TTTTTCCAAACTAAGTTATATGG - Intronic
1195831102 X:109059800-109059822 ATTTTCCAGGATAAGCTGTATGG - Intergenic
1197517887 X:127458885-127458907 ATTTTTCAAAGTAAGTAGTATGG + Intergenic
1197518744 X:127471833-127471855 TTTTTTCAAGGTAAGTTACATGG - Intergenic
1198155203 X:133953037-133953059 GTTTTCCAAGGTGAGTTCTGGGG - Exonic
1198607650 X:138360214-138360236 ATTTTGGAAGGTAAGATCTATGG + Intergenic
1199011423 X:142763457-142763479 ATTTTAAATGGTAAATTCTATGG - Intergenic
1199359751 X:146904959-146904981 ATTTCCCAAGGTATATTCTGAGG + Intergenic
1199727936 X:150603463-150603485 AGTTTCCTAGGTAAGTGATAAGG + Intronic
1200300592 X:154970722-154970744 AGTTTCAAAGCTAAGTTCAAGGG + Intronic
1200690241 Y:6301330-6301352 AATTTCTAAGCTAATTTCTAAGG + Intergenic
1201045032 Y:9873386-9873408 AATTTCTAAGCTAATTTCTAAGG - Intergenic