ID: 922284851

View in Genome Browser
Species Human (GRCh38)
Location 1:224161752-224161774
Sequence CAGACACAACAGAAGAAATC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 406}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922284851_922284855 28 Left 922284851 1:224161752-224161774 CCAGATTTCTTCTGTTGTGTCTG 0: 1
1: 0
2: 0
3: 19
4: 406
Right 922284855 1:224161803-224161825 TGGTAATCTATTAGGTCCATTGG 0: 1
1: 0
2: 0
3: 4
4: 73
922284851_922284853 8 Left 922284851 1:224161752-224161774 CCAGATTTCTTCTGTTGTGTCTG 0: 1
1: 0
2: 0
3: 19
4: 406
Right 922284853 1:224161783-224161805 CATGACATTTAGAAGTATATTGG 0: 1
1: 0
2: 2
3: 16
4: 208
922284851_922284854 20 Left 922284851 1:224161752-224161774 CCAGATTTCTTCTGTTGTGTCTG 0: 1
1: 0
2: 0
3: 19
4: 406
Right 922284854 1:224161795-224161817 AAGTATATTGGTAATCTATTAGG 0: 1
1: 0
2: 1
3: 21
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922284851 Original CRISPR CAGACACAACAGAAGAAATC TGG (reversed) Exonic
902057975 1:13618233-13618255 AAAACAAAACAGAAAAAATCAGG - Intergenic
902293279 1:15448797-15448819 CATACACAAAAGAAGATAGCTGG - Intronic
902528709 1:17076563-17076585 CACACACAAAAAAAGAAATGAGG - Intronic
902995661 1:20222911-20222933 CAGAAACAAGAGGAGAAAACTGG - Intergenic
904726158 1:32549914-32549936 CAGCCAAAACAGAAGAAAGATGG + Intronic
904870998 1:33618166-33618188 AAAACACAACAGGAGAAATAAGG - Intronic
905287339 1:36890048-36890070 CAGACACAACAGCAGAGAGAGGG + Intronic
907063341 1:51453521-51453543 CACACACACCAAAAAAAATCTGG + Intronic
907329485 1:53661787-53661809 CAGACACAACACTACAGATCAGG + Intronic
907996069 1:59633957-59633979 CAGAAACAAGAGAACAAATGAGG + Intronic
908551771 1:65215471-65215493 AAGACTCAAAAGAAAAAATCAGG - Intronic
909625918 1:77715904-77715926 CAAAAACAACAGAAGAAAGGAGG + Intronic
910084679 1:83385377-83385399 CAGTCAAAACAGAAGGCATCAGG + Intergenic
910680161 1:89854822-89854844 CAGACACAACTGCAGACACCTGG - Intronic
911081638 1:93938796-93938818 AAGACACACTAGAAGAAATCTGG - Intergenic
911189601 1:94934390-94934412 CAGTCACAACAGGATAAATACGG + Intergenic
911301484 1:96179725-96179747 CAGACACATCCAAACAAATCAGG + Intergenic
911338829 1:96612996-96613018 CTGACAAAAAAGAAGAAATGGGG - Intergenic
912256766 1:108067602-108067624 CAGTCACAACAGAAGCTCTCTGG + Intergenic
912750855 1:112286137-112286159 CAAACAAAAAAAAAGAAATCAGG + Intergenic
913538664 1:119798042-119798064 CAGACAGAAGGGAAGAACTCAGG + Intronic
914955274 1:152156296-152156318 CAGACAAATCAACAGAAATCAGG - Exonic
915159462 1:153907392-153907414 CAGACACAAAAGGACAAATGTGG + Intronic
915794363 1:158712287-158712309 TAGAGAAAACAGAAGAAATTTGG - Intergenic
915796054 1:158734770-158734792 CAAACACAGCATTAGAAATCAGG - Intergenic
915838445 1:159196859-159196881 CAGACAAATCAGAAGAGCTCAGG - Intronic
917610264 1:176682198-176682220 CAGACTCCACAGAAACAATCTGG - Intronic
918969322 1:191394085-191394107 CAGACACAAAAGGACAAATATGG + Intergenic
918999183 1:191806744-191806766 ATTACACAACAGAAGCAATCAGG + Intergenic
919071168 1:192756714-192756736 CAGACACAAGACAAGCAAGCTGG - Intergenic
920994448 1:210975476-210975498 CTGACAAAAAAGAAGAAATGGGG + Intronic
920995196 1:210983535-210983557 CTGACAAAAAAGAAGAAATGGGG - Intronic
921364865 1:214364284-214364306 CAGATAAAACAGGAGAAATGAGG - Intronic
922284851 1:224161752-224161774 CAGACACAACAGAAGAAATCTGG - Exonic
923536286 1:234854570-234854592 CAAACCAAACAGAAGAAAACAGG + Intergenic
923872534 1:238011467-238011489 CACAGAAAGCAGAAGAAATCTGG - Intergenic
924556561 1:245123880-245123902 CAGACAGAAAAAAAGAAACCTGG - Intronic
1063817547 10:9793078-9793100 CAGAGACATAAGAGGAAATCAGG + Intergenic
1064319520 10:14290523-14290545 CACACACAAAAGAATAAAACTGG + Intronic
1065519598 10:26558798-26558820 CAGAAACAACAGAAGCAATGAGG + Intronic
1065666387 10:28066767-28066789 CAGACACAAGAGAATGAATGAGG - Intronic
1065998316 10:31080510-31080532 TAGAGGCAACAGAAGAATTCAGG - Intergenic
1067219211 10:44331034-44331056 CACACACAAGGGAAAAAATCTGG + Intergenic
1070708046 10:78656033-78656055 AAGAAACAAAAGAAGAAATCTGG - Intergenic
1070949056 10:80416414-80416436 CAAGCACATCAGAAGAAATGTGG + Intronic
1072273047 10:93795987-93796009 CAGAGACAGCTGAACAAATCTGG - Intronic
1074624982 10:115173061-115173083 CTGAGAAAACAGAAGTAATCAGG + Intronic
1075359156 10:121814065-121814087 CAAACACAACAGAAAAAAATGGG + Intronic
1075477225 10:122746423-122746445 CAACCTCATCAGAAGAAATCTGG + Intergenic
1076020011 10:127064987-127065009 CAGACACAAAAGGACAAATGTGG - Intronic
1078192522 11:9103737-9103759 CAGTGACCACAGAAGAAAGCGGG - Intronic
1078260340 11:9700837-9700859 GAGACAGAACAGAAGAAAACTGG - Intronic
1078728493 11:13954546-13954568 GAGAAACAACAGAGGAAATGAGG - Intergenic
1079962275 11:26939609-26939631 AAGCCACATCAGAAGAAATAAGG + Intergenic
1080126438 11:28740020-28740042 CAGTCACAACACAAGTAATTTGG + Intergenic
1080134716 11:28841332-28841354 CAGACAGAACAAAAAAAATGGGG - Intergenic
1080181275 11:29429297-29429319 AAGAGATAACAGAAGAAATTAGG - Intergenic
1080225691 11:29957557-29957579 CAGAGACACCAGGAGAAACCGGG - Intergenic
1080258194 11:30316794-30316816 CAGACACAAAAGAATATATGTGG + Intergenic
1080656531 11:34262964-34262986 CAGCCACAGGAGACGAAATCAGG + Intronic
1081907631 11:46679619-46679641 CAGGCCCAACAGAAGAGATGGGG + Intronic
1083294440 11:61707565-61707587 CAGACACACCAGAAGCATGCAGG + Intronic
1084143798 11:67252431-67252453 CAAACACTCCAGAATAAATCAGG + Intronic
1084735366 11:71102064-71102086 CAGGCACCACAAAAGAGATCTGG - Intronic
1084835681 11:71800470-71800492 GAGACTCCAAAGAAGAAATCAGG + Exonic
1084897901 11:72288496-72288518 AAAACAAAACAAAAGAAATCTGG + Intergenic
1085683136 11:78596753-78596775 CAGAAGAAACAGAACAAATCAGG - Intergenic
1086506191 11:87507268-87507290 CGCACACAACAGAACAAAGCTGG - Intergenic
1086526674 11:87735702-87735724 CAAACAAAACAAAACAAATCTGG + Intergenic
1086762361 11:90648269-90648291 CAGACAATATAGAAGAAATAAGG + Intergenic
1087080026 11:94161740-94161762 CACCAGCAACAGAAGAAATCTGG - Intronic
1087257018 11:95967479-95967501 CACACACAAAAGAAGAAAGAAGG - Intergenic
1088299995 11:108347631-108347653 CAGATTCAAAAGAAGGAATCAGG + Intronic
1089062759 11:115639516-115639538 CAGACACTCCAGAAGACAGCTGG - Intergenic
1090775767 11:129964082-129964104 GAGACACCACAGAAGAGATGTGG + Intronic
1091638657 12:2217149-2217171 CAGACACAAAAGGAGAAATATGG + Intronic
1092036682 12:5341826-5341848 CACACACAAGAGAAGAAAAGTGG - Intergenic
1092407646 12:8231933-8231955 GAGACTCCAAAGAAGAAATCAGG - Intergenic
1093669297 12:21853708-21853730 TAGAAACAACTGAAGAAAACTGG + Intronic
1093829093 12:23733642-23733664 TAGATACAATAGGAGAAATCTGG + Intronic
1094150407 12:27276384-27276406 AAGACACAACTGCAGAAATCTGG + Intronic
1094733975 12:33211203-33211225 GAGACAGAATAAAAGAAATCAGG + Intergenic
1099129712 12:78811858-78811880 CACTCACAACAGAAGGAATAAGG + Intergenic
1099231940 12:80036853-80036875 CATACAAAACAGAAGAATTCTGG - Intergenic
1099532004 12:83793993-83794015 TTGAAACAAGAGAAGAAATCAGG - Intergenic
1099613604 12:84908400-84908422 CAGAAACAACAACAAAAATCAGG + Intronic
1099830971 12:87842308-87842330 CATACACAGAAGAAGAAAACAGG + Intergenic
1101028278 12:100635225-100635247 TAGCCACAACAGAAGAAAAAGGG - Intergenic
1101556990 12:105819292-105819314 CACTGACAACAGAAGGAATCAGG - Intergenic
1102910323 12:116708665-116708687 CACACACAAAAGAAGAATGCTGG + Intergenic
1103217060 12:119209849-119209871 CTGACACAAAAGAACAAATATGG - Intronic
1104087437 12:125489220-125489242 CTGACAAAATATAAGAAATCAGG + Intronic
1104165813 12:126228807-126228829 TAGATACAGCAGAAGAAAACAGG - Intergenic
1104954813 12:132459085-132459107 CACACAAAACTGGAGAAATCGGG - Intergenic
1105495093 13:20923489-20923511 CAGACACAACAGCTGCACTCTGG + Intergenic
1106214084 13:27678748-27678770 CAGACACAACTGCAGCAAACTGG - Intergenic
1106500048 13:30319399-30319421 GAGAGCCGACAGAAGAAATCTGG + Intergenic
1106737375 13:32601484-32601506 AAGAGACAACAGTAGAAATATGG - Intronic
1107537087 13:41346177-41346199 CACACACAAAAGAATGAATCTGG - Intronic
1107537223 13:41347234-41347256 CAAAAACAAAAAAAGAAATCAGG + Intronic
1107989058 13:45801284-45801306 CAGAAACAATAGAGGAACTCTGG + Intronic
1108288308 13:48930857-48930879 CAGACACAGAAGAATAAACCTGG + Intergenic
1108473372 13:50789262-50789284 CAGAACCAACATAAGAACTCGGG - Intronic
1108619320 13:52165868-52165890 CAGAAACATCAGGAGAAAGCTGG - Intergenic
1108640081 13:52375289-52375311 CAGAAACATCAGGAGAAACCTGG - Intergenic
1108939778 13:55938521-55938543 GGGACCCAACAGAATAAATCAGG + Intergenic
1109131474 13:58591828-58591850 AAGACAAAAGAGAAGAAAACTGG + Intergenic
1109301225 13:60592201-60592223 CATAAACATTAGAAGAAATCAGG + Intergenic
1111187425 13:84757125-84757147 CAGACAAAAGAGAAAAACTCAGG - Intergenic
1111232890 13:85366933-85366955 CAGAAACAACAGAAGGAGACGGG - Intergenic
1111880137 13:93945578-93945600 CAGAGACAACAAAAAAAATAGGG + Intronic
1112035641 13:95493858-95493880 CAGACACAAAAGGACAAATATGG - Intronic
1112489147 13:99846526-99846548 CAGACACGAATGAAGAAATCAGG - Intronic
1112668695 13:101609599-101609621 CAAACACAAGAGGAGAAATAAGG - Intronic
1112783677 13:102928967-102928989 ATGACACAGCAGCAGAAATCAGG + Intergenic
1113100192 13:106709400-106709422 ATGACACCACAGAAGGAATCTGG + Intergenic
1113109736 13:106810245-106810267 CAGGCACAACAGAGTTAATCTGG - Intergenic
1113216759 13:108049899-108049921 CAGACAGAATAGTAAAAATCAGG + Intergenic
1113340900 13:109424802-109424824 GAGAAAGAACAGGAGAAATCTGG + Intergenic
1113385981 13:109848494-109848516 CAAAATCAAAAGAAGAAATCTGG - Intergenic
1113873136 13:113576104-113576126 CAGACACAAAAGGACAAATATGG - Intergenic
1114617954 14:24078143-24078165 CACACACACCATAAGAAATGAGG + Intergenic
1115010149 14:28536651-28536673 CAGAACCAACATAAGAACTCAGG - Intergenic
1115267568 14:31516726-31516748 CAGACACAGAAGAAGATATGAGG - Intronic
1115839950 14:37458976-37458998 GAGACACAACATACCAAATCTGG + Intronic
1116663135 14:47738163-47738185 CAGAACCAACAGAAAATATCAGG - Intergenic
1116979852 14:51157027-51157049 CATACACAAAATAAGAAAACAGG - Intergenic
1117435997 14:55715776-55715798 CAGACAAAAGAGAAGAGATGGGG - Intergenic
1119965734 14:78913759-78913781 AAGAGAAAACAGATGAAATCTGG + Intronic
1120139803 14:80916109-80916131 CAGCCACAAGATAAGAAATGTGG + Intronic
1120534804 14:85681357-85681379 CATATACAACAGAATAAATTGGG - Intergenic
1121099158 14:91238012-91238034 CAGACACAAAAGGACAAATACGG - Intronic
1122764909 14:104061642-104061664 CACACAAATCAGAAGAAAGCTGG - Intergenic
1124241611 15:28032919-28032941 AAGACCAAACAGAACAAATCAGG + Intronic
1125899548 15:43332167-43332189 CAGAGAAAACAGAAGCCATCAGG - Intronic
1125911282 15:43441996-43442018 CAAACAAAAAACAAGAAATCTGG - Intronic
1129912276 15:79238286-79238308 AAGACAAAATAGAAGAAAGCAGG - Intergenic
1130608670 15:85340447-85340469 CAGAAACAGGAGAAGAAAACAGG + Intergenic
1131548403 15:93334837-93334859 CAGTCACCACAGCAGAAACCTGG + Intergenic
1131953725 15:97709164-97709186 CAAACACACCAGAAGAAAGCTGG + Intergenic
1132401966 15:101515664-101515686 CAGACACAAAAGGACAAATATGG - Intronic
1135514221 16:23116222-23116244 CAAAAAAAACAGAAGAACTCAGG + Intronic
1138612887 16:58141471-58141493 CAAACACAATAGAATTAATCAGG - Intergenic
1139130538 16:64137995-64138017 CATACAAAACAGAAGTAATTGGG + Intergenic
1139182898 16:64769095-64769117 AAGACACAACCCAAGAAACCTGG + Intergenic
1139228764 16:65260033-65260055 AAGAAACATCATAAGAAATCTGG - Intergenic
1140125161 16:72112387-72112409 GAGACACAGCAGGAGAGATCAGG - Intronic
1141838520 16:86559225-86559247 CAGACACTGCATAAGAAATGGGG - Intergenic
1143127031 17:4648836-4648858 GAGACAGAAATGAAGAAATCTGG + Intergenic
1145111495 17:20166640-20166662 AAGAAACAACAAAAGAAATCTGG + Intronic
1145276529 17:21434675-21434697 CAGAAACAAGTGAAGAAACCTGG - Intergenic
1145314370 17:21720568-21720590 CAGAAACAAGTGAAGAAACCTGG - Intergenic
1145712825 17:26992544-26992566 CAGAAACAAGTGAAGAAACCTGG - Intergenic
1146372082 17:32271107-32271129 CTGAATCAACAGAAGGAATCAGG - Intronic
1149886640 17:60347058-60347080 CAAAGAGAACAGAACAAATCTGG + Intronic
1150635286 17:66908841-66908863 CAGACACAATGTAAGAAATTGGG + Intergenic
1150988933 17:70232462-70232484 CAGACACAAAAGGAAAAACCTGG - Intergenic
1151760322 17:76098022-76098044 CACAGACAACAGAAGGAAGCAGG + Intronic
1152976778 18:228670-228692 TAGACATGACAGAAGAAATATGG - Intronic
1153147081 18:2045717-2045739 AAGACACAACAGTAGAAAGTGGG - Intergenic
1153177875 18:2399428-2399450 AAGACAAAACAGAAGGATTCTGG + Intergenic
1155313358 18:24546322-24546344 TGGACACAACAGCAGAAATATGG + Intergenic
1155782805 18:29859320-29859342 GAGATACAACAAAAGAAAACAGG - Intergenic
1157489816 18:48115168-48115190 CAGTCACAAAAGAACAAATATGG - Intronic
1158245549 18:55428573-55428595 CAGAAACTAAAGAAGAAATGAGG + Intronic
1158289015 18:55917828-55917850 CAGACAGAAAAGAAGGAATTTGG + Intergenic
1158507149 18:58056964-58056986 GAGACACAACAGAAGATTTAAGG - Intronic
1158909615 18:62047133-62047155 CAAACACCACAGAAAAAATGTGG + Intronic
1159879895 18:73848783-73848805 CTAAGACAACAGAAGAAATCAGG + Intergenic
1159994294 18:74948004-74948026 CAAACACAACAGCAGAACCCAGG + Intronic
1160547307 18:79668043-79668065 TATACACAAAAGAAGAAAACAGG + Intergenic
1160890305 19:1374183-1374205 CAGACTCAAAAAAAAAAATCAGG - Intronic
1163138167 19:15328705-15328727 AAGATACAACAGAATAAAACAGG + Intronic
1163312189 19:16521307-16521329 GAGACACATCAGAAGAAGTTAGG - Exonic
1163983318 19:20922197-20922219 CCCACACCACAGAAGAAAACAGG + Intergenic
1163993190 19:21018547-21018569 CACACACCACAGGAGAAAACAGG + Intergenic
1164133889 19:22393561-22393583 CTGACAAAACACAAGAAATGGGG + Intronic
1164164919 19:22663199-22663221 CTGACAAAACACAAGAAATGGGG - Intronic
1164499231 19:28800306-28800328 CTGACACAAGAATAGAAATCTGG - Intergenic
1165752214 19:38267294-38267316 CGGAGAAAACAGAAGCAATCAGG - Intronic
1166350155 19:42194002-42194024 CAGACACAACAGCAAACATATGG + Intronic
1166891062 19:45993591-45993613 CTTACACAACAGAAGCATTCCGG - Intergenic
925819036 2:7780898-7780920 CAGACACAAAAGAATACATATGG - Intergenic
925860911 2:8174405-8174427 CAAACACCACAGAAAAAATGGGG + Intergenic
926145009 2:10391704-10391726 CAGACACAAAAGGACAAATGTGG - Intronic
926497902 2:13614580-13614602 CAGAAAAACCAGAATAAATCAGG - Intergenic
926871666 2:17425515-17425537 CAGACACAAGACAAGGAATTAGG - Intergenic
927300834 2:21512268-21512290 CATACACAAAATAAGAAAGCAGG + Intergenic
927571641 2:24165513-24165535 CAGAGACAACAGCAGACAACAGG - Intronic
928715722 2:34057455-34057477 CAGCCACATCATAAGAAATTTGG - Intergenic
929307933 2:40386788-40386810 AAGCCACAAAAGAAGAAAACTGG - Intronic
929332431 2:40699625-40699647 CAGACACTTCAGAAGAAAAATGG - Intergenic
929799340 2:45085906-45085928 CAAAAACAACAGAACAAAACAGG + Intergenic
930627307 2:53712159-53712181 CAGACACAGCAGAAAAAAATAGG + Intronic
931838184 2:66121793-66121815 CAGAATCAACACAAGAATTCAGG + Intergenic
932233254 2:70100244-70100266 CATATGCAACAGAACAAATCTGG - Intergenic
932896453 2:75645527-75645549 CACACACAAAAAAAGAAATTTGG - Intergenic
933311656 2:80668456-80668478 CATACAGAACAGAAGAAAGATGG - Intergenic
934095940 2:88604107-88604129 CTGAAACAACAGCAGAAATTGGG - Intronic
936294072 2:111251875-111251897 CAGAAACCACAGAAGTCATCTGG - Intergenic
937157108 2:119728837-119728859 CAGACAAAAAAGAAGAAAATTGG - Intergenic
938326970 2:130414110-130414132 CAGACACTAGAGAAGAATTTGGG - Intergenic
938362973 2:130707366-130707388 CAGACACTAGAGAAGAATTTGGG + Intergenic
938691985 2:133800269-133800291 CAGACACCACAGAGGATATTAGG + Intergenic
938874839 2:135521568-135521590 CAGACACTACAGAAGGTATTGGG + Intronic
938966128 2:136390155-136390177 CAAAAAGAACAGAAGAAATGAGG - Intergenic
939143910 2:138389800-138389822 CAGACAGAATAAAAGATATCTGG - Intergenic
940847245 2:158655398-158655420 CAGAAACAACAAAAAAAAACAGG + Intronic
941027198 2:160469857-160469879 TAGACACAACAGTGAAAATCAGG + Intronic
943073416 2:183168208-183168230 CAGAGACAAATAAAGAAATCAGG - Intergenic
943340340 2:186673115-186673137 CACACACAAAAGAATCAATCTGG - Intronic
943520020 2:188937469-188937491 CAAAAAAAACAGAAGAACTCAGG + Intergenic
944288936 2:197982480-197982502 CAGACAGAAGGGAAGAGATCGGG - Intronic
944932967 2:204539275-204539297 AAGACACAACAGTAGAAAACAGG - Intergenic
944939283 2:204605935-204605957 CAGACAGCACAGAAGACAACTGG - Intronic
945272837 2:207958997-207959019 CCGAGACAAAAGGAGAAATCAGG + Intronic
945307700 2:208274481-208274503 CAGCCACACCAGACGAGATCTGG - Intronic
945406102 2:209451014-209451036 CATACCCAGCAGAAGAAATAAGG - Intronic
946595704 2:221303530-221303552 CAGAGACAAGAGAAGAACCCAGG - Intergenic
946998527 2:225425190-225425212 CAGCTACAAGAGAAGGAATCAGG + Intronic
948527979 2:238584868-238584890 CAGACACATCTGCAGGAATCAGG - Intergenic
948777068 2:240294818-240294840 CAGCCACAAAAGAAGAAATTTGG - Intergenic
1169482122 20:5992991-5993013 TAGAGAAAGCAGAAGAAATCTGG + Intronic
1169658032 20:7947418-7947440 CAGACACAACAGAAATAAAAAGG - Intergenic
1170542695 20:17405029-17405051 AGGACACAACAGGAGAAGTCAGG + Intronic
1170672255 20:18445156-18445178 CACACACATCAAAAGAAAGCAGG + Intronic
1171335841 20:24384704-24384726 GAGACAGAACAGTAGAACTCTGG - Intergenic
1173033863 20:39389948-39389970 CACACACAAAAAAAGAAATTGGG - Intergenic
1173042628 20:39478647-39478669 AACACCCAACAGATGAAATCAGG + Intergenic
1174001309 20:47376827-47376849 AAAACAAAAAAGAAGAAATCTGG + Intergenic
1174261211 20:49296697-49296719 AAGACAGAAAAGGAGAAATCTGG + Intergenic
1174311924 20:49663100-49663122 CAGACACAAAAGAACACATGTGG + Intronic
1174479152 20:50818756-50818778 CAGAGAGAACAGAAGGATTCAGG - Intronic
1174642364 20:52055630-52055652 AAGGGACAACAGAAGATATCTGG + Intronic
1174954497 20:55082110-55082132 CAGAGACAACAGAGAAAATGTGG - Intergenic
1174996071 20:55569783-55569805 CATGCACAACAGAAGAAAATAGG - Intergenic
1175285793 20:57836033-57836055 CACACAGCACAGAAGACATCCGG - Intergenic
1175940131 20:62533946-62533968 CAGCCACAAGAGAAGGAAACCGG + Intergenic
1177058549 21:16340674-16340696 GAGACACAACAGAAGATAGTGGG - Intergenic
1180897372 22:19346719-19346741 GAGAGAGAACAGGAGAAATCTGG - Intronic
1181620761 22:24089662-24089684 CAGACAGAAAAGTAGCAATCAGG - Intronic
950637698 3:14326780-14326802 CAGATACAAAAGAAGGTATCTGG + Intergenic
951329603 3:21350202-21350224 CAGACAAATTAGAAGAATTCTGG + Intergenic
951514039 3:23538163-23538185 CATAGGCATCAGAAGAAATCTGG - Intronic
951771997 3:26268524-26268546 GAGACAAAGCAGTAGAAATCAGG - Intergenic
951996006 3:28729783-28729805 CAGGTACAATAGAAGAAATTTGG - Intergenic
953325716 3:42010883-42010905 CTGGCACTACAGAACAAATCAGG + Intergenic
954121210 3:48501215-48501237 CAGGTACCACAGCAGAAATCTGG + Exonic
954287337 3:49628408-49628430 CAGAAACAGCAGATGAGATCTGG + Intronic
956154950 3:66285781-66285803 CAGAAACACCAGAATACATCTGG - Intronic
956578199 3:70779518-70779540 CAGAGCCAACAGATGAAATAAGG + Intergenic
957052697 3:75422304-75422326 GAGACTCCAAAGAAGAAATCAGG - Intergenic
957089068 3:75710309-75710331 TAGACACAAAAGAAGAAGACAGG - Intronic
958825012 3:99019865-99019887 CAGACTATACAGAAGAAATATGG + Intergenic
959155580 3:102663121-102663143 GGGACACAACAGAAGAGATTTGG + Intergenic
960059847 3:113309982-113310004 CAAACACCACAGAAAAACTCTGG + Intronic
960469653 3:118046952-118046974 CAGACACAAAAGAAAAAAAAGGG + Intergenic
960495815 3:118373779-118373801 TAGACATAAAAGAAGAAATAAGG + Intergenic
961886310 3:130098528-130098550 GAGACTCCAAAGAAGAAATCAGG - Intronic
962364707 3:134770824-134770846 CAGACGCAAGAGGAGAACTCAGG - Intronic
962609693 3:137064168-137064190 CAGACGCAACACCAGAGATCTGG + Intergenic
963856048 3:150255063-150255085 TAGAACCAACAGAAGAATTCAGG - Intergenic
964139820 3:153384835-153384857 CAGAAAAAACAGAAGCAAGCAGG + Intergenic
965049224 3:163622801-163622823 CAAACACAACAGAAAAACTGTGG - Intergenic
966143254 3:176780978-176781000 CAGACAAAACAGAAGGAAATGGG + Intergenic
966578090 3:181526111-181526133 CACACTCATCAGAAGAAAGCTGG + Intergenic
967161423 3:186742005-186742027 CAGACACAAGAGAAGACAGAAGG + Exonic
968347635 3:198024120-198024142 CAGACACAAGGGAATAAAACTGG - Intronic
969580850 4:8064107-8064129 CACACAGAACAAAGGAAATCAGG - Intronic
969758490 4:9166111-9166133 GAGACTCCAAAGAAGAAATCAGG + Intergenic
970645046 4:18110049-18110071 CAGAAACAAAAGCAGAATTCGGG + Intergenic
970735781 4:19165870-19165892 CAGACAAATCAGAAGGAGTCTGG + Intergenic
972315825 4:37924621-37924643 CAGACACAGAAGGAGAAATATGG - Intronic
972685486 4:41348599-41348621 CAGACACCAAAGTAGAAATTAGG - Intergenic
973034554 4:45390180-45390202 AAGAAACAACACAAGAACTCTGG - Intergenic
973129691 4:46635567-46635589 CAGAACCAACACAAGAACTCTGG - Intergenic
974133229 4:57782535-57782557 CAGACACAATAAAATAAAGCTGG - Intergenic
974186284 4:58451352-58451374 CAAACACAAGGGAAGAAAGCAGG - Intergenic
974550086 4:63361116-63361138 CAGCCACAACAGAAAGAAACAGG - Intergenic
975030038 4:69603539-69603561 CACACGCAACAGAACAAAACTGG + Intronic
975397694 4:73896072-73896094 CAGAAAGAAGAGAAGAAAACAGG + Intergenic
976336577 4:83894767-83894789 AAGACCCAATAGAAGAAAGCTGG - Intergenic
978731814 4:112036852-112036874 CAGACAAAATAAGAGAAATCTGG - Intergenic
979714574 4:123822212-123822234 CTGAAAGAAAAGAAGAAATCTGG - Intergenic
982542313 4:156689268-156689290 CAGACACCACTGAAGACATTTGG + Intergenic
983045228 4:162979112-162979134 TAGACAAAACATAAGAAAACAGG + Intergenic
983073207 4:163293614-163293636 TAAACACAACAGAAGAGATTAGG - Intergenic
983351085 4:166589255-166589277 TAAAAACAACAAAAGAAATCTGG - Intergenic
984007009 4:174324153-174324175 CAGACACAAAAGACTAAATATGG - Intronic
984278028 4:177633822-177633844 CAGACACCAAACAAGAACTCGGG + Intergenic
986220082 5:5760887-5760909 CAAACACAGAAGAAGAAAACAGG + Intergenic
986672493 5:10155085-10155107 CAGACACGACATAATAAACCTGG - Intergenic
987222214 5:15802404-15802426 CAGACACAAGGGTAGACATCTGG - Intronic
987779031 5:22408482-22408504 CAGGAGCAACAGAAGCAATCTGG + Intronic
988108751 5:26786712-26786734 CACACACAAAAAAACAAATCTGG + Intergenic
988241514 5:28615151-28615173 CAGGGACAAAAGCAGAAATCAGG + Intergenic
988371364 5:30371979-30372001 CAGACTCCTCAGAAGAAGTCTGG + Intergenic
989216557 5:38910043-38910065 CAAACAAAACAGAAAAAAGCAGG + Intronic
989480200 5:41922150-41922172 CAGACTTCAGAGAAGAAATCAGG + Intergenic
989772140 5:45157577-45157599 CTGCCACAACAGATGCAATCGGG + Intergenic
990324658 5:54662740-54662762 CATACACCACAGAATATATCTGG + Intergenic
991922085 5:71667132-71667154 CATACACAACTGGGGAAATCTGG + Intergenic
992333897 5:75745632-75745654 TAGACACAAAGGAGGAAATCGGG + Intergenic
992980443 5:82165273-82165295 CAGATACAAAAGGAGAAATAGGG - Intronic
994174193 5:96692950-96692972 CAGACACAAATGAAGAAAGGGGG + Intronic
995516462 5:112959288-112959310 AAGCCAAAACAGAAGAAAGCAGG - Intergenic
996372071 5:122763976-122763998 CAGTCACATCAAGAGAAATCAGG + Intergenic
997101469 5:130973918-130973940 CAGAGACTAGAGGAGAAATCAGG - Intergenic
997870797 5:137503688-137503710 CAGAACCATGAGAAGAAATCTGG - Intronic
999355437 5:150925432-150925454 AATACTAAACAGAAGAAATCTGG - Intergenic
1000004649 5:157172083-157172105 CTGAAAAAACAGAAGAAAACAGG + Intronic
1000382695 5:160643391-160643413 CAGCCACAACAGAGGAAACATGG - Intronic
1001334579 5:170786950-170786972 GAGACAAAAGAGAAGAAATGGGG + Intronic
1002802700 6:540556-540578 TAGACACAACTGAAGAAACAAGG + Intronic
1003631757 6:7793878-7793900 CAGACACATCAGCAGGCATCAGG - Intronic
1004548068 6:16618428-16618450 CAAACAAAACAAAAGAATTCAGG + Intronic
1005381670 6:25241249-25241271 CAAACAAAAAAGAAGAAATTGGG + Intergenic
1005431495 6:25762738-25762760 CAACCATCACAGAAGAAATCAGG + Intronic
1005980569 6:30833446-30833468 CAGACCCAATAGGAGAAATCAGG - Intergenic
1007148968 6:39668678-39668700 GAGGCAGAACAGAAGCAATCAGG - Intronic
1007756842 6:44104998-44105020 CAGAAAAAGCAGAAGAAATGTGG + Intergenic
1008036001 6:46745803-46745825 CTGGCAGAGCAGAAGAAATCAGG - Intergenic
1008757220 6:54810667-54810689 CAGTCACAAAAGAACAAATATGG - Intergenic
1009950664 6:70391923-70391945 CAGACATCCCTGAAGAAATCTGG - Intergenic
1009999338 6:70932533-70932555 CAGACACAAAAGTATAAATATGG + Intronic
1010189048 6:73175885-73175907 AAGAAAGAAAAGAAGAAATCTGG + Intronic
1010246652 6:73665942-73665964 CATACACAAAAGAAGCAAACAGG - Intergenic
1010864637 6:80959758-80959780 AAAACACAACAGAGGGAATCTGG + Intergenic
1011801339 6:91019428-91019450 TAGAGACAACAGAAAAAAGCAGG - Intergenic
1011899944 6:92280455-92280477 CAATCACAACAGAAGATATTAGG - Intergenic
1012461741 6:99470310-99470332 CATACACAGCAGAACAATTCTGG - Intronic
1013111252 6:107067185-107067207 CAGAGATAACAGAAACAATCTGG - Exonic
1013540722 6:111105794-111105816 CAGTCACAACAGAGCAATTCAGG - Intronic
1013631457 6:111989974-111989996 GACACACTTCAGAAGAAATCAGG + Intergenic
1014488214 6:122027890-122027912 CAGACAGAACAGAAGTGAGCAGG + Intergenic
1014504981 6:122243998-122244020 CAGACTTCTCAGAAGAAATCTGG + Intergenic
1014505297 6:122247728-122247750 TGGACACAAGAGAAGAACTCAGG - Intergenic
1015264987 6:131281885-131281907 GAAACACAACAGAAGAAAAATGG + Exonic
1015602952 6:134928230-134928252 CTGAGAAAACAGAAGAAATAAGG + Intronic
1015993281 6:138970847-138970869 CAGGCAGTAGAGAAGAAATCAGG + Intronic
1016421309 6:143886157-143886179 CAAACACTAAAGAAGATATCAGG - Intronic
1019027625 6:168983094-168983116 CAACCACAACAGAATAAAACTGG + Intergenic
1020824237 7:13007464-13007486 CAGAGACCACAGAAGGAATTTGG - Intergenic
1021817588 7:24463394-24463416 AAGGTATAACAGAAGAAATCAGG + Intergenic
1023245728 7:38201675-38201697 CAAACAAAAAAAAAGAAATCTGG - Intronic
1023291652 7:38674381-38674403 AAGAAACAACAGAAGGAATCTGG - Intergenic
1023704142 7:42922472-42922494 TAGACACAACAGAGGAAAATAGG + Intronic
1024207971 7:47179950-47179972 CAGAAAAAACAGAAAACATCTGG - Intergenic
1024290242 7:47798135-47798157 CAGTCAAAACAGAACAAAGCTGG + Intronic
1027301500 7:76841492-76841514 CAGTCAAAACAGAAGGCATCAGG + Intergenic
1027339779 7:77193593-77193615 TATACAAAACATAAGAAATCTGG - Exonic
1027742886 7:82034877-82034899 CATACACAAAAGAAGGAATATGG + Intronic
1028557758 7:92141457-92141479 CAGAGAGAAAAGAAGAAAGCTGG - Intronic
1028766286 7:94563579-94563601 CAGTCAAAACAGAAGACAACTGG - Intergenic
1030373884 7:108732110-108732132 CAGACACAACAGGACACATCAGG + Intergenic
1031788326 7:126064086-126064108 CAAACACAACAAAAGAAAAATGG + Intergenic
1032541690 7:132708211-132708233 CAGAAACTAGAGGAGAAATCTGG + Intronic
1032868004 7:135948428-135948450 CAGACACAAAAGAACAAAATGGG + Intronic
1033287244 7:140051999-140052021 CAGTCACAGCAGAAGTGATCAGG - Intronic
1034431287 7:151042461-151042483 CAGACTGAACAGAAGAAATGGGG + Intronic
1034607928 7:152334761-152334783 GAGACAAGACAGAAGAAACCTGG + Intronic
1034908331 7:154971051-154971073 CAAACACAGCAGCAGACATCAGG + Intronic
1035666997 8:1386640-1386662 CAGAAACGAGAGAAGAAACCTGG + Intergenic
1036012640 8:4744311-4744333 CACACACATCAGTAGAACTCAGG - Intronic
1036638568 8:10567880-10567902 CAGACACCACAGAGGGAATGGGG - Intergenic
1036848026 8:12182880-12182902 GAGACTCCAAAGAAGAAATCAGG - Exonic
1036869389 8:12425163-12425185 GAGACTCCAAAGAAGAAATCAGG - Intergenic
1037431048 8:18813544-18813566 CTGTTACAACAGAAGAATTCAGG + Intronic
1038418578 8:27416770-27416792 AAAACACAACAGAAAAAATGGGG + Intronic
1038680158 8:29659378-29659400 GAGATACAAAGGAAGAAATCTGG + Intergenic
1041124793 8:54624701-54624723 CAGAAGAAACAGAATAAATCTGG - Exonic
1041589142 8:59556576-59556598 CTGACATAATAGAAGAAAGCTGG + Intergenic
1043153680 8:76750569-76750591 CAGAAAGAAAAGAATAAATCTGG - Intronic
1043723891 8:83584254-83584276 AAGAAGCAACAGAAGAAATAAGG - Intergenic
1045676462 8:104613776-104613798 CAGAACCAGCACAAGAAATCTGG - Intronic
1046467530 8:114625845-114625867 CAGAGCAAAAAGAAGAAATCTGG + Intergenic
1048672354 8:136737098-136737120 CAGAAACAACAGTAAAAATGTGG - Intergenic
1049630023 8:143648807-143648829 ATGAGAAAACAGAAGAAATCAGG - Intronic
1049904705 9:205212-205234 CAGACACAAAAGAAAATATAGGG + Intergenic
1050444966 9:5711355-5711377 CAGACAAAACAGAAGCATTTAGG - Intronic
1050883432 9:10734098-10734120 GTGATACAACAGAAGAAATCAGG + Intergenic
1051234279 9:14982163-14982185 CAGACAAGATAGAAGAAATCTGG - Intergenic
1051488577 9:17635684-17635706 TGTACACAACAGAGGAAATCTGG + Intronic
1051591308 9:18778448-18778470 CAGAGACAACAGGAGATATTAGG - Intronic
1051654803 9:19369233-19369255 CAGGTACAACAGAAGGAACCTGG - Intronic
1051675716 9:19556370-19556392 CAGACAAAAAATAAGAAACCGGG - Intronic
1052199179 9:25757168-25757190 CAAATACCACAGAAGAAGTCTGG - Intergenic
1053317310 9:37063011-37063033 CAGACACAAAAGGACAAATACGG + Intergenic
1053630439 9:39932195-39932217 CATCCAAAACAGAAGAAAACTGG - Intergenic
1053775333 9:41531313-41531335 CATCCAAAACAGAAGAAAACTGG + Intergenic
1054169734 9:61827398-61827420 CCGACACAAGAGAACAAAGCTGG + Intergenic
1054213448 9:62318507-62318529 CATCCAAAACAGAAGAAAACTGG + Intergenic
1054667804 9:67753417-67753439 CCGACACAAGAGAACAAAGCTGG - Intergenic
1055468611 9:76590088-76590110 CAGACTCAACAAAACATATCAGG + Intergenic
1055793620 9:79950027-79950049 CAGTCACAACTGAAGAGACCAGG - Intergenic
1056444743 9:86655021-86655043 GAGACAAAACAGAAAAAAACAGG - Intergenic
1058090743 9:100802793-100802815 CACACCCAACCGAAGAAACCAGG - Intergenic
1058260152 9:102818075-102818097 CACACACAAAAGAAAATATCAGG + Intergenic
1058717187 9:107733276-107733298 AAAACACAACAGCAGAAAACGGG - Intergenic
1058720207 9:107757595-107757617 AAGACACATCTGTAGAAATCAGG + Intergenic
1203488524 Un_GL000224v1:81653-81675 TAGACACAAAAGAAGAAGACAGG + Intergenic
1203501145 Un_KI270741v1:23549-23571 TAGACACAAAAGAAGAAGACAGG + Intergenic
1186166805 X:6835153-6835175 CAGCCAGAACTGAAGAAATTGGG + Intergenic
1186580680 X:10814549-10814571 CAAGCAAAACTGAAGAAATCTGG - Intronic
1186606763 X:11100309-11100331 CAGACACCACCGAGGGAATCTGG + Intergenic
1187928508 X:24272618-24272640 CAGACACAGTAGAACAAATATGG + Intergenic
1188643453 X:32535284-32535306 CAGAAAGTACAGAAGAAATGTGG - Intronic
1189003184 X:36966995-36967017 CAGACCCTACAGAATGAATCTGG + Intergenic
1189450277 X:41122703-41122725 CAGACACAGGAAAAGAACTCGGG - Intronic
1190859882 X:54334462-54334484 CAGACACAAAAGGACAAATGTGG - Intronic
1191800309 X:65072362-65072384 CAGAAACAACATTAGAAATGTGG - Intergenic
1192001087 X:67152186-67152208 CTGACAAAAAAGAAGAAATGGGG - Intergenic
1193673030 X:84413236-84413258 AAGAACCAACACAAGAAATCTGG - Intronic
1193711922 X:84891483-84891505 CACACACAAAAAAAGAAATATGG - Intergenic
1193737990 X:85183728-85183750 TAATCACAACAGAATAAATCAGG + Intergenic
1194941960 X:100021294-100021316 CAGAAACAACAAAAAAATTCAGG + Intergenic
1195446232 X:104956110-104956132 GGGCCACAACAGAAGAGATCAGG - Intronic
1195931653 X:110083467-110083489 CAGAGAAAGCAAAAGAAATCTGG - Intronic
1197726614 X:129781003-129781025 CAAACCCAACCAAAGAAATCTGG - Intronic
1197784668 X:130187890-130187912 CAGACACTAAACAAGAAATGAGG + Intergenic
1198006749 X:132502803-132502825 CAGTAACAACAGACCAAATCTGG - Intergenic
1198858952 X:141048954-141048976 CTGACACAAAACAAGAAATGGGG + Intergenic
1198903745 X:141538435-141538457 CTGACACAAAACAAGAAATGGGG - Intergenic
1198916646 X:141679804-141679826 CTGACACAAAACAAGAAATGGGG - Intronic
1199098219 X:143767266-143767288 CAGCAACAACAGAACAAAGCTGG - Intergenic
1201279111 Y:12325744-12325766 CAAACACATCAGACGAGATCGGG - Intergenic