ID: 922287235

View in Genome Browser
Species Human (GRCh38)
Location 1:224181088-224181110
Sequence CTGCCAATCCAGATGAAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 2, 1: 0, 2: 0, 3: 11, 4: 171}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922287233_922287235 1 Left 922287233 1:224181064-224181086 CCAATTATCAGCTTCATGTGCCA 0: 2
1: 0
2: 1
3: 7
4: 132
Right 922287235 1:224181088-224181110 CTGCCAATCCAGATGAAACTTGG 0: 2
1: 0
2: 0
3: 11
4: 171
922287230_922287235 27 Left 922287230 1:224181038-224181060 CCTGAAAACTTCCTCCTGAGTTG 0: 1
1: 1
2: 2
3: 13
4: 169
Right 922287235 1:224181088-224181110 CTGCCAATCCAGATGAAACTTGG 0: 2
1: 0
2: 0
3: 11
4: 171
922287232_922287235 13 Left 922287232 1:224181052-224181074 CCTGAGTTGAGTCCAATTATCAG 0: 2
1: 0
2: 0
3: 6
4: 79
Right 922287235 1:224181088-224181110 CTGCCAATCCAGATGAAACTTGG 0: 2
1: 0
2: 0
3: 11
4: 171
922287231_922287235 16 Left 922287231 1:224181049-224181071 CCTCCTGAGTTGAGTCCAATTAT 0: 2
1: 0
2: 0
3: 10
4: 125
Right 922287235 1:224181088-224181110 CTGCCAATCCAGATGAAACTTGG 0: 2
1: 0
2: 0
3: 11
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922287235 Original CRISPR CTGCCAATCCAGATGAAACT TGG Intronic
903267284 1:22165397-22165419 CTGCCATTCAAGATGAGATTTGG + Intergenic
906759494 1:48362569-48362591 CTCACAATCCAGATGAGACAGGG + Intronic
906833356 1:49058231-49058253 CTACAATTCCAGATGAAATTTGG - Intronic
907487022 1:54785427-54785449 GTGCCAATCCAGAAGAGGCTGGG + Intronic
907789173 1:57645072-57645094 CTGTGGATCCAGATGAACCTTGG - Intronic
910815180 1:91284901-91284923 CTGCAAATCAAGATGAGATTTGG - Intronic
915444768 1:155968327-155968349 CTGTAAATCCCTATGAAACTTGG - Intronic
915483666 1:156204939-156204961 CTGCCATCCCAGCTGAGACTTGG + Intronic
916679420 1:167090431-167090453 CTGCCAATCCAGCTGAGGCTGGG - Exonic
917037981 1:170770310-170770332 CTGCTCTTCCAAATGAAACTGGG - Intergenic
919680934 1:200434047-200434069 ATCCCAATCCAGATGTAACCCGG + Intergenic
920317597 1:205089512-205089534 CTGCCATTCCAAATGACACCTGG - Intronic
922287235 1:224181088-224181110 CTGCCAATCCAGATGAAACTTGG + Intronic
922289491 1:224198655-224198677 CTGCCAATCCAGATGAAACTTGG - Intergenic
922682477 1:227612137-227612159 TTGCCCATCCAGATGTGACTTGG - Intronic
1063806769 10:9653716-9653738 CTACAAATCCAGATGAGATTTGG - Intergenic
1066587763 10:36956419-36956441 CTGCCAATTCAGTTGAAAATGGG + Intergenic
1068214528 10:53967047-53967069 CTGCAATTCAAGATGAAATTTGG - Intronic
1069679691 10:70275094-70275116 TTGCCAATCCAAATGATTCTTGG - Intronic
1071138408 10:82478775-82478797 ATGCCACGCCAGTTGAAACTTGG + Intronic
1072065296 10:91863215-91863237 ATGCCATTCCAGGTTAAACTGGG + Exonic
1074971303 10:118541607-118541629 TGGCCAATTCAGACGAAACTGGG - Intergenic
1077440664 11:2567268-2567290 CTGCAAATACAGATGAACCCAGG + Intronic
1077923987 11:6662466-6662488 GTGCCCATCCAGATCAATCTCGG + Intergenic
1078685879 11:13531288-13531310 CTGCGAATCCACCTGGAACTGGG + Intergenic
1080179405 11:29405874-29405896 CTGCAAATCTAGTTGAAACTGGG + Intergenic
1083132259 11:60635807-60635829 CTGACAATCCAGAAGGAATTGGG + Intergenic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1085875258 11:80399580-80399602 CTGACATTCTAGATGAAATTTGG - Intergenic
1086222881 11:84471128-84471150 CTGGCAACCCAGATGGAACTGGG + Intronic
1087192524 11:95270045-95270067 CTGACAAACCTGATGGAACTGGG + Intergenic
1094120536 12:26969474-26969496 GTGACATTCCAGCTGAAACTTGG - Intergenic
1095820484 12:46473050-46473072 CAGCCAATAGAGATTAAACTAGG - Intergenic
1097404985 12:59178027-59178049 CTGCAATTCAAGATGAAATTTGG + Intergenic
1098457898 12:70696449-70696471 ATTCCAATCCAGATGAAACCAGG - Intronic
1100004213 12:89874417-89874439 CTGCCAAACCCCAGGAAACTTGG + Intergenic
1104198952 12:126568522-126568544 CTGCAATTCAAGATGAAATTTGG + Intergenic
1106433000 13:29699456-29699478 CTGTGAATCCATCTGAAACTGGG - Intergenic
1111008451 13:82281114-82281136 CTGCTAAGCCAGATGGACCTTGG + Intergenic
1111832110 13:93342566-93342588 CTACCATTCAAGATGAGACTTGG + Intronic
1112568455 13:100571117-100571139 CTGCCAATCCAAAGGAAAGAAGG + Intronic
1112857398 13:103787917-103787939 CTGCAATTCAAGATGAAATTTGG + Intergenic
1113777633 13:112957440-112957462 CTGCAAACCAAGATTAAACTAGG - Intronic
1117034763 14:51716593-51716615 CTGTCAATCCAAATGAGACCCGG + Intronic
1121517426 14:94561798-94561820 CTGCCAATCCAGGTGATCTTGGG + Intronic
1125135183 15:36333047-36333069 CTGTAAATATAGATGAAACTTGG - Intergenic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1127655678 15:61053391-61053413 CTGCCTGTCCAGATGTAATTAGG + Intronic
1128107213 15:65053985-65054007 CTGCCAAACCAGATGACAAACGG + Exonic
1132012341 15:98287106-98287128 CTGAGAATCCAGAGGGAACTGGG - Intergenic
1133504726 16:6400029-6400051 CTGCAATTCAAGATGAAATTTGG + Intronic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1138141200 16:54570078-54570100 CTGCCAAGCAAAATGAAATTTGG + Intergenic
1138225637 16:55292088-55292110 CTGCAATTCCAGATGAGATTTGG + Intergenic
1140855248 16:78972160-78972182 CTTCATTTCCAGATGAAACTGGG + Intronic
1141019711 16:80483804-80483826 CTGCAATTCAAGATGAAATTTGG + Intergenic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1143760879 17:9103341-9103363 CTACAATTCAAGATGAAACTTGG - Intronic
1146375392 17:32290443-32290465 CCACCAATCTAGAAGAAACTGGG + Intronic
1149159078 17:53668456-53668478 CTGCAATTCAAGATGAAATTTGG - Intergenic
1150069415 17:62138936-62138958 CTGCCAGTGCAGATGGAGCTGGG - Intergenic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1152770272 17:82163262-82163284 GTGCCAGTCCAGAGGATACTGGG + Exonic
1153494069 18:5679594-5679616 CTGCCAACTCTGATGAAAGTAGG + Intergenic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1156130361 18:33965514-33965536 CTGCAATTCAAGATGAAATTTGG - Intronic
1157501722 18:48195280-48195302 CTGCAATTCAAGATGAAATTTGG - Intronic
1160627399 18:80220330-80220352 CTACAACTCAAGATGAAACTTGG + Intronic
1160727112 19:622273-622295 CTGCCAGTGCAGATGGAGCTGGG - Exonic
1164418270 19:28064124-28064146 CGGCCAATTAAGATGAAATTAGG - Intergenic
1166418275 19:42612051-42612073 CTCCCAATCCTGAAGAAATTCGG + Intronic
1166862222 19:45817080-45817102 TTGCCCATCCAGAGGAATCTTGG - Intronic
1168136605 19:54356157-54356179 GTGCCAATCCAGATGCAATGTGG - Intronic
925256243 2:2491045-2491067 CTGCAATTCAAGATGAAATTTGG + Intergenic
928907717 2:36384925-36384947 CTTCCACTTAAGATGAAACTGGG + Intronic
931571879 2:63677816-63677838 AAACAAATCCAGATGAAACTTGG + Intronic
940750917 2:157626463-157626485 CTGCAGATCCAGATGAAAGGTGG + Intronic
942013543 2:171788819-171788841 CACCCTATTCAGATGAAACTAGG + Intronic
942561450 2:177224238-177224260 CTGCCTTTCAAGATCAAACTAGG - Intergenic
942898721 2:181089338-181089360 CTGGCATTCCAGATGCCACTGGG - Intergenic
943437558 2:187885529-187885551 CTGCAATTCAAGATGAAATTTGG + Intergenic
943499332 2:188666901-188666923 CTGCCAAGGCAGCTGAAACTTGG - Intergenic
943757207 2:191569209-191569231 CTGCCACCTCAGCTGAAACTGGG - Intergenic
946523480 2:220492450-220492472 CTCCTAATACAGATGATACTCGG - Intergenic
1168978175 20:1983497-1983519 CCGCCAAGCCAGAAGATACTTGG + Intronic
1170444594 20:16412749-16412771 CTACAATTCCAGATGAAATTTGG + Intronic
1172484055 20:35287955-35287977 CTGCAAAGCCAGGTGAAGCTGGG + Exonic
1172798411 20:37559286-37559308 CTGCAACTCCAGAGGAAGCTAGG - Intergenic
1174181600 20:48678538-48678560 CTGCCATTCAAGATGAGATTTGG - Intronic
1174715054 20:52748740-52748762 GTGCCAAACTAGATGAAATTTGG + Intergenic
1176936198 21:14870049-14870071 CTGCTATTGCAGATGGAACTGGG - Intergenic
1177184222 21:17775763-17775785 CTGGCATTCCAGATGCCACTGGG + Intergenic
1177261408 21:18733938-18733960 CTACAAATCAAGATGAAATTTGG - Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1181543782 22:23588970-23588992 CTGCCGAACATGATGAAACTAGG + Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1183966267 22:41444793-41444815 CTCCCATTACTGATGAAACTAGG + Intronic
949435297 3:4022883-4022905 CTTCTAATCCAGGTGAAACCAGG + Intronic
949940521 3:9150920-9150942 CTTCCAGTCTAGAAGAAACTGGG + Intronic
951350214 3:21597846-21597868 CTGCCTTTCCAGATGAAGGTTGG - Intronic
952919377 3:38274590-38274612 CGGCCAATCCTGAGGAAACAGGG - Exonic
953406765 3:42663631-42663653 CTGCCCACCCAGATGCACCTCGG + Intronic
959330513 3:104998579-104998601 CTGACAAGCCAGAAGAGACTGGG + Intergenic
960067014 3:113384942-113384964 CTACAATTCAAGATGAAACTTGG - Intronic
963391302 3:144666743-144666765 CTGCTATTCAAGGTGAAACTTGG + Intergenic
963489748 3:145984764-145984786 CTTCCAAGCCAGAAGAGACTGGG + Intergenic
967201072 3:187073079-187073101 CTGCTAGTCCAGATGAAATGGGG - Intronic
967936418 3:194731512-194731534 CTCCCAATCTAGATGATCCTCGG - Intergenic
971073827 4:23125599-23125621 CTGCCAAGATAGATGAAACAAGG + Intergenic
971087594 4:23296919-23296941 CTGTCAATCCTTTTGAAACTTGG + Intergenic
973680531 4:53313635-53313657 CTGCCAATCAAGATGAGTATGGG - Exonic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
975383554 4:73729495-73729517 GTTCCAATGAAGATGAAACTGGG + Intergenic
981131549 4:141162923-141162945 CTGGCATTCCAGATGCCACTAGG - Intronic
982533122 4:156572431-156572453 CTTCCAAGCCAGGTGAAAGTGGG + Intergenic
984160018 4:176240902-176240924 CTGCCAACCCAGATCCAAGTAGG - Intronic
984571750 4:181403633-181403655 CTACAATTCCAGATGAAATTTGG + Intergenic
987803421 5:22728948-22728970 TTGCTAATCCAGAGGAGACTAGG - Intronic
987847918 5:23311512-23311534 CTGCAATTCAAGATGAAATTTGG + Intergenic
989518644 5:42374803-42374825 CATCCAAACCTGATGAAACTAGG + Intergenic
992938032 5:81731400-81731422 CTGCCAAGCCAAATGAATCCTGG + Intronic
993741028 5:91539825-91539847 CTACAATTCCAGATGAGACTTGG - Intergenic
993761190 5:91799540-91799562 CTCCCATTCAAGATGAAATTTGG + Intergenic
993822643 5:92638476-92638498 TTGCCTATCCAGATCAAAATTGG + Intergenic
994594005 5:101807748-101807770 CTGCCAGGCCAGATGTAACAAGG + Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
995063485 5:107836354-107836376 CTGCCCATCCCGTTGAAATTAGG + Intergenic
995474622 5:112535060-112535082 CTGCCAATCTAGAACAAACAGGG + Intergenic
995587537 5:113663756-113663778 CTGCCCATCCAAATGAGATTAGG + Intergenic
998460836 5:142308888-142308910 ATGCCAATCAGGATGAAAGTTGG - Intergenic
1001155651 5:169270368-169270390 CTCCCAATCCATATGAAAACAGG - Intronic
1002677135 5:180926441-180926463 CTGCCATTCCAGGTGCCACTGGG - Intronic
1008832041 6:55776793-55776815 CTGGCAACCCAAAGGAAACTTGG - Intronic
1010882742 6:81200134-81200156 CTGCAATTCAAGATGAAATTTGG - Intergenic
1014893371 6:126870034-126870056 CTGTGAATGCAGATGATACTGGG - Intergenic
1015699327 6:136018158-136018180 CTGCCAATCATGCTGAAATTGGG - Intronic
1017661808 6:156682229-156682251 CCACTAATACAGATGAAACTTGG + Intergenic
1020358307 7:7301328-7301350 CTGGCATTCCAGATGCCACTGGG + Intergenic
1022050493 7:26663843-26663865 GTTCCAGTCCAGATGAAAATAGG - Intergenic
1022853368 7:34289780-34289802 CTACAATTCAAGATGAAACTTGG + Intergenic
1024344269 7:48296989-48297011 CTGCCAACCGAGATGAACCAGGG - Intronic
1026171141 7:67954963-67954985 CTGCAATTCAAGATGAAATTTGG + Intergenic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1029047641 7:97646575-97646597 CTGTAAATACAGATGATACTTGG + Intergenic
1030376415 7:108757540-108757562 CCTACAATCCAGAAGAAACTGGG + Intergenic
1035478340 7:159159502-159159524 CTGTCTTTCCAGATGGAACTGGG - Intergenic
1036077801 8:5520840-5520862 CTGACAATGCAGCTCAAACTGGG - Intergenic
1037740403 8:21604430-21604452 CTGCAAATCCAGCAGGAACTTGG + Intergenic
1038134324 8:24769272-24769294 CTGACTATCCAAATGAAAATGGG - Intergenic
1039246958 8:35619609-35619631 CTGGTAATCCAGTTGCAACTGGG + Intronic
1041050780 8:53932247-53932269 CTGGCATTCCAGGTGAAACTGGG - Intronic
1041904681 8:63019475-63019497 CTGCCACTGCAGATAAAACACGG + Intronic
1042522233 8:69725827-69725849 CTGAAAATCCAGAGGAAACAAGG - Intronic
1043425955 8:80149130-80149152 CTGCAATTCAAGATGAAATTCGG - Intronic
1044054032 8:87545794-87545816 CTGCCAATTCCCATGAAACCTGG - Intronic
1046598911 8:116295093-116295115 ATGCCTATCCAGATGAAATTAGG - Intergenic
1050492577 9:6204340-6204362 CTGACAAGCCAGAAGAGACTGGG + Intergenic
1052707173 9:32008145-32008167 CTGTGAATCCATATGAACCTGGG + Intergenic
1053434522 9:38066651-38066673 CTGCCCATGCAGATCAAACAGGG + Intronic
1055847271 9:80580874-80580896 CTGCCAATCTAGATGTGACATGG + Intergenic
1057134308 9:92676436-92676458 ATGCCCAGCCAGATGGAACTGGG + Intergenic
1057736307 9:97664752-97664774 CAGCTAGTCCAGATGGAACTCGG + Intronic
1058136569 9:101314222-101314244 ATGCCAATCCAAATGGATCTTGG - Intronic
1059422592 9:114201488-114201510 CTGGCCATCCAGGAGAAACTGGG + Intronic
1059958809 9:119545319-119545341 CTCCCAACCCAGAGGCAACTCGG + Intergenic
1060858667 9:126935947-126935969 CTGCCAGTCCCGAGGAATCTGGG + Intronic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1186723607 X:12332925-12332947 CTGCCATTCCATATAAAACAGGG - Intronic
1187979371 X:24738859-24738881 CTGCCACTACAGATCAAAGTTGG + Intronic
1188273754 X:28176244-28176266 CTAAGAAGCCAGATGAAACTGGG - Intergenic
1189087886 X:38046565-38046587 CTACAATTCAAGATGAAACTTGG + Intronic
1189219141 X:39356209-39356231 CTGCCCTCCCAGTTGAAACTGGG + Intergenic
1191103660 X:56759237-56759259 CTGCCATTCCAGGAGAAAGTGGG - Intergenic
1192209419 X:69118255-69118277 CTTCCATTCCAGCTGAATCTGGG + Intergenic
1192740995 X:73892650-73892672 CTGGCATTCCAGATGCCACTGGG - Intergenic
1193606965 X:83580973-83580995 GTTCCAACCCAGATCAAACTAGG - Intergenic
1194203493 X:90983426-90983448 CTGGCATTCCAGGTGACACTGGG - Intergenic
1194397694 X:93405244-93405266 CTGCAATTCAAGATGAAATTTGG + Intergenic
1194697545 X:97073237-97073259 CTGTCAGGCCAGATGAAACTTGG + Intronic
1196545512 X:116960386-116960408 TTGCCACTCCATATGAAAATGGG - Intergenic
1196803345 X:119563206-119563228 GTGCCAATCCAGGTGAAAGATGG + Intronic
1197157195 X:123283364-123283386 CTGGCATTCCAGATGCCACTGGG - Intronic
1200549323 Y:4558860-4558882 CTGGCATTCCAGGTGACACTGGG - Intergenic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic