ID: 922287676

View in Genome Browser
Species Human (GRCh38)
Location 1:224183727-224183749
Sequence TACTCAAGGCTGGCACAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 178}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922287676_922287681 14 Left 922287676 1:224183727-224183749 CCCGGCTGTGCCAGCCTTGAGTA 0: 1
1: 0
2: 2
3: 13
4: 178
Right 922287681 1:224183764-224183786 AAGATTCCTGTGCCCTCAGGTGG 0: 1
1: 0
2: 2
3: 12
4: 157
922287676_922287680 11 Left 922287676 1:224183727-224183749 CCCGGCTGTGCCAGCCTTGAGTA 0: 1
1: 0
2: 2
3: 13
4: 178
Right 922287680 1:224183761-224183783 TAGAAGATTCCTGTGCCCTCAGG 0: 1
1: 0
2: 0
3: 7
4: 161
922287676_922287682 15 Left 922287676 1:224183727-224183749 CCCGGCTGTGCCAGCCTTGAGTA 0: 1
1: 0
2: 2
3: 13
4: 178
Right 922287682 1:224183765-224183787 AGATTCCTGTGCCCTCAGGTGGG 0: 1
1: 0
2: 0
3: 19
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922287676 Original CRISPR TACTCAAGGCTGGCACAGCC GGG (reversed) Intronic
901735003 1:11306692-11306714 TACTGAATGCTGGCACAGAGGGG + Intergenic
901866374 1:12109616-12109638 TTCTCTGGGCTGGCACAGGCAGG - Exonic
903526541 1:23995185-23995207 TCCTGAAGGGTGGCACAACCAGG + Intergenic
904125773 1:28237089-28237111 AACTCAAGGCTGGCAAAGGGAGG - Intronic
909673196 1:78211717-78211739 CACTGAAAGCAGGCACAGCCAGG - Intergenic
913568037 1:120092398-120092420 TTCACCAAGCTGGCACAGCCTGG - Intergenic
914288846 1:146253419-146253441 TTCACCAAGCTGGCACAGCCTGG - Intergenic
914549881 1:148704163-148704185 TTCACCAAGCTGGCACAGCCTGG - Intergenic
914616858 1:149367865-149367887 TTCACCAAGCTGGCACAGCCTGG + Intergenic
917081865 1:171263815-171263837 TATTGAAGGCTGGCAGGGCCTGG + Intronic
919253454 1:195091095-195091117 TACTCAAGGCTGGCAAATGTGGG - Intergenic
921673686 1:217953671-217953693 AATTAAAGGCAGGCACAGCCGGG - Intergenic
922257405 1:223904618-223904640 TCCTCCAGGCTGGCTTAGCCTGG + Intergenic
922287676 1:224183727-224183749 TACTCAAGGCTGGCACAGCCGGG - Intronic
924197075 1:241619364-241619386 TCCTCAGGGCTGGCTCAGCCTGG - Intronic
1063298543 10:4830855-4830877 TATGCAAGGCTGGCAGAGCTTGG + Intronic
1066388078 10:34957570-34957592 TTCCCAAGGCAGGCCCAGCCAGG + Intergenic
1071794331 10:88989483-88989505 TGCACAAGGCTGGCACGCCCAGG + Intronic
1071892346 10:90024303-90024325 CACTCCAGACTGGCCCAGCCTGG - Intergenic
1075368091 10:121911300-121911322 CACTTAAGACTGGCACAGCTGGG + Intronic
1075409856 10:122219306-122219328 CACTGAAGGCGGGCAGAGCCAGG - Intronic
1076203876 10:128579471-128579493 TATTAAAGGCTGTCACAGTCAGG + Intergenic
1076555791 10:131320672-131320694 TGGTCAAGGCTGACACACCCTGG - Intergenic
1077273513 11:1692781-1692803 TGCTCAGGGCTGGCATGGCCAGG - Intergenic
1080958507 11:37130252-37130274 TAGTCATGGCTGGAACAGCTAGG - Intergenic
1083002108 11:59301999-59302021 TCCTCAAGGCTGTCACCACCCGG + Intergenic
1083304469 11:61755308-61755330 CCCTCGAGGCTGGTACAGCCGGG + Intronic
1083343349 11:61973182-61973204 TCCCCAACCCTGGCACAGCCCGG + Intergenic
1083505955 11:63157384-63157406 TGCACAAGGCTGGCATTGCCTGG + Intronic
1085030342 11:73267267-73267289 TACTCCAGGCTGGCTTAGGCAGG - Intronic
1085251811 11:75148931-75148953 TTCCCCAGGCTGGCAAAGCCTGG - Intronic
1085327004 11:75613838-75613860 TACTAAGGGATGGCAGAGCCAGG + Intronic
1086223196 11:84475140-84475162 TGTTCTTGGCTGGCACAGCCTGG + Intronic
1089968427 11:122672857-122672879 TACTGCAGGCTGGCCCAGCCTGG - Intronic
1091295984 11:134474325-134474347 AAATGAAGGCTGGCACTGCCAGG + Intergenic
1091403415 12:194655-194677 TACTGAATGCTGCAACAGCCAGG - Intronic
1091413038 12:256852-256874 TACTAAAGGATGGCACAGCCTGG + Intronic
1091834644 12:3577028-3577050 GACTCCAGGGTGGCACAGCGGGG - Intronic
1093923893 12:24889974-24889996 TCCTAAAGGGTGGCACACCCCGG + Intronic
1095307080 12:40651283-40651305 TGCACAAGCCAGGCACAGCCTGG - Intergenic
1095318299 12:40793631-40793653 TACTAAAGGATGACACAGCTTGG - Intronic
1095511125 12:42952805-42952827 TACCCATGGCTGGAACAGCTGGG - Intergenic
1102571794 12:113831359-113831381 AACTGTAGGCTGGCCCAGCCTGG - Intronic
1104619457 12:130299921-130299943 GACAGGAGGCTGGCACAGCCAGG - Intergenic
1105793196 13:23823427-23823449 TTCTCAATGCTGTCACAGCTTGG + Intronic
1112564774 13:100544013-100544035 TGCTCAGGGCTGGCACAGTGTGG - Intronic
1113707675 13:112445060-112445082 TGGTCAAGCCTGCCACAGCCCGG + Intergenic
1118326524 14:64785237-64785259 TCCTCAAAGCTGGCCCAGACTGG + Intronic
1119230060 14:72972588-72972610 TACGCAAGGCTGGCCAGGCCTGG - Intronic
1119662477 14:76462024-76462046 TCCTCAAGGTTAGCAAAGCCAGG + Intronic
1120861679 14:89260508-89260530 AACTCCTGGCTGGCACAGCCTGG + Intronic
1121027507 14:90627333-90627355 CACACAAGGCTGGCACATCCGGG + Intronic
1121319298 14:92981712-92981734 TCCTCAAGGCTGTCACGGTCAGG + Intronic
1121457847 14:94050225-94050247 AACTCAAGGCTTGGTCAGCCTGG - Exonic
1121656970 14:95604302-95604324 TACCCAAGGTTGGCATAGCCAGG - Intergenic
1123795163 15:23763651-23763673 TGCTCCAGGCTGGCAAAGCTCGG - Intergenic
1124192468 15:27592204-27592226 TTCTCAAGGCAGGCAAAGGCTGG + Intergenic
1125927283 15:43573274-43573296 GAATCAAAGCTGGGACAGCCTGG - Intronic
1125940426 15:43672839-43672861 GAATCAAAGCTGGGACAGCCTGG - Intergenic
1128066441 15:64767651-64767673 CACTCAAGGCTGGGACATGCTGG - Intronic
1129893020 15:79084393-79084415 CACTCAACGCTTTCACAGCCTGG - Intronic
1129903882 15:79172573-79172595 GACTCAAGTCTGGGGCAGCCAGG - Intergenic
1130824805 15:87532961-87532983 TAGTCATGGCTGGAACAGCTGGG + Intergenic
1132610583 16:813896-813918 CACCCAACGCTGGCCCAGCCCGG + Intergenic
1132632814 16:928101-928123 CACCCAACGCTGGGACAGCCTGG + Intronic
1137451878 16:48583382-48583404 TATCCAAGGCTGGCACAGTTTGG + Intronic
1139312957 16:66042571-66042593 AACTCAAGGCTGGTTCCGCCCGG + Intergenic
1140995365 16:80253715-80253737 AACTCAAGGGAGGAACAGCCAGG + Intergenic
1141196072 16:81862226-81862248 GGCTCAGGGCTGGCCCAGCCCGG + Intronic
1142197668 16:88746211-88746233 TACACAAGGCTGGCAGAGCCGGG + Intronic
1142711556 17:1726492-1726514 TGCACCAGGCTGGCACATCCAGG - Exonic
1142717485 17:1754998-1755020 AACTCGTGTCTGGCACAGCCTGG + Exonic
1143097867 17:4488108-4488130 CGCTCAAGGCTGCCCCAGCCTGG + Exonic
1146289398 17:31597026-31597048 TGGTCAAGGCTGGGACAGGCCGG + Intergenic
1148767178 17:50046216-50046238 AAAGCCAGGCTGGCACAGCCTGG + Intergenic
1151500246 17:74483746-74483768 TCCTCAGGGCTGACCCAGCCTGG - Intronic
1152262917 17:79276901-79276923 GACTCAGGGCTGGTACAGGCTGG + Intronic
1152388517 17:79989418-79989440 TACTCAAAGCAGGCACAGAGTGG - Intronic
1152531579 17:80922304-80922326 GACTCAAGGCTGGGACAGTGTGG + Intronic
1153455045 18:5271456-5271478 TAGTCATGGCTGGAACAGCTGGG + Intergenic
1154191501 18:12234480-12234502 TCCTCATGGCTGGAACAGCCTGG - Intergenic
1156397808 18:36715105-36715127 TCATCAGGGCTGGCAGAGCCAGG - Intronic
1158339396 18:56449095-56449117 CACTCCATCCTGGCACAGCCTGG - Intergenic
1158930855 18:62324645-62324667 GCCTCAAGGCTGGCGGAGCCTGG + Intergenic
1161414107 19:4135187-4135209 TACTCCAGCCTGGGACAGACCGG + Intergenic
1167017273 19:46849477-46849499 TACACCAGGCAGCCACAGCCTGG + Intronic
1168584006 19:57578305-57578327 TACTCAGAGTTGGAACAGCCTGG - Intronic
1168712765 19:58511388-58511410 TACACAGGGCTGGAACGGCCTGG + Exonic
925580146 2:5401770-5401792 TACTGAGGACTGTCACAGCCTGG + Intergenic
927164005 2:20298939-20298961 TCCTGAAGGGTGGCACACCCAGG + Intronic
927927558 2:27024380-27024402 TCCTCCAGGCTGGCAGGGCCGGG - Intronic
931177720 2:59870526-59870548 TGTTCAAGGCTGGCTGAGCCTGG - Intergenic
931668112 2:64624649-64624671 TTCTCAAGGCTGGCCCAGAGGGG - Intergenic
932128264 2:69164687-69164709 CATACAAGGCTGGCACGGCCTGG - Intronic
932515119 2:72338788-72338810 TACCCAAGGCTGCTACAGACAGG + Intronic
933247721 2:79994548-79994570 TACTTAAGGCAGGCACTGCTAGG + Intronic
935147020 2:100402549-100402571 AACTGAAGGTGGGCACAGCCAGG - Exonic
935752569 2:106249977-106249999 TACTAAAGGCTGGGAAAGGCAGG + Intergenic
935912988 2:107917522-107917544 TACTAAAGGCTGGGAAAGGCAGG + Intergenic
939614238 2:144344872-144344894 TACTCAATGCAGTCACAGCTAGG - Intergenic
942351302 2:175056477-175056499 TACACAAGTCTGGCATAGCTGGG - Intergenic
946072298 2:217044825-217044847 TATTCATGGCAGGCACAGTCTGG + Intergenic
946522670 2:220483820-220483842 TACTCAACTGTGGCACAGCACGG - Intergenic
1169138622 20:3213542-3213564 TATTCAAGGCTGGCAAAGGAAGG - Intronic
1172358290 20:34294751-34294773 AACTCAAGACTGGCATATCCAGG - Intronic
1178341221 21:31786878-31786900 TACTCAAAACTAGCACAGGCTGG - Intergenic
1178635417 21:34298177-34298199 TATTCAAGGGTGGCATATCCTGG + Intergenic
1179116147 21:38494295-38494317 TACCAAACGCTGGAACAGCCTGG + Intronic
1179287970 21:39994543-39994565 TACTCATGGGTGGCTGAGCCAGG - Intergenic
1184191522 22:42898235-42898257 TTCCCAAGGTGGGCACAGCCTGG - Intronic
1184509546 22:44925673-44925695 TGCTCTTGGCTGGCACAGCCTGG + Intronic
1184791861 22:46705063-46705085 TCCCCAAGCCTGGCACAGCCTGG - Intronic
1185379693 22:50502737-50502759 GCCTCAGGCCTGGCACAGCCCGG - Intergenic
949391100 3:3563431-3563453 CACTAAAGGCTGGCCCAGCCTGG - Intergenic
950087112 3:10267214-10267236 TATTCAAGACTGTCTCAGCCGGG - Intronic
950451560 3:13068381-13068403 TACCCAAAGCTGGCATGGCCTGG - Intronic
952321066 3:32278117-32278139 TACTGAAGGCTGGAGCAGACAGG - Intronic
952524638 3:34197349-34197371 TACTGAAGCATGCCACAGCCTGG + Intergenic
952647413 3:35678080-35678102 AACTCAAAGCAGGGACAGCCTGG - Intronic
954871546 3:53771084-53771106 TTCTCCAGGCTGGCACAGCTCGG + Intronic
958670419 3:97197246-97197268 TCCTCATGGCTGCCACAGCTAGG + Intronic
960015906 3:112887529-112887551 GTCTCAAGGCTGGCAGAGACAGG + Intergenic
960314737 3:116162823-116162845 TTATCAAGGCTGGGACATCCAGG - Intronic
961114287 3:124315431-124315453 GACTCATGGTTGGCACTGCCTGG + Intronic
961738604 3:129017926-129017948 TCCTCAAGGCTGTACCAGCCAGG + Intronic
963421072 3:145061534-145061556 TAGTCAAGGCTGGAGCAGCTGGG + Intergenic
963571572 3:147003807-147003829 TTCACAAGGCTGGCAGAGGCGGG + Intergenic
966059256 3:175734708-175734730 TAGTCAAGGCTGGAGCAGCTGGG + Intronic
967712564 3:192726341-192726363 CACTCAAGGCTCTCACAACCTGG + Intronic
969893094 4:10277841-10277863 TCCCCAAGGCTAGCACAACCTGG + Intergenic
970365634 4:15355207-15355229 AAATCAATGCTGGCAGAGCCAGG + Intronic
972599595 4:40560516-40560538 GACCAAAGGCTGGCACTGCCGGG - Intronic
974061088 4:57036690-57036712 TTCTTACGGTTGGCACAGCCTGG - Intronic
976928651 4:90534423-90534445 CACAAAAGGCTGGCACAGCCTGG - Intronic
980266552 4:130524166-130524188 TAGCCATGGCTGGAACAGCCAGG + Intergenic
983062588 4:163175776-163175798 TACTAAAGTCTGGCAAAGCTGGG - Intergenic
983359934 4:166715034-166715056 GACTATAGGCTGGCACACCCTGG + Intergenic
983736821 4:171072128-171072150 TACTCATGGCTGGCAGAGAAGGG - Intergenic
984852794 4:184168661-184168683 AATTCAAGGCTGGCCCAGCCTGG - Intronic
985201401 4:187488741-187488763 TAGTCATGGCTGGAGCAGCCGGG - Intergenic
985361743 4:189183625-189183647 TACTAATGGCTGGCACAACTGGG + Intergenic
987799484 5:22675236-22675258 TAGTCATGGCTGGAACAGCTGGG - Intronic
989279163 5:39621776-39621798 TGCTCAAGGCTGGCTGAGTCCGG + Intergenic
989459699 5:41683371-41683393 TGCACAAGCCAGGCACAGCCCGG - Intergenic
995508618 5:112885625-112885647 TGCTCCAGGCTGGCAGACCCTGG - Intronic
995624232 5:114058998-114059020 TCCTCCAGGCTTTCACAGCCTGG - Intergenic
997381582 5:133441855-133441877 TAGTCCAGGCTGGCAGGGCCTGG + Intronic
999155926 5:149457566-149457588 TACTGAAGGCCTGCCCAGCCTGG - Intergenic
999204347 5:149837258-149837280 TTCTGGAGGCAGGCACAGCCTGG + Intronic
999497853 5:152117876-152117898 TACTCGAGGCTGGCAGAGAAGGG - Intergenic
1001640786 5:173242762-173242784 TGCCCAACGGTGGCACAGCCTGG + Intergenic
1002891373 6:1335640-1335662 TACACAACTCTGGCAGAGCCAGG - Intergenic
1004387898 6:15188244-15188266 TCCTGAAGGGTGGCACAACCAGG - Intergenic
1006276747 6:33010214-33010236 TCCTCCAGGCTGACACAGGCTGG + Intergenic
1011580849 6:88862416-88862438 TACTGGAGGGTGGCACATCCAGG + Intronic
1012141476 6:95631537-95631559 TACTCACAGCTGGAACAGCTTGG - Intergenic
1014153567 6:118086287-118086309 TACAGAAGACAGGCACAGCCTGG - Intronic
1016698780 6:147030453-147030475 CGCACATGGCTGGCACAGCCTGG - Intergenic
1018940993 6:168308770-168308792 TCCTCGAGGCTGGCCCGGCCAGG - Exonic
1020736065 7:11950455-11950477 TACTGCAAGCAGGCACAGCCAGG + Intergenic
1022206986 7:28174396-28174418 ACCTTAAGGCTGGCACAGGCTGG - Intronic
1022503187 7:30895133-30895155 TAAGCAAGGGTGGCACAGCAGGG + Intergenic
1022622188 7:31996020-31996042 TTCTGAAGGCTGGCACAGAGTGG - Intronic
1024301445 7:47890297-47890319 TAGCTAAAGCTGGCACAGCCGGG - Intronic
1026742814 7:72989861-72989883 TGCTCCAAGGTGGCACAGCCAGG + Intergenic
1026802666 7:73410251-73410273 TGCTCCAAGGTGGCACAGCCAGG + Intergenic
1027028927 7:74874566-74874588 TGCTCCAAGGTGGCACAGCCAGG + Intergenic
1027100921 7:75375217-75375239 TGCTCCAAGGTGGCACAGCCAGG - Intergenic
1027564644 7:79776428-79776450 TCCTAGAGGGTGGCACAGCCAGG - Intergenic
1029521912 7:101068158-101068180 GGCTCATGGCTGGCAGAGCCAGG + Intergenic
1034556111 7:151851452-151851474 TACTCCTGGCTGGCCCAGGCTGG + Intronic
1035638664 8:1165367-1165389 TACCAAGCGCTGGCACAGCCGGG + Intergenic
1035837454 8:2770024-2770046 AACACAAGGGTGACACAGCCTGG - Intergenic
1035931312 8:3783392-3783414 GACCCACGGCTGGCACAGTCAGG + Intronic
1038347648 8:26747094-26747116 TGCCCAAGGGTGACACAGCCTGG - Intergenic
1039395878 8:37224819-37224841 CACTGAAGGCAGGCGCAGCCGGG - Intergenic
1043195536 8:77287595-77287617 TACTCAAGTCTGGCTGAGTCTGG - Intergenic
1043805922 8:84671672-84671694 TAGTCAAGGCTGGAGCAGCTGGG + Intronic
1045588201 8:103562960-103562982 TAGTCAAGGCTGGAGCAGCTGGG + Intronic
1048197406 8:132343489-132343511 TACCCAAAGCTGGCAGAGGCTGG + Intronic
1049280040 8:141739683-141739705 CAGTCAGGGCTGGCCCAGCCTGG - Intergenic
1051430183 9:16973561-16973583 TCCTCTAGACTGACACAGCCAGG - Intergenic
1051547683 9:18294554-18294576 TAGTCTAAGCTGGCACTGCCTGG + Intergenic
1052736153 9:32344691-32344713 TGCCCAAGGCTGGAACAACCTGG + Intergenic
1055419219 9:76119854-76119876 TACTAAATGATGGCACAGCAGGG - Intronic
1062376479 9:136264050-136264072 CACGCAGGGCTGGCACAGGCTGG + Intergenic
1062379951 9:136282308-136282330 CACGCAAGGCTGACAGAGCCAGG + Intronic
1062586860 9:137253408-137253430 TGGACAAGGCTGGCCCAGCCTGG + Exonic
1189669776 X:43395366-43395388 TAGTCAAGGCTGGAGCAGCTGGG + Intergenic
1192587868 X:72334176-72334198 TTCTAAAGGCTAGCACAGGCTGG + Intronic
1196580979 X:117378815-117378837 TACTATCGGCTTGCACAGCCAGG + Intergenic
1196892963 X:120308511-120308533 TACTCAAGGCTGGGATATCCGGG - Intronic
1197786150 X:130199320-130199342 CACTCAAGGGTGGCAGAGCAAGG - Intergenic
1198847259 X:140925359-140925381 GACTCCAGGCTGTCAAAGCCAGG + Intergenic