ID: 922288445

View in Genome Browser
Species Human (GRCh38)
Location 1:224190006-224190028
Sequence GTTGATGAACAGAGGTCGAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 86}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922288445_922288452 17 Left 922288445 1:224190006-224190028 CCTTTCGACCTCTGTTCATCAAC 0: 1
1: 0
2: 0
3: 5
4: 86
Right 922288452 1:224190046-224190068 TCTGGAAGTTATCAATACCGTGG 0: 1
1: 0
2: 0
3: 2
4: 83
922288445_922288448 -1 Left 922288445 1:224190006-224190028 CCTTTCGACCTCTGTTCATCAAC 0: 1
1: 0
2: 0
3: 5
4: 86
Right 922288448 1:224190028-224190050 CCCCAAACCAATTACGTATCTGG 0: 1
1: 0
2: 0
3: 6
4: 31
922288445_922288453 23 Left 922288445 1:224190006-224190028 CCTTTCGACCTCTGTTCATCAAC 0: 1
1: 0
2: 0
3: 5
4: 86
Right 922288453 1:224190052-224190074 AGTTATCAATACCGTGGCACAGG 0: 1
1: 0
2: 0
3: 4
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922288445 Original CRISPR GTTGATGAACAGAGGTCGAA AGG (reversed) Exonic
904828789 1:33293614-33293636 GTTGAGGAACAGAAGTGGAGGGG - Intronic
906234138 1:44193586-44193608 GTTGATGAACAGAAGCAGAAGGG + Intergenic
908077589 1:60537446-60537468 CTTGAAGAACAGACCTCGAATGG - Intergenic
909599493 1:77447058-77447080 GAAGAGGAACAGAGGTCAAAAGG + Intronic
912350130 1:109004683-109004705 GTTGATGCACAGAGGCCTATCGG - Exonic
918912941 1:190596775-190596797 GTTGATGAAGAAAGATGGAAAGG - Intergenic
922288445 1:224190006-224190028 GTTGATGAACAGAGGTCGAAAGG - Exonic
1063361579 10:5463429-5463451 CTGGAAGAACAGAGGTCCAAAGG - Intergenic
1066094580 10:32059957-32059979 GTTGAGGAACATAGGGGGAATGG - Intergenic
1067761703 10:49053399-49053421 GGTGCTGAACAGGGGTCAAAAGG + Intronic
1069465901 10:68638642-68638664 GTCAATGAACAGACTTCGAAAGG + Intronic
1071217490 10:83425195-83425217 GTTGAGGAACAGAGGGTGACTGG - Intergenic
1072192924 10:93090777-93090799 GATGAGGAACTGAGGTCCAAGGG + Intergenic
1073608275 10:104917653-104917675 GGTGGTTAACAGGGGTCGAATGG - Intronic
1080723645 11:34873241-34873263 CTTGATGATCTGAGGTGGAACGG + Intronic
1086331948 11:85762960-85762982 AATGATGAACACAGGTGGAAGGG + Intronic
1087205469 11:95389343-95389365 TTTCATGAACAGAGGTTGGAGGG - Intergenic
1088371281 11:109090965-109090987 ATTAGTGAACAGAGGTCAAAGGG - Intergenic
1093763188 12:22933478-22933500 TTTGGGGAACAGAGGTGGAAGGG - Intergenic
1099061977 12:77922632-77922654 GTTGAGGAACACAGGCCGAGGGG - Intronic
1118229365 14:63933124-63933146 TTTGATGAGAAGAGGTCGCAAGG + Intronic
1118774853 14:68967332-68967354 GTTGATGAACAGTGGTGGTGAGG - Intronic
1121726829 14:96158465-96158487 GAGGATGAACAGAGGTAGAAGGG + Intergenic
1129866406 15:78912094-78912116 GTTGATTAGCAGAGGTCGGAGGG + Intergenic
1132226111 15:100142655-100142677 GTTCAAGAACAGAGGCAGAATGG + Intronic
1145262466 17:21362816-21362838 GTGGATGAACAGAGGATGAATGG + Intergenic
1145782152 17:27570477-27570499 GTGGAGGAATAGAGGTCAAAGGG - Intronic
1147291906 17:39450253-39450275 GTTTTGGAGCAGAGGTCGAAAGG - Intronic
1147358748 17:39918122-39918144 GTTGATGAACAGAGGAACCAGGG + Intronic
1156558874 18:38098907-38098929 GTTGATGCACAATGGTCAAAGGG - Intergenic
1157793559 18:50555233-50555255 GTTGAAGAACAGAGGAAGAGTGG - Intergenic
1160775153 19:852174-852196 GTTGATGAAAAGGGGGAGAAGGG - Intronic
1167054419 19:47100317-47100339 GTTGATGAACCTAGGTAGTAAGG - Intronic
1167170850 19:47830814-47830836 TTTGATGAACAGAAGTTGATAGG + Intronic
929917883 2:46151355-46151377 GGTGATGAGCAGAGGTGGGAGGG - Intronic
931932262 2:67152294-67152316 GTTGATTAACAGTGGTGGCAGGG - Intergenic
941020140 2:160399007-160399029 TTTGAAGAACAGAGGTCAATAGG - Intronic
942337316 2:174903173-174903195 GTTGATGATCAGTGATAGAATGG - Intronic
942899957 2:181103432-181103454 GTTGATGCCCAGATGTCCAAAGG - Intergenic
948067704 2:235093527-235093549 GTTGAGGAAGCGAGGTAGAACGG + Intergenic
948082642 2:235219265-235219287 GTGGATGAACACAGGGCAAAGGG - Intergenic
1171057089 20:21917852-21917874 CTTGATGAACTGAGGATGAAGGG + Intergenic
1174532996 20:51229591-51229613 GCTGACGAACAGAGGGCAAAGGG + Intergenic
1182128933 22:27836509-27836531 GTTGATGAGCAATGGTGGAAGGG - Intergenic
1183413092 22:37666725-37666747 GTTGATGGCCACAGCTCGAAGGG + Exonic
950808257 3:15627082-15627104 GTTGGTGAACAGATCTGGAAAGG + Intronic
950839913 3:15957947-15957969 ACTGATGAACAGAGGCCCAAAGG - Intergenic
951443361 3:22748058-22748080 GTGAATGAACAGAGGATGAAAGG - Intergenic
953849818 3:46456957-46456979 CCTGATGATCAGAGGTGGAACGG - Intronic
954117438 3:48474959-48474981 GTTTATGAACTGAAGTAGAAAGG - Intronic
955488301 3:59457095-59457117 GTGGATGATCAGAGGTGGAGAGG - Intergenic
971008135 4:22398536-22398558 AGTGATGAACAGAGGTTGTAGGG - Intronic
971953549 4:33385717-33385739 GGTGGTGACCAGAGGTCGAGAGG + Intergenic
974627781 4:64445957-64445979 GAAGATGAACAAAGGTGGAAGGG + Intergenic
977498004 4:97801402-97801424 GTTGATGAAGGGATGTAGAAAGG - Intronic
978268793 4:106862182-106862204 GTTGACTAACAGAGGTCACAAGG + Intergenic
979375273 4:119939043-119939065 CTTGGTGTACAGAGGTCTAATGG + Intergenic
979896312 4:126162304-126162326 GATGATTATCAGAGGTTGAAAGG + Intergenic
982692512 4:158564923-158564945 GTTTAGGAACAGAAGTAGAAAGG - Intronic
985597674 5:803975-803997 GAAGATGAACAGAGCTTGAAAGG + Intronic
987126321 5:14816180-14816202 GTTGATCTAAAGAGGTTGAAGGG + Intronic
987217714 5:15755062-15755084 GTTGAACAACAGAGGCAGAAGGG - Intronic
990646236 5:57847787-57847809 GTTGATGAAAATGGGTCAAATGG - Intergenic
995481711 5:112599594-112599616 GTGGACTAACAGAGGGCGAAAGG + Intergenic
1000914623 5:167065635-167065657 GTTGATAAATAGAAGTCCAATGG + Intergenic
1001569102 5:172718556-172718578 GTGGATGGATAGAAGTCGAATGG + Intergenic
1005981715 6:30841764-30841786 GATAATGAACTGAGGTGGAAAGG - Intergenic
1007071057 6:39038450-39038472 CTTCATGAACAGATGTGGAAGGG - Intergenic
1007215777 6:40236048-40236070 GGTGATGAACAGTGGTGGGAAGG - Intergenic
1008320840 6:50111879-50111901 GTTAATGAACAGAGGTTAAAAGG + Intergenic
1016676483 6:146776114-146776136 GTTGATGAAATGAGCTCAAAAGG - Intronic
1018222729 6:161597165-161597187 GGTGATGAACACATGCCGAAAGG + Intronic
1019326895 7:442931-442953 GTGGATGAACGGAGGATGAATGG + Intergenic
1020143086 7:5623007-5623029 GTTGTTGAACACAGGCCGCACGG + Exonic
1022222173 7:28324123-28324145 GTTGAGGAACCCTGGTCGAAGGG + Intronic
1022786773 7:33645868-33645890 GTTGATGAAATCAGGTGGAAGGG - Intergenic
1032450289 7:132024788-132024810 GCTGATGAAGAGAGGAGGAAGGG + Intergenic
1037797507 8:22008927-22008949 TTTGATGAACAGATGACAAAGGG - Intergenic
1038520277 8:28226424-28226446 TTGCATGAACAGAGGTTGAAAGG - Intergenic
1038731188 8:30129216-30129238 CTTGATGAACAGAGATGGCAAGG - Intronic
1039530688 8:38259024-38259046 GTTGAGGAACAAAGGTGGGAGGG + Intronic
1041335693 8:56780111-56780133 TTTGATGGACAGAGGAAGAAAGG + Intergenic
1042605378 8:70540892-70540914 GGTAATGGACAGAGGTTGAAAGG + Intergenic
1043247417 8:78022474-78022496 GTTAATGAAGAGAGGAAGAATGG - Intergenic
1043794599 8:84520767-84520789 CTTGATGATCTGAGGTGGAATGG + Intronic
1049639542 8:143708591-143708613 GTTGCTGAACCGAAGGCGAAGGG - Intronic
1050591188 9:7161813-7161835 GCTGATGAAAAGAAGTTGAAAGG - Intergenic
1055942437 9:81663300-81663322 GTAGAAAAACAGAGGTCTAAAGG + Intronic
1188722505 X:33540704-33540726 TTTGATGAACTTAGGTTGAAGGG - Intergenic
1192794770 X:74417890-74417912 CTTGATGATCTGAGGTGGAACGG - Intergenic
1194579268 X:95651651-95651673 GTTGATAAACAGTAGTAGAAAGG + Intergenic
1195422842 X:104694744-104694766 GTTGATCAACTGAGGGGGAAAGG + Intronic