ID: 922289491

View in Genome Browser
Species Human (GRCh38)
Location 1:224198655-224198677
Sequence CTGCCAATCCAGATGAAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922289491_922289497 27 Left 922289491 1:224198655-224198677 CCAAGTTTCATCTGGATTGGCAG No data
Right 922289497 1:224198705-224198727 CAACTCAGGAGGAAGGTTTCAGG No data
922289491_922289496 20 Left 922289491 1:224198655-224198677 CCAAGTTTCATCTGGATTGGCAG No data
Right 922289496 1:224198698-224198720 TTGGACTCAACTCAGGAGGAAGG No data
922289491_922289494 13 Left 922289491 1:224198655-224198677 CCAAGTTTCATCTGGATTGGCAG No data
Right 922289494 1:224198691-224198713 CTGATAATTGGACTCAACTCAGG No data
922289491_922289493 1 Left 922289491 1:224198655-224198677 CCAAGTTTCATCTGGATTGGCAG No data
Right 922289493 1:224198679-224198701 TGGCACATGAAGCTGATAATTGG No data
922289491_922289495 16 Left 922289491 1:224198655-224198677 CCAAGTTTCATCTGGATTGGCAG No data
Right 922289495 1:224198694-224198716 ATAATTGGACTCAACTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922289491 Original CRISPR CTGCCAATCCAGATGAAACT TGG (reversed) Intergenic
No off target data available for this crispr