ID: 922291166

View in Genome Browser
Species Human (GRCh38)
Location 1:224210088-224210110
Sequence CTGTGGGTCTTGGGGTCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922291166_922291178 30 Left 922291166 1:224210088-224210110 CCCACAGACCCCAAGACCCACAG No data
Right 922291178 1:224210141-224210163 CCAGACCAGAAGCTGAGCGCTGG No data
922291166_922291174 -1 Left 922291166 1:224210088-224210110 CCCACAGACCCCAAGACCCACAG No data
Right 922291174 1:224210110-224210132 GACCACAGTAAAAGGTCCTAAGG No data
922291166_922291171 -9 Left 922291166 1:224210088-224210110 CCCACAGACCCCAAGACCCACAG No data
Right 922291171 1:224210102-224210124 GACCCACAGACCACAGTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922291166 Original CRISPR CTGTGGGTCTTGGGGTCTGT GGG (reversed) Intergenic
No off target data available for this crispr