ID: 922291368

View in Genome Browser
Species Human (GRCh38)
Location 1:224211504-224211526
Sequence AAGGGCATTTTGAAGTCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922291368_922291371 -5 Left 922291368 1:224211504-224211526 CCTCCAGACTTCAAAATGCCCTT No data
Right 922291371 1:224211522-224211544 CCCTTCTGCAGCTCCTGTGCTGG No data
922291368_922291374 30 Left 922291368 1:224211504-224211526 CCTCCAGACTTCAAAATGCCCTT No data
Right 922291374 1:224211557-224211579 AAAAACACAGTGAAGTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922291368 Original CRISPR AAGGGCATTTTGAAGTCTGG AGG (reversed) Intergenic
No off target data available for this crispr