ID: 922294582

View in Genome Browser
Species Human (GRCh38)
Location 1:224238400-224238422
Sequence GCTGAGAGGACTGGAGCTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 497
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 450}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922294577_922294582 1 Left 922294577 1:224238376-224238398 CCAGGCACAGGGTTCGGCGACCT 0: 1
1: 0
2: 0
3: 2
4: 51
Right 922294582 1:224238400-224238422 GCTGAGAGGACTGGAGCTGCCGG 0: 1
1: 0
2: 2
3: 44
4: 450
922294573_922294582 15 Left 922294573 1:224238362-224238384 CCTGGCAAAGTGCTCCAGGCACA 0: 1
1: 0
2: 1
3: 16
4: 197
Right 922294582 1:224238400-224238422 GCTGAGAGGACTGGAGCTGCCGG 0: 1
1: 0
2: 2
3: 44
4: 450

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922294582 Original CRISPR GCTGAGAGGACTGGAGCTGC CGG Intronic