ID: 922303639

View in Genome Browser
Species Human (GRCh38)
Location 1:224325326-224325348
Sequence CTTAGGGAGGCGAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143124
Summary {0: 1, 1: 15, 2: 1520, 3: 29919, 4: 111669}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922303639 Original CRISPR CTTAGGGAGGCGAAGGTGGA AGG Intronic
Too many off-targets to display for this crispr