ID: 922307717

View in Genome Browser
Species Human (GRCh38)
Location 1:224358371-224358393
Sequence TCTGAGTTTTAGTAGGTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 286}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922307713_922307717 24 Left 922307713 1:224358324-224358346 CCAATTGAGCAGCAGTTTTTACT 0: 1
1: 0
2: 0
3: 15
4: 146
Right 922307717 1:224358371-224358393 TCTGAGTTTTAGTAGGTTTGGGG 0: 1
1: 0
2: 1
3: 30
4: 286
922307710_922307717 29 Left 922307710 1:224358319-224358341 CCTCCCCAATTGAGCAGCAGTTT 0: 1
1: 0
2: 0
3: 6
4: 122
Right 922307717 1:224358371-224358393 TCTGAGTTTTAGTAGGTTTGGGG 0: 1
1: 0
2: 1
3: 30
4: 286
922307711_922307717 26 Left 922307711 1:224358322-224358344 CCCCAATTGAGCAGCAGTTTTTA 0: 1
1: 1
2: 1
3: 11
4: 178
Right 922307717 1:224358371-224358393 TCTGAGTTTTAGTAGGTTTGGGG 0: 1
1: 0
2: 1
3: 30
4: 286
922307709_922307717 30 Left 922307709 1:224358318-224358340 CCCTCCCCAATTGAGCAGCAGTT 0: 1
1: 0
2: 2
3: 10
4: 141
Right 922307717 1:224358371-224358393 TCTGAGTTTTAGTAGGTTTGGGG 0: 1
1: 0
2: 1
3: 30
4: 286
922307712_922307717 25 Left 922307712 1:224358323-224358345 CCCAATTGAGCAGCAGTTTTTAC 0: 1
1: 0
2: 0
3: 16
4: 170
Right 922307717 1:224358371-224358393 TCTGAGTTTTAGTAGGTTTGGGG 0: 1
1: 0
2: 1
3: 30
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922307717 Original CRISPR TCTGAGTTTTAGTAGGTTTG GGG Intronic
900723744 1:4200327-4200349 TGTAAGTTTCAGTAGGTTTTTGG - Intergenic
900990993 1:6098304-6098326 TTTGTGTTTCAGAAGGTTTGGGG - Intronic
903155195 1:21437990-21438012 TCTTAGTTTTAGTAGAGATGGGG + Intergenic
907586812 1:55625799-55625821 TCTGAGTTTTCTTAGGTATGGGG + Intergenic
908418597 1:63937327-63937349 TCTGAACTTCAGCAGGTTTGTGG + Intronic
908706504 1:66962475-66962497 CCAGAGTTTCAGTAGGTTTGGGG + Intronic
908815746 1:68031817-68031839 TATCAGTTTTAGGAGGTTTTTGG - Intergenic
909157262 1:72093441-72093463 TCTGAGTTCTCATAGTTTTGGGG + Intronic
909975660 1:82043384-82043406 TCTTAGCTTTTGGAGGTTTGTGG + Intergenic
910300029 1:85695483-85695505 TCTGATGTTTACTAGTTTTGTGG - Intronic
910548541 1:88449255-88449277 TGTAGGTTTTTGTAGGTTTGTGG + Intergenic
910956232 1:92709243-92709265 TCTAAGTCTTAATAGGTATGTGG + Intronic
911895728 1:103432743-103432765 TCTGACTTTTTCTAGGTGTGAGG - Intergenic
912167690 1:107059547-107059569 TGTGATTTTGAGTAGGTTTCTGG + Intergenic
912791783 1:112659334-112659356 TCTGAGTTTTACTTGGCTTAGGG + Intronic
917372761 1:174313341-174313363 GATGAGTTTTAATAGTTTTGTGG + Intronic
917993736 1:180412141-180412163 TCTGATTCTAATTAGGTTTGTGG - Intronic
921450699 1:215302411-215302433 ACTGAGGTTTAGTAGATTTGTGG + Intergenic
922307717 1:224358371-224358393 TCTGAGTTTTAGTAGGTTTGGGG + Intronic
922815049 1:228442895-228442917 TCTTGGTTTTGGTGGGTTTGGGG - Intergenic
922982797 1:229842311-229842333 TCTGAATTTTAGTAGAGATGGGG + Intergenic
923590486 1:235313962-235313984 TATGAGTTTAAGTAGGCTTTCGG - Intronic
923961829 1:239093642-239093664 TCTGTCTTTTAGTAGGCTTCGGG - Intergenic
1063837793 10:10035408-10035430 TTTCTGATTTAGTAGGTTTGCGG + Intergenic
1064166501 10:12991157-12991179 TCTGATTTTTAGTCTATTTGGGG + Intronic
1064929717 10:20611507-20611529 TCTGAGTTTTATGACGTTTAAGG + Intergenic
1065487150 10:26246566-26246588 TCTAATTTTTAGTAGGCTTCAGG - Intronic
1065930657 10:30475945-30475967 TCTGCGTTTTAGTAGAGATGGGG - Intergenic
1068020213 10:51572642-51572664 CCAGAGTTTCAGTAGGTCTGGGG - Intronic
1069026730 10:63550524-63550546 TCTGAGTTTAGGTAGGGGTGGGG + Intronic
1069315077 10:67088570-67088592 TCTGAATTTTGGTAGCTTTATGG - Intronic
1069391763 10:67943740-67943762 TCTGTGTTTTAGTAGTGTTCTGG - Intronic
1070514260 10:77189093-77189115 TTTCTGATTTAGTAGGTTTGGGG + Intronic
1070822491 10:79368931-79368953 TCTGATGTTTGGTAGGTTAGGGG + Intergenic
1071161459 10:82750633-82750655 TCTGAGTTATAGTAATTTTATGG + Intronic
1072832879 10:98677638-98677660 TCTGACCTTTAGTAGATTTGTGG - Intronic
1075191079 10:120309253-120309275 TCTGAGTTTGTGTAGGGATGTGG + Intergenic
1075873528 10:125788479-125788501 TCTGATTCATAGCAGGTTTGTGG + Intronic
1075888909 10:125928389-125928411 TCTTGGTTTTAGTAGGTTTTAGG + Intronic
1076377051 10:129997245-129997267 TATCAGTTTTAATAGGTTTTTGG - Intergenic
1078217833 11:9326712-9326734 TCTGAGTTTTTATAGTTTTGGGG - Intergenic
1078698140 11:13655508-13655530 TATCAGTTTAAGGAGGTTTGGGG - Intergenic
1079091727 11:17485448-17485470 TTTCAGATTTAGTAGGTTAGGGG - Intergenic
1079627894 11:22637863-22637885 TCTGAGATTTTCTTGGTTTGGGG - Intronic
1079658871 11:23016560-23016582 GCTGAGTTTAAGTAAGTTTTTGG + Intergenic
1079806577 11:24938148-24938170 TCTAAGTTTTAGTATTTTTGTGG + Intronic
1080630785 11:34073594-34073616 TCTAATTTTTAGTAGGGATGGGG + Intronic
1080633584 11:34104118-34104140 TATGAGTTTTGAGAGGTTTGGGG - Intergenic
1081271710 11:41093140-41093162 TTTGAGTTAAAGTAGTTTTGTGG - Intronic
1081340529 11:41921951-41921973 TCTGATTGTTATTAGGTTTAGGG + Intergenic
1083137834 11:60696027-60696049 TGTGTGTTTTTTTAGGTTTGGGG - Intergenic
1083286627 11:61663624-61663646 TCTTAGTTTTAGTAGAGATGGGG - Intergenic
1085538143 11:77239443-77239465 TATTAGTTTTAGTATTTTTGTGG - Intronic
1086157482 11:83683576-83683598 TCTGCGTTTTAGTAAATTAGTGG - Intronic
1086265274 11:84990660-84990682 TATGAATTTTAATAGGTATGTGG - Intronic
1087487850 11:98780463-98780485 ACTGAGTTTTTGTATGTTTTGGG - Intergenic
1089768162 11:120783529-120783551 TTTGAAGTTTAGTAGGTTTATGG + Intronic
1090305848 11:125690321-125690343 TCTGATTTTTAGTAGATGTAAGG - Intergenic
1092028441 12:5262910-5262932 TTTGAGTTGTTGTAGGTTTCAGG - Intergenic
1092601950 12:10076643-10076665 TCTGTGTTTTAGAACGTCTGAGG - Intronic
1093530914 12:20162027-20162049 TTTGAGTTTTTGTAGTTTTGTGG + Intergenic
1094026119 12:25960768-25960790 TCTGGGCTTTAGTAGCTTAGGGG + Intronic
1095190848 12:39256412-39256434 GCTTAGAGTTAGTAGGTTTGAGG + Intergenic
1098535987 12:71594069-71594091 TCCCATTTTTAATAGGTTTGGGG - Intergenic
1098900532 12:76107981-76108003 TTTGATTTTTAGTAGATATGGGG - Intergenic
1101309689 12:103564846-103564868 TCTGACTGTTTGTAGGTGTGTGG + Intergenic
1102558365 12:113744102-113744124 TCTGATGTTTGGTAGGTTAGAGG + Intergenic
1104212879 12:126707021-126707043 TATGAGTTTTAGTAGGATTTGGG + Intergenic
1105495734 13:20929247-20929269 TCTAAATTTTAGTAGGTCTATGG - Intergenic
1106647178 13:31649101-31649123 TCTGAGTTTTAGGCAGATTGTGG - Intergenic
1107653243 13:42566099-42566121 CCTAAGTATTAGTAGATTTGGGG + Intronic
1109408044 13:61926217-61926239 TGTTAGGTTTAGTAGGTTTTTGG + Intergenic
1109523209 13:63540279-63540301 TCAGAGTGTTAATGGGTTTGGGG - Intergenic
1110204021 13:72889814-72889836 ACTGAGTTTTAGTACTTTTTAGG + Intronic
1110733005 13:78902641-78902663 GCAGAGTTTTAATAGGGTTGAGG - Intergenic
1111339027 13:86860007-86860029 AGTGAGTTTTAGCAGGTGTGGGG - Intergenic
1112143350 13:96670991-96671013 TATGAATTTTAGTAGCTTTAGGG + Intronic
1112933283 13:104768336-104768358 TCTCTGATTTAGTGGGTTTGAGG - Intergenic
1114252624 14:20974307-20974329 TCTGAGATTATTTAGGTTTGAGG + Intergenic
1115216530 14:31018948-31018970 TTTGAATTTTAGTAGGGATGGGG - Intronic
1115730406 14:36262499-36262521 TGTTAGTTTTAGTCGGTGTGAGG + Intergenic
1116149075 14:41115586-41115608 TATTAGTTTTAATAGGTTTTTGG - Intergenic
1116184986 14:41588553-41588575 TATGAATTTTAGGAGGTTTTTGG - Intergenic
1116559971 14:46365782-46365804 TCTGTGTTTTAGTTCTTTTGAGG + Intergenic
1117101444 14:52352431-52352453 TCTGATAATTAGTTGGTTTGGGG - Intergenic
1117923324 14:60748401-60748423 TTTGATTTTTAGTAGGGATGAGG + Intronic
1119661201 14:76453044-76453066 TCTCAGATTCAGTAGGTCTGGGG - Intronic
1120259305 14:82161602-82161624 TCTGAGTTTTAAAAGGCTTTTGG + Intergenic
1122401322 14:101469246-101469268 TCTGAGTGGAAGTTGGTTTGGGG - Intergenic
1122920770 14:104879071-104879093 TCTCAGGTTAAGTAGCTTTGGGG + Intronic
1126179535 15:45771462-45771484 TCTGTGTTGTATGAGGTTTGGGG - Intergenic
1126224882 15:46259516-46259538 CCTGAGTTTTTTTAGGTTGGTGG + Intergenic
1128432004 15:67605225-67605247 TCTGTATTTTAGTAGGGATGGGG + Intronic
1129643279 15:77405176-77405198 TTTGTGTTTTAGTAGGGATGGGG + Intronic
1131904241 15:97124738-97124760 TTTGATTTTTTGTAGGGTTGAGG - Intergenic
1134048187 16:11116875-11116897 GCTGAGTTTTAGTATATTTATGG - Intronic
1135379099 16:21978956-21978978 TGTGAGTTTTGGCAGGTTTCGGG - Intronic
1138026444 16:53525884-53525906 ACTGAGTTTTAGTGCTTTTGTGG + Intergenic
1139276506 16:65732736-65732758 ACTGAGTTCTAGAAAGTTTGGGG + Intergenic
1139398680 16:66662357-66662379 TCTGGGTTTTTCTGGGTTTGAGG - Intronic
1140307979 16:73821480-73821502 TCTGAGGCTTAGAGGGTTTGTGG - Intergenic
1141385023 16:83614231-83614253 TCTGAGATGGAGTTGGTTTGTGG + Intronic
1143595441 17:7911170-7911192 CCAGAGTTTTAGTAGATCTGTGG + Intronic
1143709773 17:8726173-8726195 TGTGGGCTTGAGTAGGTTTGCGG + Intergenic
1144114016 17:12068010-12068032 AGTGAGTTTTACTAGATTTGGGG + Intronic
1144492379 17:15724769-15724791 TGTAAGTTTTGGAAGGTTTGGGG - Intergenic
1144504014 17:15814384-15814406 TTTAAATTTTAGTAGGTTTTTGG - Intergenic
1144805817 17:17966520-17966542 TTTCTGTTTCAGTAGGTTTGGGG - Intronic
1144908092 17:18654417-18654439 TGTAAGTTTTGGAAGGTTTGGGG + Intronic
1146098768 17:29958852-29958874 TCACAGTGTTAGTGGGTTTGGGG - Intronic
1148119082 17:45197263-45197285 CCTGAGTTTGAGTAGGTCAGGGG + Intergenic
1148869807 17:50650500-50650522 TAAGAGTTGTAGGAGGTTTGTGG - Intronic
1149377508 17:56060308-56060330 TCTCAGTTTAAGGAGTTTTGGGG + Intergenic
1150998739 17:70349632-70349654 TCTCTGATTTAGTAGGTCTGTGG + Intergenic
1151118895 17:71770296-71770318 TCTGAGTTTTAGTAGGAGAAAGG + Intergenic
1151281877 17:73082098-73082120 TTTTAGTTTCAGTAGGTTTTGGG - Intronic
1153340397 18:3967469-3967491 TCTGGGATTCAGTAGGTCTGGGG - Intronic
1153386055 18:4498275-4498297 TGTCAGTTTCTGTAGGTTTGAGG + Intergenic
1153426077 18:4965617-4965639 TATCAGTTTTAGTAGTTTTTTGG - Intergenic
1153551204 18:6263332-6263354 TCTGAGTTTTAGATGTTTTGGGG - Intronic
1154410170 18:14135898-14135920 TCTGAGTTTCAGTATCTTTGGGG + Intergenic
1155266703 18:24101432-24101454 TCTGAGTTTTAGTAGAGACGGGG - Intronic
1156221901 18:35061227-35061249 TGTGAGTTTTATCAGGTTTGAGG - Intronic
1158778681 18:60619491-60619513 TTTGTGTTTTAGTAGGAATGGGG - Intergenic
1158897991 18:61933477-61933499 TCTGGGTTTTAAAAGCTTTGAGG + Intergenic
1162467871 19:10853456-10853478 TTTGAGTTTTAGTAGAGATGGGG + Intronic
1162730180 19:12713853-12713875 TCTAAGTTTTAGTAGAGATGAGG - Intronic
1164913936 19:32034763-32034785 TCTGTCATTTAGTAGGTTTCAGG + Intergenic
1168178905 19:54646208-54646230 TTTAAGTTTCAGTAGTTTTGGGG - Intronic
1168535672 19:57167377-57167399 ACTGAGCTTTTGTTGGTTTGGGG - Intronic
927107163 2:19837680-19837702 AATGAGTTTGAGGAGGTTTGGGG - Intergenic
927404477 2:22751625-22751647 TCTGAGTTTCAGATGTTTTGAGG - Intergenic
927585027 2:24295182-24295204 GCAGAGTTTTAGTAGGTCTATGG + Intronic
928288359 2:30014134-30014156 TATGAGTGGTAGGAGGTTTGGGG - Intergenic
929479607 2:42292098-42292120 TCTGAATTATAGGAGTTTTGTGG + Intronic
929911003 2:46089485-46089507 TCTGTGTTTTAGAAGAATTGTGG - Intronic
930442137 2:51422290-51422312 TCTGAGGTTTAGTAGAATTCTGG - Intergenic
931895930 2:66729577-66729599 TCTGTGAGTAAGTAGGTTTGTGG - Intergenic
931997763 2:67855474-67855496 TTTGAGTTTTAGTAGAGGTGAGG - Intergenic
932696572 2:73961856-73961878 TCTGATTTTTAGTAGAGATGGGG - Intergenic
933442385 2:82329354-82329376 TCAGGGATTTAGTAAGTTTGGGG - Intergenic
933778592 2:85786649-85786671 CCTGCGTTTTGGTTGGTTTGGGG - Intronic
937224425 2:120360080-120360102 TCCGAGGTTTAGTGGCTTTGGGG + Intergenic
937940991 2:127285900-127285922 AATGAGTTTTAGTAAATTTGTGG - Intronic
939001992 2:136747365-136747387 TCTGATGTTTGGCAGGTTTGGGG - Intergenic
941436486 2:165479710-165479732 TTTGATTTTTAGTAGGGATGGGG - Intronic
942639023 2:178041110-178041132 TTTGAGTTTTAGTAGATACGAGG + Intronic
942971834 2:181966183-181966205 TATGAGTTCTAATAGGTTTTTGG + Intronic
945535660 2:211014764-211014786 TCTGAGTTTTGGAAGGTTAAAGG - Intergenic
948032687 2:234832147-234832169 TTTAAGTGTTATTAGGTTTGGGG + Intergenic
1168989494 20:2082088-2082110 TTTCTGGTTTAGTAGGTTTGGGG - Intergenic
1169014652 20:2281805-2281827 TCTGCCTTTTAGTAGCTGTGTGG + Intergenic
1169329205 20:4703471-4703493 TTTCTGTTTTAGTAGTTTTGTGG - Intergenic
1169949511 20:11027736-11027758 TCTGTGTTTTGAAAGGTTTGAGG + Intergenic
1170393742 20:15903562-15903584 TCTCTGATTCAGTAGGTTTGGGG + Intronic
1170780098 20:19417717-19417739 TCAGAGTTCTGCTAGGTTTGGGG - Intronic
1172001054 20:31777287-31777309 ACTGAGTACTATTAGGTTTGAGG - Intronic
1172859766 20:38039100-38039122 TCTGAGTTACAGTTGCTTTGGGG - Intronic
1173056665 20:39621053-39621075 TATGAGTTCTAGTATTTTTGTGG - Intergenic
1173063489 20:39684406-39684428 TCAGAGTTTCTGTAGGTCTGTGG - Intergenic
1173191398 20:40879044-40879066 TTTAAATTTCAGTAGGTTTGGGG - Intergenic
1173382045 20:42554275-42554297 TAAGAATTTCAGTAGGTTTGGGG - Intronic
1173968983 20:47136452-47136474 TCTGAATTATAGGAGGTTGGTGG - Intronic
1174752595 20:53126448-53126470 GCTGAGTATTTGTAGGTTTGGGG + Intronic
1175370888 20:58489957-58489979 TCTGAATTTTATTGTGTTTGTGG - Intronic
1175444405 20:59010167-59010189 TTTGAGTTTGGGTGGGTTTGTGG - Intergenic
1175808352 20:61844118-61844140 TCTGAGTTTTACTTGGGATGGGG - Intronic
1176862891 21:14022513-14022535 TCTGAGTTTCAGTATCTTTGGGG - Intergenic
1177916401 21:27093499-27093521 CCTGTGTTTTAGTAGCTCTGGGG - Intergenic
1178564419 21:33669745-33669767 TTTAAGTTTTAATATGTTTGTGG + Intronic
1178682414 21:34683979-34684001 CCAGATTTTTACTAGGTTTGTGG + Intronic
1178693712 21:34774147-34774169 TCTGAGTTTCAGTACCTGTGAGG + Intergenic
1180098917 21:45575234-45575256 TCTGGGTTTCTGTAGGTTGGTGG + Intergenic
1181404254 22:22671088-22671110 TCTGAGTTTTAGAATTTTTGTGG - Intergenic
1181519877 22:23439936-23439958 TCTTGGTTTTGGTGGGTTTGGGG - Intergenic
1184325943 22:43785165-43785187 TGTGAGGTCTAGTTGGTTTGTGG - Intronic
949442691 3:4099722-4099744 TATCAGTTCTAGTAGGTTTTGGG - Intronic
949657908 3:6242501-6242523 TCTGCATTTTCGTTGGTTTGAGG + Intergenic
950602728 3:14049085-14049107 TCTGAGTTTTTGTAGAGATGGGG - Intronic
951040899 3:17987978-17988000 TCTGAGTTTTTGTGGGGGTGGGG + Intronic
951350672 3:21603043-21603065 TCTGAATGATAGTAAGTTTGGGG - Intronic
951401681 3:22240339-22240361 TCTGACTTGTAGTTAGTTTGTGG - Intronic
951414173 3:22402804-22402826 TGGGAGTTTTATTAGGTTGGTGG + Intergenic
953988032 3:47460728-47460750 TCTTATTTTTAGTAGATATGGGG + Intronic
954478251 3:50769955-50769977 TCTTAGTTTTAATAGTTTTTTGG - Intronic
955616714 3:60816118-60816140 TCTGAGTTCTAGGAGGCTTTTGG + Intronic
956131711 3:66060215-66060237 TCAGAGTTTTAATATTTTTGAGG - Intergenic
957158951 3:76583769-76583791 TATGGGTTATAGTAGATTTGGGG - Intronic
957395145 3:79626763-79626785 TATTAGTTTGAGGAGGTTTGGGG - Intronic
957433745 3:80148212-80148234 TATCAGTTTAAGGAGGTTTGGGG + Intergenic
958271726 3:91508367-91508389 TTTTAGTTTTAGTAGGGATGGGG - Intergenic
958547800 3:95577705-95577727 CCTCATTTTTAGTAGCTTTGTGG - Intergenic
959510370 3:107203833-107203855 ATTGATTTTGAGTAGGTTTGTGG - Intergenic
960914622 3:122682744-122682766 TTTGAGTTTTAATAAGTTTTGGG - Intronic
963940437 3:151091379-151091401 TCTAAGATTCAGTAGGTCTGAGG + Intronic
965256500 3:166420351-166420373 TATGAGCTTTAGAAGCTTTGGGG + Intergenic
965595101 3:170402675-170402697 TATGAGTTCTAGTAGTTTTATGG + Intergenic
965622156 3:170652732-170652754 TTTGGGTTTTAGTAGCTTTGTGG + Intronic
965956788 3:174379704-174379726 TCTGATTTTTAGTAGAGATGGGG - Intergenic
966498267 3:180605453-180605475 TTTGATTTTTAGTAGAGTTGGGG + Intronic
967282048 3:187832350-187832372 CCTGAGTTTGAGTAGCTGTGTGG + Intergenic
967404999 3:189105537-189105559 TATGAGTTTGAGTAGGTATGTGG + Intronic
967508743 3:190285481-190285503 TCTCACTTTTAATAGTTTTGTGG + Intergenic
967690128 3:192464142-192464164 TTTTAGTTTCAGTAGGTCTGGGG + Intronic
970117668 4:12717548-12717570 TCTGAGTGTTAACAGGTTTCTGG + Intergenic
971370279 4:26013530-26013552 TCTGACTTTTAATAGGTTTGGGG + Intergenic
973318829 4:48789276-48789298 TCTGATGTTTGGTAGGTTGGGGG - Intergenic
974787412 4:66637098-66637120 TCTATTTTTTAGTAGGTTTGTGG + Intergenic
975274693 4:72483255-72483277 TTGTAGTTTTAGTAGGTTTTTGG - Intronic
975898330 4:79121495-79121517 TCCCAGTTTTTGTGGGTTTGTGG - Intergenic
976677931 4:87724052-87724074 GCTCAGTTTTAATAGTTTTGTGG - Intergenic
978208488 4:106107748-106107770 TCTCAGTTCTATTAGCTTTGAGG - Intronic
978635865 4:110805567-110805589 TCTTTGTCTTAGTAAGTTTGAGG + Intergenic
978661944 4:111137518-111137540 TCTGAGATTTGCTAGGTTTCAGG - Intergenic
979753024 4:124302967-124302989 TTTGTGTTTTAGTAGGGATGGGG - Intergenic
980284444 4:130763976-130763998 TCTGAGGTGTAGTAGGCTGGTGG + Intergenic
980536903 4:134136895-134136917 TCTGAGCTATAGTTAGTTTGAGG + Intergenic
982030420 4:151294996-151295018 TCTGAGTTTAGGTGGGTGTGAGG + Intronic
982186994 4:152812661-152812683 TCTGAATTTGAGAATGTTTGTGG - Intronic
982220215 4:153118208-153118230 TCTTAGTTTTGGTGGGTTTTAGG - Intergenic
982261479 4:153498096-153498118 TCTGAGTTTATGTAAGTTTGAGG + Intronic
983095854 4:163560895-163560917 TCTTAGTCTTAGTAGCTTTTTGG + Intronic
983338816 4:166431106-166431128 TCTGAGATGTGTTAGGTTTGGGG + Intergenic
983561775 4:169108838-169108860 TCTAAGCTTTAGTAGGTGTAGGG - Intronic
983727146 4:170942375-170942397 TATCAGTTTAAGTAGGTTTTGGG - Intergenic
983916001 4:173291228-173291250 TCTGGGTTATAGTTTGTTTGGGG + Intronic
984887385 4:184462160-184462182 AGTGAATTCTAGTAGGTTTGGGG - Intronic
987044506 5:14094641-14094663 GATGAGTTTTAGGGGGTTTGGGG - Intergenic
989353724 5:40517514-40517536 TTTGAGTTTAAGTTGTTTTGTGG - Intergenic
989395895 5:40956267-40956289 TCTGGGTTTTGGAAGGTTTACGG + Intronic
991286066 5:64977613-64977635 ACTGAGTTCTAAAAGGTTTGTGG - Intronic
992133358 5:73718047-73718069 TCTGATTTTTAGTAGAGATGGGG + Intronic
993274315 5:85836675-85836697 TGTGAGTTTTTGCTGGTTTGTGG + Intergenic
993785262 5:92124896-92124918 GATGACTTTTTGTAGGTTTGTGG - Intergenic
994873819 5:105389358-105389380 TCTGAGTTTTTGTTTGTTTAAGG - Intergenic
996567356 5:124893403-124893425 TCTTACTTTCGGTAGGTTTGTGG - Intergenic
999029447 5:148274995-148275017 TCTCAGTTTTAATAAGTTTTGGG + Intronic
1000668995 5:164036643-164036665 TCTGAGTTTTTGCAGTTGTGAGG + Intergenic
1003982231 6:11400963-11400985 TTTCATTTTTAGTAGATTTGGGG - Intergenic
1007015931 6:38466629-38466651 TGTGAGTTTTTGTTGGTTTGTGG + Intronic
1008064357 6:47031675-47031697 TCCAAGATTTAGTAGGTTTAGGG - Intronic
1008289253 6:49693535-49693557 TTTGAGTTTTATTGAGTTTGAGG - Intronic
1008362282 6:50634620-50634642 TATGAGTTCTAATAGATTTGTGG - Intergenic
1008941308 6:57048316-57048338 TTTTAGTTTTTGTAGGTTTAGGG + Intronic
1009313318 6:62185719-62185741 TCAGAATTTTAGTGGGTTTAGGG - Intronic
1010124000 6:72411862-72411884 TCAGAGTTATATTTGGTTTGTGG - Intergenic
1010299149 6:74239116-74239138 TATCAGTTTGAGTAGTTTTGTGG + Intergenic
1010500808 6:76597236-76597258 TCTGTGTTTCAGTAGGTTTTTGG - Intergenic
1010550295 6:77213604-77213626 TTTCCGATTTAGTAGGTTTGGGG - Intergenic
1011740571 6:90355545-90355567 TCTGACTTTTAGTAGAGATGAGG + Intergenic
1012648799 6:101724829-101724851 TCTGAGAAATAGGAGGTTTGAGG + Intronic
1013023143 6:106240541-106240563 TCTGATTTTTAGTAGTATTGTGG - Intronic
1016040608 6:139428358-139428380 TATTAGTTTTAGTAGGGATGGGG + Intergenic
1016134798 6:140526714-140526736 TCTAAGTTTTTATAGATTTGGGG + Intergenic
1016635099 6:146279691-146279713 TTTGAGTTTTAGTGAGCTTGTGG + Intronic
1016988561 6:149913074-149913096 TCTGAGTTCTAGTAGCCCTGGGG + Intergenic
1018835658 6:167481607-167481629 TCTTGGTTTTGGTTGGTTTGGGG + Intergenic
1019591382 7:1836344-1836366 TCTTGGTTTTGGTGGGTTTGGGG + Intronic
1020246879 7:6436319-6436341 TTTGAGTTTCAGTGGATTTGAGG - Intronic
1020762433 7:12284826-12284848 TCAGAGTTTAGGTAAGTTTGAGG + Intergenic
1022335281 7:29415971-29415993 TGTAAGTTTTACTGGGTTTGGGG + Intronic
1022616342 7:31934680-31934702 TCTGATTTGTGGTACGTTTGAGG + Intronic
1025860698 7:65324836-65324858 TTTGTGTTTTAGTAGGGATGGGG + Intergenic
1026100832 7:67383365-67383387 TTTGATTTTTAGTAGATGTGGGG - Intergenic
1026221687 7:68403712-68403734 TATTAGTTCTAGTAGGTTTGTGG - Intergenic
1026440313 7:70438273-70438295 TCTGAGCTTGAGTAGATTTCAGG + Intronic
1027236458 7:76301145-76301167 TCTGAATTTTAGTAGAGATGGGG + Intergenic
1028331769 7:89603810-89603832 ACTGTGTTTTAGTAGGAGTGAGG - Intergenic
1028550287 7:92053832-92053854 CCTCAGTTTCAGTAGGTCTGGGG - Intronic
1028719813 7:94016218-94016240 TATGTGTTTGACTAGGTTTGGGG - Intergenic
1030177443 7:106669524-106669546 TATCAGGTTTAGTAGGTTAGGGG - Intergenic
1032830506 7:135620359-135620381 TCTGATTTTTAGTAGAGATGGGG - Intronic
1034180403 7:149133060-149133082 TCTTGGTTTTGGTAGGTTTTAGG + Intronic
1035575065 8:699123-699145 GCTGATATTTAGTGGGTTTGGGG - Intronic
1037591945 8:20320118-20320140 TCTGATTTTTAGTAGAGATGAGG + Intergenic
1039321057 8:36431955-36431977 GTTGAGTTTTAATAGGTTTTTGG - Intergenic
1041692051 8:60698052-60698074 TGTGAGTTTTAATAGATTTTTGG - Intronic
1042268865 8:66935983-66936005 TTTGTTTTTTAGTAGGTTTATGG + Intergenic
1043117009 8:76269501-76269523 TCTGAGATTTGGGAAGTTTGGGG - Intergenic
1044342438 8:91062285-91062307 TCTGATTTTTAAAATGTTTGGGG + Intergenic
1044524802 8:93240441-93240463 TCAGAGTTTTACTATGCTTGGGG + Intergenic
1044804500 8:95991390-95991412 TCTGTCATTCAGTAGGTTTGAGG + Intergenic
1045304672 8:100949433-100949455 GCAGAGATCTAGTAGGTTTGGGG - Intronic
1045447412 8:102281820-102281842 CCAGAGTTTTAGTAGGTCTGGGG + Intronic
1047244288 8:123125650-123125672 TGTGAATTTTAGTAGATTTGAGG + Intronic
1048459032 8:134604595-134604617 CCTGATTATTAGTATGTTTGAGG - Intronic
1048863822 8:138744253-138744275 TCTGATTTCTAGTAGATTTGAGG - Intronic
1048950218 8:139490599-139490621 TGTGAGTTTATGTATGTTTGTGG + Intergenic
1050409193 9:5343867-5343889 TCTTTATTTCAGTAGGTTTGGGG - Intergenic
1051524108 9:18023267-18023289 TATCAGCTTTAGTAGGTCTGGGG + Intergenic
1051582135 9:18688492-18688514 TCTGAGTTTTAGTAGAGACGAGG - Intronic
1051600875 9:18872340-18872362 TATTAATTTCAGTAGGTTTGGGG + Intronic
1052348386 9:27433431-27433453 TCAGATGTTTAGTAGATTTGAGG + Intronic
1054826834 9:69581801-69581823 GCTGAGTTTTAGTCTCTTTGAGG + Intronic
1055331497 9:75188452-75188474 TCTGATTTTTAATTGGTCTGTGG + Intergenic
1056778995 9:89535397-89535419 TCTGAGTTTTATTGGGGTTGTGG + Intergenic
1057156418 9:92844432-92844454 TCTGTGGTTTAGTGGTTTTGGGG - Intergenic
1058159574 9:101553663-101553685 ACTGAGATTCAGTAGGTCTGGGG - Intronic
1058198917 9:102013733-102013755 TCTCAGTTCTAGGAGCTTTGGGG - Intergenic
1058921174 9:109616425-109616447 GCTGAGTCTTAGGAGGATTGAGG + Intergenic
1059011828 9:110469562-110469584 CTTGAGATTTGGTAGGTTTGGGG + Intronic
1059146800 9:111907041-111907063 ATTGAGTTTCAGTAGTTTTGGGG + Intronic
1059881298 9:118692634-118692656 TCTGAGTTTTGTTAGTTTGGTGG + Intergenic
1060123950 9:121024033-121024055 TTTTAGTTTTAGTAGGGATGAGG - Intronic
1186969571 X:14826121-14826143 TCTGCCTTTTAGAAGTTTTGGGG + Intergenic
1187559846 X:20391934-20391956 TATGAGTTTTAGTAGCTTTTTGG - Intergenic
1187578510 X:20583438-20583460 TCTGAGTGACAGCAGGTTTGAGG - Intergenic
1188284347 X:28310166-28310188 TCTTGGTTTTAGTGGGTTTGGGG - Intergenic
1190376573 X:49794283-49794305 TCTGAGTTTTAGGTGTTTTGAGG + Intergenic
1190437691 X:50442700-50442722 TCTCAGTTTCTGTAGGTTAGAGG + Intronic
1190920984 X:54852240-54852262 TCTAAGATTTAGGAGGTTAGAGG - Intergenic
1191895824 X:65992181-65992203 TCTAATTTTTAGTATGTATGTGG - Intergenic
1192257661 X:69477889-69477911 TATTAGTTCTAGGAGGTTTGGGG - Intergenic
1194131732 X:90089978-90090000 TCTGGTTTTTAGTAGTTATGTGG - Intergenic
1194382127 X:93206626-93206648 TTTAACTTTTATTAGGTTTGGGG - Intergenic
1198078850 X:133219615-133219637 TATGAGTTTTAGTGGGTAGGGGG + Intergenic
1199140636 X:144307685-144307707 TCTGGGTCTTAGTATGTGTGAGG - Intergenic
1201930293 Y:19337546-19337568 TTTAAATTTTAGTAGTTTTGGGG + Intergenic