ID: 922308311

View in Genome Browser
Species Human (GRCh38)
Location 1:224363978-224364000
Sequence AGTGTACTGAGAACAAATTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 184}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922308307_922308311 12 Left 922308307 1:224363943-224363965 CCAAGTTCCTTCATGGAGGATAT 0: 1
1: 0
2: 1
3: 12
4: 139
Right 922308311 1:224363978-224364000 AGTGTACTGAGAACAAATTCGGG 0: 1
1: 0
2: 1
3: 12
4: 184
922308306_922308311 15 Left 922308306 1:224363940-224363962 CCTCCAAGTTCCTTCATGGAGGA 0: 1
1: 0
2: 0
3: 7
4: 151
Right 922308311 1:224363978-224364000 AGTGTACTGAGAACAAATTCGGG 0: 1
1: 0
2: 1
3: 12
4: 184
922308308_922308311 5 Left 922308308 1:224363950-224363972 CCTTCATGGAGGATATGAGTCTA 0: 1
1: 0
2: 0
3: 8
4: 110
Right 922308311 1:224363978-224364000 AGTGTACTGAGAACAAATTCGGG 0: 1
1: 0
2: 1
3: 12
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922308311 Original CRISPR AGTGTACTGAGAACAAATTC GGG Intronic
904100182 1:28019492-28019514 AATGTACTGATAACAAAATCTGG - Intronic
907994644 1:59617610-59617632 AGTGTTCTGTGGACAAAGTCTGG - Intronic
909111792 1:71488314-71488336 AGTGTTCTGGGAGCTAATTCTGG + Intronic
909737847 1:78987542-78987564 ACTGTACTGAGAAAAATTTTAGG + Intronic
910316988 1:85897020-85897042 AGTTGATTAAGAACAAATTCTGG - Intronic
911355553 1:96814372-96814394 AGTGTACTGCGAAAATATGCAGG + Exonic
913543769 1:119846541-119846563 AGTGTACTGGGACCAAAATTCGG + Intergenic
918984447 1:191605680-191605702 ACTAAACTGAGAACAAATCCTGG + Intergenic
919483725 1:198120883-198120905 TGTGTGCTGTGAAAAAATTCAGG - Intergenic
920664982 1:207956771-207956793 AGGGTGATGAGAAGAAATTCAGG - Intergenic
921711145 1:218374519-218374541 AGTGTACAGAGAACTGCTTCTGG - Intronic
921994396 1:221401901-221401923 AGTTTAGTGATAAAAAATTCAGG + Intergenic
922308311 1:224363978-224364000 AGTGTACTGAGAACAAATTCGGG + Intronic
924198146 1:241631614-241631636 AGTGTATTCCGAACAAATTTTGG + Exonic
1067683340 10:48453679-48453701 ATTGTAGTGGGCACAAATTCTGG + Intronic
1072857004 10:98958021-98958043 AGTTTACAGAGAGCAAATGCTGG - Intronic
1074588998 10:114794842-114794864 AGTATAGTGAGAAAAAATACAGG + Intergenic
1075436614 10:122448918-122448940 AATCCACTAAGAACAAATTCTGG - Intergenic
1078504252 11:11919064-11919086 TGTGTTCTGAGAACAAAATAGGG + Intronic
1081258381 11:40926292-40926314 TGTCTACTGAGCACAAATTAGGG - Intronic
1081299447 11:41432771-41432793 GGTGTAATGAGACCAAAATCAGG + Intronic
1081381489 11:42421880-42421902 AATGTACTGAATGCAAATTCAGG + Intergenic
1081545248 11:44066900-44066922 AAAGTACTTAGAACAAATCCTGG - Intronic
1082949679 11:58799231-58799253 TGGATCCTGAGAACAAATTCTGG - Intergenic
1083422997 11:62566479-62566501 AGAGCTCTGAGAACAAATACAGG - Intronic
1085541350 11:77273249-77273271 ATTGTACTCAGAATAAATTTAGG - Intronic
1085583285 11:77675315-77675337 AGAGTTCTGAGTTCAAATTCTGG + Intronic
1086646265 11:89224693-89224715 ACTGTATTGAGAATGAATTCAGG - Intronic
1087655588 11:100919047-100919069 AGGGTACAGGGGACAAATTCTGG + Intronic
1087947888 11:104186446-104186468 AGGATACTGAGAGCAAATCCAGG - Intergenic
1088761919 11:112938993-112939015 AGAGTTCTTAGAACAAATTACGG - Intergenic
1090603072 11:128392547-128392569 AGTGTTCAGAAGACAAATTCTGG - Intergenic
1094066363 12:26364819-26364841 AGGGTACACAGAACAAATTGGGG - Intronic
1094720748 12:33061177-33061199 AGTGTAATGAGTAAAATTTCAGG - Intergenic
1095605651 12:44064054-44064076 GGATTACTGAGAACCAATTCTGG + Intronic
1095956128 12:47807334-47807356 AGGGTACTTAGAACAACTCCTGG - Intronic
1100154029 12:91775835-91775857 AATGCATTGAGCACAAATTCTGG + Intergenic
1100625885 12:96331478-96331500 AGCATACTGAATACAAATTCAGG + Intronic
1100838277 12:98587792-98587814 AGACAACGGAGAACAAATTCAGG - Intergenic
1101252536 12:102950380-102950402 AGTGTACTCCTAACAGATTCAGG - Intronic
1101569471 12:105939940-105939962 AGTGTAGGGAGGACAAGTTCTGG - Intergenic
1105826461 13:24127471-24127493 AGTCTACTGAGAACAGCCTCTGG + Intronic
1108707697 13:53005005-53005027 AGTGTGCTTAGAACAATTTCTGG + Intergenic
1109577414 13:64279860-64279882 AGTTTTCTAAGAATAAATTCTGG + Intergenic
1109595264 13:64544700-64544722 ATTGTAATGAGAAAAAACTCAGG + Intergenic
1109639422 13:65169286-65169308 AATGTACTGAAAACATTTTCTGG - Intergenic
1109996747 13:70137546-70137568 AGTGTACTACAAACAAAATCTGG - Intergenic
1110252877 13:73400507-73400529 AATGTGCTGAGACCTAATTCAGG - Intergenic
1110506210 13:76290081-76290103 AGAATATTGAGAACAAATTTAGG + Intergenic
1112003796 13:95236854-95236876 AGTTTACTGAGATGAAAATCTGG + Intronic
1117213904 14:53529870-53529892 AAGGTGCTGAGAACAACTTCAGG + Intergenic
1118408809 14:65454579-65454601 AGTCTACTGAAAACAATTTTAGG - Intronic
1121442054 14:93955638-93955660 AGTGTCGTGAGAACACTTTCAGG + Intronic
1122566669 14:102662937-102662959 AGTGTACTGTAAATAAGTTCAGG - Intronic
1124901808 15:33830597-33830619 AATGTACTCAGAACAACGTCTGG + Intronic
1125256946 15:37775450-37775472 TATATACAGAGAACAAATTCAGG + Intergenic
1126569479 15:50134839-50134861 AGTGAACGTGGAACAAATTCTGG + Intronic
1130292478 15:82615121-82615143 GATGACCTGAGAACAAATTCTGG - Intronic
1137702697 16:50508248-50508270 AGTGTCCTGGGAACAAAGGCGGG - Intergenic
1138195867 16:55051713-55051735 AGTGTTCTCAGACCACATTCAGG + Intergenic
1141401604 16:83752019-83752041 AGAGTACTGAGTACAGAATCAGG + Intronic
1146076777 17:29737744-29737766 AGTGTTCTGAGAATAATTGCTGG - Intronic
1147849520 17:43431032-43431054 AGGGTGCAGAGAACACATTCAGG - Intergenic
1149823570 17:59804744-59804766 AGTGTAATGAAAACAAAACCAGG - Intronic
1152049895 17:77965203-77965225 AGTGTATTGAGTTTAAATTCTGG - Intergenic
1153177962 18:2400165-2400187 AGTGTCCTGTGAACCAAGTCAGG - Intergenic
1155070010 18:22306745-22306767 AGTGTACTGAGAATATATATGGG + Intergenic
1155853029 18:30796397-30796419 AATGTACTGAGAACCAAATAAGG - Intergenic
1157390671 18:47300221-47300243 AGTGGTCTGAGAACACTTTCTGG - Intergenic
1157828450 18:50833941-50833963 AGTGCACAGAGAATAAAATCAGG - Intergenic
1158136862 18:54217274-54217296 ATTATACTGAGAACAAAGACAGG + Intronic
1158754929 18:60311341-60311363 AGAGAACTGAGTACAAATTTTGG + Intergenic
1159870073 18:73751177-73751199 TGTGTTCTGAGAACAAGTTAGGG - Intergenic
1163918244 19:20261781-20261803 AGAGGCCTGAGAACAAATTCTGG + Intergenic
1164023859 19:21332378-21332400 AGTGTTCAGAAAACAGATTCTGG + Intergenic
1165701227 19:37939699-37939721 ATAGTACTGAGATTAAATTCTGG - Intronic
926489641 2:13507954-13507976 AGTGTCCTGAGAACAAAATGTGG + Intergenic
928671549 2:33608247-33608269 AGTGTACTGGGAACAAAACAGGG + Intergenic
928872582 2:35998223-35998245 AATGTACTGTGATCAATTTCAGG + Intergenic
929382124 2:41365500-41365522 AGGAGACAGAGAACAAATTCGGG + Intergenic
931095850 2:58939893-58939915 ATTGTTCAGATAACAAATTCTGG - Intergenic
933885799 2:86719112-86719134 AGTGAGCTGAGAAGAACTTCAGG + Intronic
933924381 2:87077593-87077615 AGTGAGCTGAGAAGAACTTCAGG - Intergenic
937074767 2:119094747-119094769 AGTCTACTGAGCACCACTTCAGG + Intergenic
938624479 2:133093407-133093429 ATAGTAATGTGAACAAATTCAGG - Intronic
939174479 2:138733835-138733857 AGTGTCCTGAAAACAAAGTCAGG + Intronic
939973843 2:148693654-148693676 AGTGTACTGAGACTACACTCTGG - Intronic
940613458 2:156020782-156020804 AGGGTACTGATACCAAATTGAGG + Intergenic
941648598 2:168068463-168068485 AGTGACATGGGAACAAATTCTGG + Intronic
947392431 2:229652988-229653010 AGAGTACTAACAGCAAATTCCGG - Intronic
948682632 2:239646317-239646339 AGTGTACAGAGAGAACATTCTGG - Intergenic
1168906280 20:1406392-1406414 ATTGCACTCAGAAAAAATTCAGG + Intergenic
1173509394 20:43614613-43614635 AGTGTAAAGAGAATACATTCAGG + Intronic
1175138279 20:56841308-56841330 AGTCTTCGGAGAACTAATTCAGG + Intergenic
1175655780 20:60769198-60769220 TGAGAACTGAGAACAAATTCTGG - Intergenic
1177615470 21:23512211-23512233 TGTGTAGTCAGAAAAAATTCTGG + Intergenic
1178134116 21:29606924-29606946 AGTGGTCTGAGACCAAATACAGG - Intronic
1178174394 21:30079468-30079490 ACTGTCCTGTGAACAAATCCAGG - Intergenic
1178436510 21:32564013-32564035 ATAGAACTGAGAACAAATGCGGG - Intergenic
1182756180 22:32681425-32681447 AGTGTATCTAGAACAAATCCAGG - Intronic
1182936296 22:34225259-34225281 ACTGTGCTGAGAACAAAGGCTGG + Intergenic
1184655561 22:45940342-45940364 AGTGGGCTGAGCACAAACTCTGG - Intronic
1185248531 22:49786790-49786812 AAAGTACTGAGAATGAATTCAGG - Intronic
950479244 3:13234508-13234530 GGGGTACTTAGAAGAAATTCAGG - Intergenic
952247699 3:31613173-31613195 ATTTTAAAGAGAACAAATTCAGG - Intronic
952822471 3:37497119-37497141 AATGTACTGAGAACATAAACAGG - Intronic
956221743 3:66911624-66911646 ACTGGACTGAGACCAAATTAGGG + Intergenic
957509981 3:81175068-81175090 TGTGTAGATAGAACAAATTCAGG - Intergenic
957799303 3:85054373-85054395 AATGAACTGAGAAATAATTCTGG + Intronic
958543184 3:95507422-95507444 ATTTTACTGAGTACAATTTCTGG - Intergenic
959207553 3:103329992-103330014 AGTTTACTGAGAAGAAACTGTGG + Intergenic
960413525 3:117357148-117357170 AATGAACTGAGATCAAATCCTGG - Intergenic
960576470 3:119234785-119234807 TCAGTATTGAGAACAAATTCAGG + Intronic
960789464 3:121412260-121412282 AGTGGTCTGAGAACACTTTCTGG + Intronic
960795567 3:121483063-121483085 AGTGAAATGAGAACAGATTTAGG - Intronic
962649941 3:137478358-137478380 AGGGTACTGAGAACAAGAACTGG + Intergenic
965096498 3:164234838-164234860 TGTATTTTGAGAACAAATTCTGG + Intergenic
966226037 3:177599119-177599141 AGTGTCTTAAAAACAAATTCAGG + Intergenic
966277167 3:178187822-178187844 AGTTTACTGATTATAAATTCAGG - Intergenic
967831188 3:193921533-193921555 AGTGTACTTAGAGAACATTCTGG - Intergenic
973549054 4:52013147-52013169 AATGTACTCAAAACTAATTCAGG - Intronic
974603971 4:64124648-64124670 AATATACTGAAACCAAATTCTGG + Intergenic
974664578 4:64941388-64941410 ATTGTACTAAGTACAATTTCTGG - Intergenic
976606361 4:86987139-86987161 ATTTTACTGATAAGAAATTCAGG - Intronic
976726338 4:88219223-88219245 AGTGTACTGAGAAAAAAGAAAGG - Intronic
976862596 4:89684079-89684101 AATATACTCAGAACAAAATCAGG + Intergenic
977684350 4:99831022-99831044 AGTCTCCTTTGAACAAATTCTGG + Intronic
977720936 4:100239660-100239682 AGTGGCCTGAGAGAAAATTCAGG + Intergenic
981831862 4:149010959-149010981 TGTGAGCTGAGAGCAAATTCTGG + Intergenic
983612661 4:169666893-169666915 AATGTCCTGAGAACAATGTCTGG + Intronic
984855141 4:184188692-184188714 AGTCTTCTGAGAAAAGATTCAGG + Intronic
987119398 5:14752585-14752607 AGCATACTGAGAACAAAAGCAGG + Intronic
987419704 5:17704860-17704882 AGTGAACTGAGTAAAAATTATGG - Intergenic
990385830 5:55260925-55260947 AGTGGAATGAGAATAAATTTGGG + Intronic
990682072 5:58256146-58256168 ATTGTACTGAGAACAAGGTCTGG + Intergenic
990983787 5:61623683-61623705 CGTGTCCTGAGAACTATTTCAGG - Intergenic
991921029 5:71657336-71657358 TTGGGACTGAGAACAAATTCTGG - Exonic
992706618 5:79401557-79401579 TGTGTGCTGAGAAAAAATTCAGG - Intronic
993603836 5:89962411-89962433 AGTATGCAGAGAACAAATACAGG + Intergenic
994229698 5:97299006-97299028 TGTGTGCTGAGAAAGAATTCAGG + Intergenic
997706595 5:135959915-135959937 AGTAGAATGGGAACAAATTCTGG + Intergenic
998982901 5:147724563-147724585 AATGTAATGAGAAGAAATTCTGG + Intronic
999089483 5:148923037-148923059 AGTGTTCTGAGAAAACATTTTGG - Intergenic
1001639280 5:173233829-173233851 AGAGGCCTGGGAACAAATTCGGG - Intronic
1005502759 6:26444313-26444335 AGTGTTCTCAGAACAAAACCTGG - Intronic
1005766618 6:29017228-29017250 ATTGTAATGAGAACAAACTTCGG - Intergenic
1006459461 6:34149981-34150003 AGTATCCTGAGAGCAAATTTGGG - Intronic
1007826607 6:44605630-44605652 TGGGTATAGAGAACAAATTCAGG + Intergenic
1008966874 6:57321722-57321744 AATGCACTTAGAACAAAATCTGG - Intronic
1009772125 6:68157302-68157324 AGTGTTCTGAGCACAAATCATGG + Intergenic
1010918930 6:81656644-81656666 AGAGTGCAGAGAACAACTTCAGG - Intronic
1011090012 6:83586887-83586909 AGTGAAATGATAAAAAATTCTGG - Intronic
1011136129 6:84103140-84103162 AGTTTAATGAGGACAGATTCTGG + Intergenic
1011666528 6:89639772-89639794 AATGTACTGAGAACAGGTCCTGG + Intergenic
1012605021 6:101147191-101147213 AGTGTCCAAATAACAAATTCAGG + Intergenic
1012905940 6:105065723-105065745 TTTGTACTGAGAACACATTTTGG + Intronic
1013427864 6:110031367-110031389 AGTGTACTGAGTACACAATCTGG + Intergenic
1013561324 6:111308357-111308379 AGTGTTCTGAGCACATATCCTGG - Intronic
1015479605 6:133693149-133693171 AGTGTTTTGAGAAGAAATTAAGG + Intergenic
1016373305 6:143396019-143396041 AGTGTGCTTAGAACAACCTCTGG - Intergenic
1016997237 6:149969329-149969351 GATGTACTGGGAACAAATGCTGG + Exonic
1017600545 6:156076035-156076057 ATTGGACTGATATCAAATTCTGG + Intergenic
1020466628 7:8487159-8487181 AGTGAACTGATAACATATTGAGG - Intronic
1020830691 7:13091200-13091222 AGGGTAATGAAAACAATTTCTGG + Intergenic
1023118138 7:36882770-36882792 TATGTTCTGAGAACCAATTCTGG - Intronic
1023689456 7:42771278-42771300 AGTGTACTGAGATAAAATTGTGG + Intergenic
1024067245 7:45750482-45750504 AGTGCACTGAAAACAAAATTAGG + Intergenic
1026679930 7:72458085-72458107 AGTGGCCTCACAACAAATTCTGG + Intergenic
1027564199 7:79769395-79769417 AGTGTATTTAAAACTAATTCAGG + Intergenic
1027912490 7:84269113-84269135 ATTCTACTCATAACAAATTCAGG - Intronic
1028775679 7:94673454-94673476 AATGTCCTGAGAACAAACTGGGG - Intergenic
1029685778 7:102146950-102146972 AATCTACAGAGAACAAATTCTGG + Intronic
1030675033 7:112375567-112375589 TGTGTGCTGTGAAAAAATTCAGG - Intergenic
1031976580 7:128097514-128097536 AGTATACTGAGAACAGATGTTGG + Intergenic
1036593480 8:10190913-10190935 AGTGTAGTGAGACTAAGTTCAGG + Intronic
1037113134 8:15190124-15190146 AGTGTACAGAGGAGAATTTCAGG - Intronic
1037256290 8:16958935-16958957 AGTGTTCTGAGACCAAAGTAGGG - Intergenic
1040926043 8:52684378-52684400 AGTTTAATGAAAACTAATTCTGG + Intronic
1042376005 8:68053662-68053684 AGTATACTGAGAACAATTGGAGG - Intronic
1043006879 8:74830882-74830904 AGTGTACTGAGAACAATTGCTGG + Intronic
1043812673 8:84761409-84761431 AGTGTAATTAAAACAAATTTAGG - Intronic
1044490160 8:92804136-92804158 AGTGTAATGAAGACAATTTCTGG - Intergenic
1050192021 9:3036276-3036298 AGTGTCCCAAGATCAAATTCTGG + Intergenic
1051241929 9:15066382-15066404 AATGTCCTGAGAACAATGTCTGG - Intergenic
1059584272 9:115589260-115589282 ATTGTTCAGAGAACAAAATCAGG + Intergenic
1059671895 9:116499810-116499832 AGAGTACTGAGTAGAGATTCAGG + Intronic
1060426259 9:123509208-123509230 AATGTACTGTGGACAAATTTTGG + Intronic
1203584782 Un_KI270746v1:55773-55795 AGTGAACTAAAAGCAAATTCTGG + Intergenic
1186597040 X:10993433-10993455 AGTGGAAAAAGAACAAATTCAGG + Intergenic
1186764022 X:12752434-12752456 AGTGCACTGAGACCAACCTCGGG - Intergenic
1187427048 X:19187487-19187509 AAGGTACTGAGAACCATTTCTGG - Intergenic
1188600343 X:31955991-31956013 ATTGTCATGAGAATAAATTCTGG + Intronic
1191248719 X:58248375-58248397 AGTGTAATGATAAGGAATTCTGG + Intergenic
1192238481 X:69311668-69311690 CTTGTACTGAGGAGAAATTCAGG - Intergenic
1194781242 X:98028141-98028163 AGTATCCAGAGAACAAAGTCAGG - Intergenic
1195907909 X:109863654-109863676 AGTGTTCTGAAAACAAAGTTAGG + Intergenic
1198014362 X:132593530-132593552 AATGGACTGAAAGCAAATTCTGG - Intergenic
1201684535 Y:16686071-16686093 TGTGTACTGAGTAGACATTCAGG - Intergenic