ID: 922311212

View in Genome Browser
Species Human (GRCh38)
Location 1:224392850-224392872
Sequence TAAGTGATTCTCTGTGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 267}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922311212_922311215 28 Left 922311212 1:224392850-224392872 CCTCCTCCACAGAGAATCACTTA 0: 1
1: 0
2: 2
3: 23
4: 267
Right 922311215 1:224392901-224392923 TAAAAAAAAAAAAAAAATTTAGG 0: 8
1: 313
2: 4996
3: 22716
4: 100984

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922311212 Original CRISPR TAAGTGATTCTCTGTGGAGG AGG (reversed) Intronic
903007955 1:20310777-20310799 ACAGGGATTCACTGTGGAGGAGG - Intronic
904636462 1:31885239-31885261 TCAGTGGTTCTCAGTGGGGGTGG + Intergenic
904901963 1:33864832-33864854 TGACTGATGCTTTGTGGAGGAGG + Intronic
905072222 1:35236655-35236677 CAAGTGATTCTCTTTCCAGGAGG + Intergenic
906498849 1:46325363-46325385 TAATTGATTCTCGGGGTAGGGGG - Intergenic
906778627 1:48552539-48552561 TAAATGATTCTGTGTTGTGGGGG + Intronic
908669803 1:66533791-66533813 TAAGTGGCTCGCTGCGGAGGGGG - Intronic
909248888 1:73327102-73327124 TTTGTGATTCTCCGTGGAAGTGG + Intergenic
912856165 1:113170502-113170524 TAGGTTCTTCTTTGTGGAGGAGG - Intergenic
913030134 1:114893123-114893145 TTAGTTATTCTTTGTGGAGGAGG + Intronic
914385461 1:147165400-147165422 TCAGTGATTCTCAGCTGAGGAGG - Intronic
916202739 1:162287515-162287537 GGAGGGATTCTCTCTGGAGGTGG - Intronic
917770667 1:178274281-178274303 AATGTGATTCTTTGTGGAGAGGG - Intronic
918451838 1:184666179-184666201 TAATAGATTGTCTATGGAGGAGG - Intergenic
920106796 1:203559154-203559176 TCTGTGCTGCTCTGTGGAGGTGG + Intergenic
920213041 1:204342477-204342499 TAAGTCATTCAATGTGGAGTAGG - Intronic
920682787 1:208085365-208085387 CTAGTGATTCCCTGTGGAGGTGG - Intronic
920886707 1:209937144-209937166 TTAGTGATTCTCTCTTGTGGAGG - Intergenic
921058148 1:211560100-211560122 TAAGTGAGTGTATGTGGATGGGG - Intergenic
921196034 1:212759303-212759325 TTAGTCCTTCTTTGTGGAGGAGG - Intronic
921821897 1:219626565-219626587 TTGTTGATTCTCTGTGGATGTGG - Intergenic
922088362 1:222372134-222372156 TAAGTGGTTTTCTGTGGAATTGG - Intergenic
922311212 1:224392850-224392872 TAAGTGATTCTCTGTGGAGGAGG - Intronic
922343738 1:224678615-224678637 AAAGGGGTTCTTTGTGGAGGAGG + Intronic
923939709 1:238808258-238808280 GAAGTGATTCTCTGGGGAGTTGG - Intergenic
924569258 1:245223166-245223188 TAGCTGATTCTCTGTGGTGGGGG - Intronic
1063569897 10:7205791-7205813 TAAGTGGTTCCCAGTTGAGGGGG - Intronic
1064373494 10:14774817-14774839 TAAGTGACTCTCAGGGAAGGTGG - Exonic
1064944788 10:20775320-20775342 TAAGTGATTATCTGTGGGACGGG - Intergenic
1068624377 10:59225276-59225298 TGTGTGATTTTCTGAGGAGGAGG - Intronic
1069229997 10:65996910-65996932 TTAGTTTTTCTTTGTGGAGGAGG + Intronic
1069279002 10:66629928-66629950 TCAGGTATTCTGTGTGGAGGTGG - Intronic
1070170423 10:73928766-73928788 GAAGTCAGACTCTGTGGAGGTGG - Intergenic
1071836232 10:89420738-89420760 TAAGTCATTCTCTATGGGGCGGG - Exonic
1073639717 10:105239562-105239584 TGAGGGATTCTCTGTGGGGAGGG + Intronic
1073747697 10:106488463-106488485 TAAGTGATTTTTAGGGGAGGGGG + Intergenic
1074787240 10:116851762-116851784 TCAGTGATTCGGTGTAGAGGAGG - Intronic
1077534121 11:3111158-3111180 TCAGGGATTCTCTGTGGCAGGGG - Intronic
1078437469 11:11337451-11337473 TAAGTGGTAATCTGTGGGGGTGG + Intronic
1080253007 11:30257243-30257265 TTAGTGAGCATCTGTGGAGGTGG - Intergenic
1080293791 11:30701757-30701779 TCAGGGCTTCTCTGTGGAGCTGG + Intergenic
1080740903 11:35063493-35063515 CAAATGATTCACTTTGGAGGTGG + Intergenic
1081334479 11:41847762-41847784 TCAGTGATTCTCTGTGTCAGAGG + Intergenic
1081592351 11:44433321-44433343 GGAGTTTTTCTCTGTGGAGGTGG - Intergenic
1083097670 11:60268160-60268182 TAGTTGTTTCTCTCTGGAGGGGG - Intergenic
1083116698 11:60467103-60467125 TAAATGATCCTTTGTGGATGTGG - Intronic
1083821161 11:65172197-65172219 TTAGTTATTCTCTGAGGAGGAGG - Intronic
1083943168 11:65909471-65909493 TAAGTGATTTCCTGGGGTGGGGG - Intergenic
1087124662 11:94612444-94612466 GAAGTGAATCTCTTTGTAGGTGG + Intronic
1088541519 11:110918712-110918734 TACGTCTTCCTCTGTGGAGGTGG + Intergenic
1090843198 11:130510311-130510333 CAAGTCATTTTCTGTGGATGAGG + Intergenic
1091975023 12:4817407-4817429 TGAGTGAGTCTCTGTGGGGTTGG + Intronic
1093269447 12:17041332-17041354 TATATTACTCTCTGTGGAGGTGG + Intergenic
1093533330 12:20193564-20193586 TAAGTGGTTGCCTGGGGAGGGGG - Intergenic
1094655112 12:32412190-32412212 TAAATGATTCTCTTTGGAAATGG + Intronic
1095910636 12:47423422-47423444 TCAGTGCTGCTTTGTGGAGGAGG - Intergenic
1096590365 12:52654912-52654934 CAAGTGATTCTCTGTGCTGAGGG - Intergenic
1097651500 12:62303613-62303635 TAATTGTTTCTATGTGGCGGGGG - Intronic
1098461323 12:70735957-70735979 TGTGTGATTGTCAGTGGAGGTGG - Intronic
1102676086 12:114660136-114660158 TGGGTGATTCTCTGTTGTGGGGG - Intergenic
1105040931 12:132960652-132960674 TAAGTGATTGTATGGGGAGGAGG - Intergenic
1105736873 13:23280880-23280902 TTATTGATTCTCTGAGTAGGAGG - Intronic
1107589289 13:41884991-41885013 TCAGTGAGACCCTGTGGAGGAGG - Intronic
1110026481 13:70546717-70546739 CATGTGATACTCTTTGGAGGTGG + Intergenic
1110331865 13:74282193-74282215 AAAGTGCTTTTCTGTGAAGGAGG + Intergenic
1110772133 13:79361874-79361896 TCAGTGATTCTCAGTGGGGATGG + Intronic
1111430852 13:88146718-88146740 CAGGTGATTCTCTATGGAGTTGG + Intergenic
1112182142 13:97094188-97094210 TAAATAATTCTTTGTTGAGGGGG + Intergenic
1113735658 13:112677453-112677475 TGAGTGATTGTCTCTGCAGGGGG + Intronic
1114666144 14:24378171-24378193 AAAGAGCTTCTCAGTGGAGGAGG + Exonic
1116509071 14:45721113-45721135 CAAGTGATTCTCTGTAGTGCTGG - Intergenic
1116539380 14:46079995-46080017 AAAGTGTTTCTCGGTGGAGTAGG - Intergenic
1117675233 14:58148967-58148989 TTAGTGATTCTCTGATGAGGGGG + Intronic
1117712704 14:58548953-58548975 TCAGTGATTGTGTGTGGAGATGG + Intronic
1118011171 14:61612043-61612065 TAAGTGTGTGTGTGTGGAGGGGG - Intronic
1118473873 14:66099495-66099517 TGAGTGATTCTCAGTGGAAAGGG - Intergenic
1118874454 14:69771550-69771572 TATGTGCTTTTCTGTGGGGGTGG + Exonic
1120348218 14:83317932-83317954 CAAGTGTTTTTCTGGGGAGGAGG + Intergenic
1120358902 14:83470285-83470307 TAAATGATTGTGTTTGGAGGAGG + Intergenic
1120748593 14:88176004-88176026 TAAGACATTTTCTGTGAAGGGGG - Intergenic
1124494579 15:30178580-30178602 TAAGTCAGGCTCTGTGGAGAGGG - Intergenic
1124748991 15:32360065-32360087 TAAGTCAGGCTCTGTGGAGAGGG + Intergenic
1126173708 15:45716017-45716039 TGAGTGAATGTGTGTGGAGGGGG + Intergenic
1126549149 15:49908295-49908317 TTGGTGCTTCTTTGTGGAGGAGG - Intronic
1126892957 15:53225778-53225800 AAAGTAATCCACTGTGGAGGGGG - Intergenic
1127119046 15:55755463-55755485 TAAGGGATACTATGTGCAGGAGG + Intergenic
1127200183 15:56637505-56637527 TGACTGATTCTTTGTTGAGGAGG - Intronic
1128412075 15:67409660-67409682 CAAGTGATTCGCTGTGGTGGCGG - Intronic
1128775269 15:70315704-70315726 CAAGTGATTCTATGTGCAGTGGG - Intergenic
1129480112 15:75817316-75817338 GAAATGGTTCCCTGTGGAGGGGG - Intergenic
1129803435 15:78434823-78434845 TTAGTGCTTCTCAGTGGAAGCGG + Intergenic
1131515108 15:93072157-93072179 CAAATGCTTCTCTGTGGAGTTGG + Intronic
1133487603 16:6235267-6235289 TGATTCATTCTGTGTGGAGGAGG - Intronic
1134634276 16:15780189-15780211 GCAGTGCTTCTCAGTGGAGGCGG + Intronic
1134841281 16:17404000-17404022 TAAATAATTCTCTGTGGCTGTGG - Intronic
1135489892 16:22900122-22900144 TCTGTCATTCTCTCTGGAGGTGG + Intronic
1135746408 16:25020511-25020533 AAAGTGCTTCTCTGGGGAGCTGG - Intergenic
1135755570 16:25094709-25094731 AAAGTGCTTCTCTGGGGAGCTGG - Intergenic
1137890959 16:52161548-52161570 TAAGCAAGTCTCTGTGGATGTGG + Intergenic
1138670466 16:58610302-58610324 TAAGCGATTCTCTGAGTAGCTGG - Intronic
1140827096 16:78716696-78716718 TAAGAAAATCTCTCTGGAGGTGG - Intronic
1143748770 17:9013174-9013196 AGAGTGTTTCTCTGTAGAGGTGG - Intergenic
1144607214 17:16677489-16677511 TATGTGATGGTCTTTGGAGGTGG + Intergenic
1146675414 17:34770251-34770273 GGAGGGATTCTCTGAGGAGGTGG - Intergenic
1149927166 17:60712914-60712936 TAAGTGATTCACTTGGGAAGTGG + Intronic
1150484158 17:65532574-65532596 AAAGTGATTCTCTTTGGAGTGGG - Intronic
1151447334 17:74175869-74175891 TAAGTGTGTCTGGGTGGAGGTGG - Intergenic
1151474606 17:74338567-74338589 TCTGGGATTCTCAGTGGAGGAGG - Intronic
1151537033 17:74744931-74744953 TAAGTGATTGTCTGTGGGACAGG + Intronic
1154097164 18:11429417-11429439 TAAGTTCTTCTTTGTGGACGAGG - Intergenic
1155416471 18:25604975-25604997 CAGGTGAGGCTCTGTGGAGGGGG - Intergenic
1155833255 18:30544517-30544539 TAGATAATTCTCTGTGTAGGGGG - Intergenic
1156446576 18:37241550-37241572 TAAGAAATTCTCTGGGGAGTGGG - Intergenic
1158618405 18:59008742-59008764 TAAGTCATTCTTTGCGGGGGTGG + Intergenic
1158978747 18:62737890-62737912 TGAATGATTATATGTGGAGGGGG + Intronic
1164888126 19:31800702-31800724 TATGAGGTCCTCTGTGGAGGAGG - Intergenic
1165657096 19:37543559-37543581 TAAGTGTTTCGCTGATGAGGTGG - Intronic
1166359333 19:42246304-42246326 TAAGTCATTCCCTGGGGTGGGGG - Intronic
1168096872 19:54120962-54120984 TAAGGGATGCTCTGGGGAGAGGG + Intronic
925494603 2:4432727-4432749 TGGGTGATTCTTTGTGGGGGTGG - Intergenic
927404147 2:22748595-22748617 TAATTGATTCTCTTTGTTGGGGG - Intergenic
929642073 2:43591465-43591487 TCTGTGATTCTCTGTGGAGGTGG - Intronic
930121535 2:47764841-47764863 TAAATAATTCTTTGTGGGGGTGG + Intronic
930390258 2:50751906-50751928 TAGGTGATACACAGTGGAGGAGG - Intronic
930415488 2:51085697-51085719 TGAGTCATTCTATATGGAGGAGG + Intergenic
930605931 2:53493065-53493087 AAAGTGATTGTATTTGGAGGTGG + Intergenic
931051226 2:58417165-58417187 GAAGTTATTCTGTGTGGAAGAGG + Intergenic
932176091 2:69604178-69604200 TATTTGATTCTCTGGTGAGGTGG - Intronic
932584566 2:73019250-73019272 AAAGTGATTTTCTGTCGGGGTGG + Intronic
932821868 2:74908503-74908525 TAAATTATTATCTGGGGAGGAGG - Intergenic
933971592 2:87474146-87474168 TAAGGCATGCTCTGTGGAGTGGG + Intergenic
936322138 2:111476053-111476075 TAAGGCATGCTCTGTGGAGTGGG - Intergenic
938771900 2:134507688-134507710 TAATTTATTTTTTGTGGAGGTGG - Intronic
940018366 2:149130578-149130600 TAAGTGATTTTCTGTGACTGGGG + Intronic
940101931 2:150050298-150050320 TAAATGATTCTCTTTGGAATTGG - Intergenic
940549572 2:155136335-155136357 TCAGAAATGCTCTGTGGAGGAGG - Intergenic
940584272 2:155624950-155624972 TAAGTGATTCTCCTTAGAAGAGG - Intergenic
941499820 2:166259614-166259636 TAAGTGATTCTCAGTATAGGGGG + Intronic
942927067 2:181446600-181446622 AAAGTGATTCTCTGAGTAGTTGG - Intergenic
943073085 2:183164993-183165015 CAAGTGATTCTCTGAGTAGCTGG + Intergenic
943521230 2:188951288-188951310 TAAATGATTTTCTGTGGTGGAGG - Intergenic
945566610 2:211408690-211408712 TAGGTCATTCTCTTTGGAGCCGG + Intronic
946069560 2:217021220-217021242 TATGTGTTTCTCTCTTGAGGTGG + Intergenic
946782305 2:223204670-223204692 TCAGTCCTTCTTTGTGGAGGAGG - Intergenic
948348304 2:237317778-237317800 CATGTGATTCTTTGAGGAGGCGG - Intergenic
948532469 2:238618646-238618668 TTCTTGATTCTCTGTGGAGGCGG + Intergenic
948666689 2:239539066-239539088 AATGTGATTTTCTGTGGAGAAGG + Intergenic
1172003193 20:31797780-31797802 TACTTGTTTCTCTGTGGATGGGG - Intronic
1172057943 20:32167090-32167112 TAAGAGATTCTCTTTTTAGGGGG + Exonic
1175048462 20:56129668-56129690 TAAATGATTCTGTGTGCATGGGG + Intergenic
1175530605 20:59672204-59672226 TAAATGATGCTCTGTGGCGGGGG - Intronic
1175789779 20:61734027-61734049 TAATTGCTTCTCTGTGAAAGGGG - Intronic
1179851578 21:44141152-44141174 TAAGTGAGTGACTGTGGATGGGG - Intronic
1181987452 22:26810388-26810410 CAAATCATTCTTTGTGGAGGAGG - Intergenic
1182012355 22:27011443-27011465 TGGGTGATTCTTTGTGGCGGGGG + Intergenic
1182241202 22:28917787-28917809 TAAATGGTACCCTGTGGAGGGGG - Intronic
1182932176 22:34184985-34185007 TAAGTGAGTGTGTGTTGAGGGGG + Intergenic
1183133389 22:35862360-35862382 TTAGTTATTTTCTTTGGAGGGGG + Intronic
1185260156 22:49857062-49857084 TCAGGGTTTGTCTGTGGAGGTGG - Intronic
949734204 3:7152399-7152421 TACTTGATCCTCTGTGGAAGAGG - Intronic
950329337 3:12144100-12144122 GAACTGATTCTCTGGGAAGGTGG + Intronic
951074193 3:18369313-18369335 TAAGTTTTTTTTTGTGGAGGGGG - Intronic
951148511 3:19258323-19258345 CCACTGATTCTCTGTGGAGGTGG + Intronic
951666104 3:25125532-25125554 GAAATGTTTCTCTGAGGAGGAGG + Intergenic
951935393 3:28017224-28017246 TATTTGATTGTCGGTGGAGGGGG - Intergenic
955419910 3:58725668-58725690 TGAGTCATTGTGTGTGGAGGTGG + Intronic
956100418 3:65762211-65762233 TTTGTGATTCTCGTTGGAGGGGG - Intronic
956831925 3:73059581-73059603 TTAGTGTTTGTGTGTGGAGGGGG + Intronic
957910174 3:86609610-86609632 TATGTGATCCTCAGTGGTGGAGG - Intergenic
959079703 3:101787050-101787072 CAAGTGATTCTCAGTAGAGACGG - Intronic
960742951 3:120855224-120855246 AATGGGATTCTATGTGGAGGAGG + Intergenic
960758140 3:121041820-121041842 TAACTGATTCACTGTGTAGTGGG - Intronic
961740682 3:129031491-129031513 CATGTGATTCTCTGGGGTGGTGG + Intronic
962060137 3:131917457-131917479 TGAGTGATGCTTTGGGGAGGAGG + Intronic
962084698 3:132178301-132178323 TAAGTCAAACTCTGTGGAGATGG + Intronic
963768527 3:149364611-149364633 TATGTGAGTCTTGGTGGAGGAGG + Intergenic
966351794 3:179038932-179038954 TGAGTGAGGCTCTGTGGACGTGG - Intronic
971134015 4:23847072-23847094 TAAGTCAGTATCTTTGGAGGTGG + Intronic
971749740 4:30631923-30631945 GAAATGGTTCTCTGTGGAGAGGG - Intergenic
973133441 4:46676566-46676588 GAAGAGATTCTGTGGGGAGGTGG - Intergenic
974123561 4:57667993-57668015 TACATGATTTTCTGTGGAGGAGG - Intergenic
974503799 4:62740423-62740445 AAATTCATTATCTGTGGAGGAGG + Intergenic
975115171 4:70672115-70672137 TCAGTGATTATCTGGGAAGGTGG + Intronic
975168024 4:71200082-71200104 TAGGTGATTGTCTGGGGATGTGG + Intronic
975250671 4:72174706-72174728 GAAGTCCTCCTCTGTGGAGGAGG - Intergenic
975305864 4:72848009-72848031 TGAGTGAGTCTCTGTGGGTGTGG - Intergenic
976573128 4:86636253-86636275 TTGGTGTTTCCCTGTGGAGGAGG + Intronic
977406705 4:96608685-96608707 TAAGTGATGGTATTTGGAGGTGG - Intergenic
978414623 4:108462546-108462568 TAAGTGAACCTCTCTGCAGGTGG + Intergenic
978937036 4:114390058-114390080 AAAGTTATTTTCTGTGGAGTTGG + Intergenic
981204126 4:142018629-142018651 TAAGTGAATCACGGGGGAGGGGG - Intergenic
981364790 4:143889829-143889851 TTAATTATTCTTTGTGGAGGAGG + Intronic
981375286 4:144008100-144008122 TTAATTATTCTTTGTGGAGGAGG + Intronic
981385905 4:144130301-144130323 TTAATTATTCTTTGTGGAGGAGG + Intronic
982210975 4:153036093-153036115 CAAGTGATTCTTTGTGGTAGTGG + Intergenic
982325567 4:154125578-154125600 TATGGGACTCTCTTTGGAGGAGG - Intergenic
982406069 4:155021536-155021558 TGAGTGAGGCTCTGTGGATGTGG + Intergenic
982918249 4:161241996-161242018 TAAACAAATCTCTGTGGAGGGGG - Intergenic
983836904 4:172398928-172398950 GATTTGAGTCTCTGTGGAGGTGG - Intronic
984194333 4:176640288-176640310 TAAGTAACTCTCTGTTGTGGGGG + Intergenic
987831749 5:23104465-23104487 TTTGTTCTTCTCTGTGGAGGAGG - Intergenic
988769032 5:34412420-34412442 GAAGGGATTCTGAGTGGAGGTGG + Intergenic
989520449 5:42394785-42394807 TCAGTGTTTCTCTGTGGATGGGG - Intergenic
992078700 5:73215022-73215044 TAAGTGATTCCCTGTGAGTGAGG + Intergenic
994294238 5:98069977-98069999 TAAGTGATTCTCACTGGAACTGG - Intergenic
994433222 5:99695348-99695370 GAAGTGACTCTCAGTGGAAGGGG + Intergenic
994854507 5:105099498-105099520 AAAGTAATTCTCTTTGGAGATGG + Intergenic
995834154 5:116383781-116383803 AAGGTGATACTCTGGGGAGGGGG - Intronic
997501405 5:134377599-134377621 CCAGTGATTATCTGTGGGGGGGG + Intronic
998560764 5:143169642-143169664 TAAGTGAGCCTCTGTGGGGCTGG + Intronic
998901097 5:146855691-146855713 TCAGAGATTCTCTTTAGAGGTGG - Intronic
999542180 5:152585839-152585861 TAAGAAATTCTTTCTGGAGGAGG + Intergenic
999816861 5:155185555-155185577 TAAGTGATTCCCTGAAGAGTTGG - Intergenic
1000184241 5:158843535-158843557 CAAGTGATCCACTGTTGAGGGGG - Intronic
1000596983 5:163226880-163226902 ATAGTGATTCTCTTTGGAGAAGG - Intergenic
1000765656 5:165286105-165286127 ACAGTCTTTCTCTGTGGAGGAGG - Intergenic
1000905049 5:166955700-166955722 CAAGTGATTTTCTGTACAGGTGG + Intergenic
1001964066 5:175897890-175897912 TAAGGGTTTCTTTGTGGTGGGGG + Intergenic
1003279718 6:4680817-4680839 TGTGTGTATCTCTGTGGAGGGGG - Intergenic
1003318161 6:5030114-5030136 GAAGGGAATCTGTGTGGAGGCGG + Intergenic
1003458011 6:6301773-6301795 TAATTGGTTCTCTGTGGCTGAGG - Intronic
1005106704 6:22231694-22231716 CAAGTGATTCACTGAGGGGGTGG + Intergenic
1006743059 6:36323030-36323052 TAAGTGTTTGTGTGTGGAGAGGG + Intronic
1007711090 6:43824848-43824870 TAAGTGATTACATGTGGTGGAGG + Intergenic
1009507646 6:64504890-64504912 TAAGTTTTACTCTGTGGATGAGG + Intronic
1009728693 6:67569782-67569804 TAAGTGATTTTCTGTAGGTGTGG - Intergenic
1013906158 6:115222444-115222466 TGAGTGAGGCTCTGTGGATGTGG - Intergenic
1014864650 6:126513648-126513670 TCAGTAACTCTCTGTGGTGGTGG + Intergenic
1015145235 6:129977877-129977899 TAACAGATTCTCTCTGGAGCAGG - Intergenic
1015382963 6:132590723-132590745 TAAGTGATTCTGTATTGAGGAGG - Intergenic
1015824188 6:137294471-137294493 TAAATGATTCTCTTTGGAAATGG - Intergenic
1017613347 6:156214391-156214413 TTGGTGCTTCTTTGTGGAGGAGG + Intergenic
1021096956 7:16546497-16546519 TGAATGATTCTCAGTGGAGGTGG - Intronic
1021883278 7:25114151-25114173 TAAGAAATTGTCTGTAGAGGTGG + Intergenic
1023324089 7:39033596-39033618 TCAGTAATTCTCTATGAAGGGGG - Intronic
1024127719 7:46317717-46317739 TAAGTGATTCTCTCTGTGGCTGG + Intergenic
1024728534 7:52228990-52229012 TTAGTTTTTCTCTGTGAAGGAGG + Intergenic
1026288310 7:68983516-68983538 GAAGTGACTCTGTGTGTAGGAGG + Intergenic
1032203775 7:129843636-129843658 TGAGGGATTCTTTGGGGAGGAGG - Intronic
1035478990 7:159166950-159166972 TATGTGCTTCTCTGTGAAGAAGG - Intergenic
1036510858 8:9398894-9398916 TGGGTGATCCTCTGTGGAAGAGG - Intergenic
1036616132 8:10389172-10389194 TCAGTGTTTCTCTGTGGAAAAGG + Intronic
1036939803 8:13040447-13040469 TAACAGATTCTCTTTTGAGGAGG - Intergenic
1038225599 8:25654359-25654381 TCAGTGGTTCTTTATGGAGGAGG + Intergenic
1039601968 8:38846867-38846889 TAAGTGAGTCACTGCTGAGGAGG - Intronic
1041830394 8:62147124-62147146 TTGGTTCTTCTCTGTGGAGGAGG - Intergenic
1042682271 8:71399059-71399081 TAAGTGAGGCTCTGTGGGCGTGG + Intergenic
1042947616 8:74170849-74170871 TCAGTAATTCACTGTGCAGGTGG + Intergenic
1045946315 8:107800835-107800857 TAATTTCTTCTCTGTGGAGTGGG + Intergenic
1046152594 8:110247220-110247242 TAAGTGTGTTTCTGTGGAGTAGG - Intergenic
1046691597 8:117291724-117291746 GATGTGATGCACTGTGGAGGAGG + Intergenic
1046900790 8:119521366-119521388 TAAGTGAGGCTCTGTGGGCGTGG - Intergenic
1047566696 8:126051621-126051643 TCAGTGATTTTCTGTGGTGGGGG + Intergenic
1048686050 8:136906623-136906645 AAAATGGTTCTCAGTGGAGGTGG + Intergenic
1048858446 8:138704001-138704023 TGAGTGAGGCTCTGTGGACGTGG - Intronic
1050544910 9:6701509-6701531 TAAGGTGTTCACTGTGGAGGTGG + Intergenic
1052049554 9:23829915-23829937 TAAATGAGTTTCTGTGGAGTAGG - Intergenic
1055308989 9:74958903-74958925 TAAGTGATTTTGTGTGGATAAGG + Intergenic
1055640403 9:78314972-78314994 TCTGTGGTTCTGTGTGGAGGTGG + Intronic
1056550641 9:87650862-87650884 TGGGTGATTCTCTGTCGAGGGGG - Intronic
1056579077 9:87877236-87877258 TTTGGGATTCTCTGTGGAGGTGG + Intergenic
1056732738 9:89179860-89179882 TGAGTGTTTCACTGTGGAGCAGG - Intergenic
1057129613 9:92644443-92644465 TAAGTGATTGTCTGAGAACGAGG - Intronic
1058113577 9:101058349-101058371 TGAGTGAGACTCTGAGGAGGTGG + Intronic
1058138848 9:101337382-101337404 TCAGTGATTATCTCTGCAGGGGG - Intergenic
1058207891 9:102131195-102131217 TGAGTGAGGCTCTGTGGACGTGG - Intergenic
1059143025 9:111871933-111871955 TAACTGATGGTCTGAGGAGGTGG + Intergenic
1059633516 9:116150721-116150743 TAAGGGAGTCCCTGGGGAGGAGG + Intergenic
1059664806 9:116436649-116436671 TAGAGAATTCTCTGTGGAGGTGG + Intronic
1059859534 9:118443596-118443618 ATAGTGATTATCTCTGGAGGTGG + Intergenic
1059974970 9:119706285-119706307 TAAGGGATTCAGTGAGGAGGTGG - Intergenic
1060681006 9:125564534-125564556 CAAGTGATTCTCTGTGTGGTGGG - Intronic
1185654808 X:1676187-1676209 TAAGGAATTGTCTGTGTAGGAGG - Intergenic
1185825871 X:3249157-3249179 TGGATGATTCTCTGTGGTGGGGG - Intergenic
1186157289 X:6738724-6738746 GAAGTCATTCTCTGTGGTAGGGG - Intergenic
1186633858 X:11380751-11380773 CAAGTAATTCTCTGTTGTGGGGG + Intronic
1187998745 X:24957984-24958006 TAGGTGATTCTTTGTTGTGGAGG + Intronic
1189863658 X:45300483-45300505 GAAGGGATTCTGAGTGGAGGTGG + Intergenic
1190793366 X:53720376-53720398 TCAGTGATTCTCTGTGGATGGGG - Intergenic
1192813725 X:74570175-74570197 CAAGTGATCCTCTTGGGAGGGGG - Intergenic
1193229975 X:79032347-79032369 TGAGTGAGGCTCTGTGGATGTGG + Intergenic
1193649944 X:84118882-84118904 TACATGATTCTCTGGGTAGGAGG - Intronic
1195373630 X:104203938-104203960 TATGAGATGCTCTGTGGAGAGGG + Intergenic
1195822603 X:108963225-108963247 TAAATCAATCTCTGTGGAGGTGG + Intergenic
1196416085 X:115473026-115473048 TACGTTATTATCTGTGGAGGAGG + Intergenic
1196466080 X:115972821-115972843 TAAGTGTTTCTGTGTGCTGGTGG + Intergenic
1197690746 X:129498478-129498500 TATGTAAGTCTCTGTGGGGGTGG - Intronic
1197848856 X:130834942-130834964 TTAGTGTTTCTCTATGGTGGAGG - Intronic
1201253121 Y:12080680-12080702 TGGATGATTCTCTGTGGTGGGGG + Intergenic
1201550912 Y:15215519-15215541 GAAGTCATTCTCTGTGGTAGGGG - Intergenic
1201969850 Y:19780026-19780048 TGAGTGAGTCTCTGTGCATGTGG - Intergenic
1202330865 Y:23751212-23751234 AAAGTAATTCTCTTTGGAGATGG + Intergenic
1202539904 Y:25918849-25918871 AAAGTAATTCTCTTTGGAGATGG - Intergenic