ID: 922316081

View in Genome Browser
Species Human (GRCh38)
Location 1:224443420-224443442
Sequence CTCCATTAGCAGCTCCAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 4, 3: 17, 4: 156}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922316080_922316081 13 Left 922316080 1:224443384-224443406 CCAGACTTGATTTATACAGGAAT 0: 1
1: 0
2: 0
3: 10
4: 177
Right 922316081 1:224443420-224443442 CTCCATTAGCAGCTCCAGCTAGG 0: 1
1: 0
2: 4
3: 17
4: 156
922316077_922316081 27 Left 922316077 1:224443370-224443392 CCCTGGAATAAGAGCCAGACTTG 0: 1
1: 0
2: 1
3: 11
4: 176
Right 922316081 1:224443420-224443442 CTCCATTAGCAGCTCCAGCTAGG 0: 1
1: 0
2: 4
3: 17
4: 156
922316078_922316081 26 Left 922316078 1:224443371-224443393 CCTGGAATAAGAGCCAGACTTGA 0: 1
1: 0
2: 0
3: 7
4: 150
Right 922316081 1:224443420-224443442 CTCCATTAGCAGCTCCAGCTAGG 0: 1
1: 0
2: 4
3: 17
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922316081 Original CRISPR CTCCATTAGCAGCTCCAGCT AGG Intronic
901454629 1:9355995-9356017 GTCCAGTAGCAGATCCAGCCGGG - Exonic
901816292 1:11795292-11795314 CTCCTGTGGCACCTCCAGCTTGG + Exonic
902368131 1:15990472-15990494 CTCCAGGAGCACCTCCAGCCAGG + Intergenic
903658618 1:24963779-24963801 CCCCATTAGAGGCTCCAGGTCGG + Intronic
904571420 1:31468882-31468904 GTCCATTAGCAGAGACAGCTGGG - Intergenic
904684125 1:32248489-32248511 CTCCAGCTCCAGCTCCAGCTCGG - Exonic
910579359 1:88805650-88805672 CTCAACTAGCACCTCCAGCTAGG + Exonic
910774022 1:90856827-90856849 TTCCATTATCAGGTCCAGCTGGG - Intergenic
912431535 1:109630675-109630697 CTCCATCAGCGGCTCCTGCACGG - Exonic
912499531 1:110112860-110112882 CTGCCTTAGCAGCTGCAGCACGG - Exonic
914404812 1:147359942-147359964 TTCCATTAGGAGCTCTAGCAAGG - Intergenic
914739706 1:150453694-150453716 CTACATTAGCAGCTACCTCTGGG - Intronic
915160908 1:153920118-153920140 CTCCACATGCACCTCCAGCTTGG + Intronic
915313178 1:155014730-155014752 CTCAATGAGCAGCGCCAGCTGGG + Exonic
918962823 1:191302768-191302790 CTCCAGTGGCAGCTACAGCTGGG + Intergenic
920711203 1:208296629-208296651 CTGTATTTGCAGCTCCAGCAGGG + Intergenic
921155801 1:212437643-212437665 CTCCAGTGGCAGCTTCAGATGGG + Intronic
922223617 1:223627182-223627204 CTCCATTAGCACCCTCAGCAAGG + Intronic
922316081 1:224443420-224443442 CTCCATTAGCAGCTCCAGCTAGG + Intronic
923198960 1:231693755-231693777 CTCCAGATGCAGTTCCAGCTGGG + Intronic
1062828528 10:589012-589034 TTCCATCAGCCGCTCCAGCAGGG + Intronic
1063557836 10:7097430-7097452 CTCCATTCCCAGCCCCAGCACGG + Intergenic
1067382730 10:45789867-45789889 CTACATTGTCAGCTCCAGCCAGG - Intronic
1067890433 10:50130412-50130434 CTACATTGTCAGCTCCAGCCAGG - Intronic
1069582658 10:69576181-69576203 ATCCATTAGCCGCTCCAGGCAGG - Intergenic
1070811123 10:79298598-79298620 CTCTCTTGGCAGCTCCACCTGGG + Intronic
1075414493 10:122252440-122252462 CACCGTTAGCAGCCCCAGCAGGG + Intronic
1076016050 10:127028279-127028301 CACCATTAGCAGATCCGACTTGG - Intronic
1076470797 10:130716693-130716715 CTCCTGTAGCAGCTGCTGCTGGG + Intergenic
1077005436 11:353229-353251 CACCAATAGCAGCTCGGGCTGGG - Intergenic
1077095044 11:795671-795693 CTCCCATGGCAGCTCCACCTAGG + Intronic
1079409840 11:20177081-20177103 CTGAATGAGCAGCTCCAGCCTGG + Intergenic
1079626696 11:22625295-22625317 CTCCAGCAGCAGCTCCGCCTGGG + Exonic
1086502942 11:87472064-87472086 CTCCATTAGAAGCTTTAACTGGG - Intergenic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1087857786 11:103112462-103112484 CTCCATTAGCAGCTACAACTTGG + Intronic
1089610036 11:119664004-119664026 CTCCATTAGGGGCTCCAGGTGGG - Exonic
1090420596 11:126572584-126572606 CTCCATCAGCAGCACCTGCTTGG - Intronic
1091394003 12:142598-142620 CTCCACCAGCAGCTCCAGGAGGG - Intronic
1092613885 12:10198892-10198914 TTCCATTGGCATCTCCACCTTGG + Intergenic
1093498576 12:19784148-19784170 CTGCATTAGCAGCTGCAGCTGGG - Intergenic
1095489103 12:42714457-42714479 CTCCATTAGTAGATCCATCAGGG - Intergenic
1099481129 12:83168002-83168024 CTCCCTTAGCAACCCCAGGTTGG - Intergenic
1102725491 12:115060758-115060780 CTGCAATAGAAGCTCCAGTTTGG + Intergenic
1105593959 13:21818383-21818405 ATCCACTAGCAGAACCAGCTGGG + Intergenic
1108530345 13:51322339-51322361 CTCCATTCCAAGCTCCAGCCTGG + Intergenic
1109776384 13:67046240-67046262 ATCCATTAGCAGCCCATGCTAGG - Intronic
1110828857 13:80006729-80006751 CTCCATTCATAGCTCCAGTTGGG - Intergenic
1112369986 13:98785703-98785725 CTCGGTTAGCAACTCCAGCCAGG - Intergenic
1112588089 13:100737482-100737504 CTCCATTGGCAGCTCCAGATAGG + Intergenic
1114253633 14:20983129-20983151 CTCCAGTCACAGCCCCAGCTGGG - Intergenic
1117106223 14:52399566-52399588 TTGCATTATCAGCTTCAGCTGGG - Intergenic
1117180234 14:53183815-53183837 CTCCAGTAGTGTCTCCAGCTGGG - Intergenic
1120432407 14:84435962-84435984 CTCCATTAGTAGCTGCAACTGGG + Intergenic
1121224778 14:92313378-92313400 GACCAGTAGCAGCTCCATCTTGG + Intergenic
1128921314 15:71612566-71612588 CTCCATCAACAGCTGCAGCACGG - Intronic
1131713045 15:95076501-95076523 ATCACTTAGCAGCTGCAGCTTGG + Intergenic
1131866462 15:96716371-96716393 CTCAATTAACATGTCCAGCTGGG + Intergenic
1132691589 16:1184060-1184082 CTCCCCTACCAGCTCCACCTAGG - Intronic
1132858984 16:2060796-2060818 CTCCTTCAGCAGCTCCAGGTGGG + Exonic
1134111673 16:11518914-11518936 CTCCTTCAGAAGCTCCACCTTGG + Exonic
1138550010 16:57742265-57742287 CTCCCTAACCAGCTCCAGCCAGG - Intronic
1138876266 16:60954177-60954199 GTCCATTTCCAGGTCCAGCTGGG - Intergenic
1139662852 16:68433581-68433603 CTCCACTGGCAGCTCCAACGTGG - Intronic
1140540476 16:75752165-75752187 GTCCCTTAGGAGCTGCAGCTTGG + Intronic
1141715097 16:85722460-85722482 CTGGATTTGCAGCTCCAGGTAGG + Intronic
1142130485 16:88429621-88429643 CTCCCTCAGCAGCGCCAGCCTGG + Exonic
1146580885 17:34037659-34037681 ATGCAATAGCAGCTCCAGCAGGG + Intronic
1147186555 17:38716406-38716428 CTCCTCTGGCTGCTCCAGCTTGG - Exonic
1147362442 17:39939817-39939839 CCACATCTGCAGCTCCAGCTGGG + Intergenic
1147891772 17:43722400-43722422 CTCCATTTGCACCTTCTGCTAGG + Intergenic
1148242000 17:46005734-46005756 CTCCTTCCGCAGCTCCAGCCTGG + Intronic
1149345687 17:55732741-55732763 TTCCAGTCTCAGCTCCAGCTTGG + Intergenic
1150122098 17:62612505-62612527 ATGCAATAGCAGCTCCAGCAGGG - Exonic
1153060117 18:986240-986262 CTCCATTAGCAGCTCATGGGAGG + Intergenic
1155422384 18:25669097-25669119 CACCATTAGCAGCACAATCTAGG - Intergenic
1157185633 18:45538062-45538084 CTCCATTGGCAAACCCAGCTAGG - Intronic
1157196914 18:45626916-45626938 AGCCATCAGCAGGTCCAGCTTGG - Intronic
1158508947 18:58073168-58073190 CTCCATCTGCAGCTCAATCTGGG - Intronic
1161384319 19:3982909-3982931 CTCCAGCTGCAGCTCCAGCAGGG + Exonic
1165313895 19:35043336-35043358 CTCCATGCGCCCCTCCAGCTGGG - Intronic
1166851113 19:45761807-45761829 CTCCAGCTCCAGCTCCAGCTCGG + Exonic
1167653804 19:50749800-50749822 CTGTATTAGCAGCTCCTGCTCGG + Intergenic
1167881353 19:52461074-52461096 GTCCATCAGCAGCTCCAGCTAGG + Intronic
925714582 2:6772563-6772585 CTCCATCTGCAGATCCACCTAGG - Intergenic
925833600 2:7920323-7920345 TTCCATTTGAACCTCCAGCTTGG - Intergenic
925953914 2:8942370-8942392 GTCTATTAGCAGATCCTGCTGGG - Intronic
926311246 2:11677662-11677684 CGGCATTCGCAGCTCCAGCTGGG + Exonic
926536356 2:14118052-14118074 CTAGATTAGGAGCTCCAACTGGG + Intergenic
927086283 2:19676774-19676796 CTCCATTAGCACCAACAGCCTGG - Intergenic
928683677 2:33727473-33727495 CACCTTCAGCAGCCCCAGCTCGG + Intergenic
929620773 2:43351725-43351747 CTGCATTTGCAGCAGCAGCTGGG + Intronic
930430073 2:51264589-51264611 TTCCTTTAGCAGCTCCAGGAAGG + Intergenic
931429275 2:62196330-62196352 GTCCGGGAGCAGCTCCAGCTCGG - Exonic
931511325 2:62998788-62998810 CTGCAGTAGCAGATCCAGTTAGG - Intronic
936795908 2:116204115-116204137 CTCCAGTGGCAACTGCAGCTTGG + Intergenic
937462442 2:122101203-122101225 CCTGGTTAGCAGCTCCAGCTGGG - Intergenic
937640884 2:124209765-124209787 CTCCACTAGGAGGACCAGCTCGG - Intronic
941579093 2:167272903-167272925 CTCTATTAGTAGCTCCATTTGGG - Intergenic
942457279 2:176147146-176147168 CTCCCTTTCCAGCTTCAGCTTGG - Intergenic
944065233 2:195612640-195612662 ACACATTAGCAGCTCCATCTGGG + Intronic
946210741 2:218145149-218145171 CTCCCATAGCTGCTCCACCTAGG - Intergenic
946620726 2:221559984-221560006 CTCCATTAGCATGTACTGCTGGG + Intronic
946656201 2:221950688-221950710 CTCCATTGGCTGCAGCAGCTAGG - Intergenic
947828403 2:233122138-233122160 CTCGATGAGCTGGTCCAGCTTGG - Exonic
948903212 2:240966396-240966418 CCCCATTACCCGCTCCCGCTGGG - Intronic
1169110637 20:3031026-3031048 TTCCCTCAGCAGCTGCAGCTTGG + Intronic
1173354964 20:42278731-42278753 CTCCTTTAGCAGCTGCAACCTGG + Intronic
1173382869 20:42561688-42561710 CTCCTTTAGCACATCTAGCTTGG - Intronic
1173557618 20:43977766-43977788 CCCCATCAGCAGCTCCAGGGGGG + Intronic
1175658366 20:60791650-60791672 CTCCTTTAGCAGGTGGAGCTGGG + Intergenic
1176088393 20:63308294-63308316 CCACATTAGCAGCTCTGGCTGGG + Intronic
1179572762 21:42287546-42287568 CTCCCTTCCCAGCTCCACCTTGG + Intronic
1181475672 22:23166534-23166556 CTGCTTTAGCCTCTCCAGCTGGG + Intergenic
1183176589 22:36228984-36229006 CTCCTTGACCAACTCCAGCTGGG + Intronic
1183181641 22:36264108-36264130 CTCCTTGACCAACTCCAGCTGGG - Intronic
1183831477 22:40420497-40420519 TACCAATAGCAGCTCCAGCTCGG - Exonic
1183864872 22:40696042-40696064 CTCCACTGGCAGCATCAGCTGGG - Intergenic
951835759 3:26981829-26981851 CACTATTAGCAGCAGCAGCTTGG + Intergenic
952754590 3:36855366-36855388 TTTCATCAGCAGCGCCAGCTCGG + Exonic
953100146 3:39816657-39816679 CTCCATTAGCCACTCCATTTGGG - Intronic
956198231 3:66675316-66675338 TTTCATTAGCAACTCCAGTTTGG + Intergenic
962713045 3:138103495-138103517 CTGCATTAGCAGCTGCTGCAGGG + Exonic
965160735 3:165129785-165129807 CTCCCTTAGCCACCCCAGCTGGG + Intergenic
967414369 3:189200159-189200181 CTCCCTTCCCAGCTCCACCTGGG - Intronic
968452151 4:680822-680844 CTCCATCTTCAGCTCCTGCTAGG + Intronic
969486251 4:7473993-7474015 CTTCATTAGGAGCTTCAGATGGG - Intronic
971419787 4:26464876-26464898 CTCCAACAGCAGATCCAGCCTGG + Intergenic
975672300 4:76793395-76793417 CTACTTTAAAAGCTCCAGCTGGG + Intergenic
976447790 4:85151505-85151527 TTCCTTCAGCAGCTGCAGCTTGG + Intergenic
978092945 4:104739922-104739944 ATCTGCTAGCAGCTCCAGCTTGG + Intergenic
978574136 4:110171519-110171541 CTCCATAAGAAGCTCAAGATTGG + Intronic
979832784 4:125321073-125321095 CTCCATTAGCACCTTCATCTGGG - Exonic
979975472 4:127190732-127190754 CTGCAGTAGCAGCAGCAGCTGGG + Intergenic
981081883 4:140644613-140644635 CGCCTTCAGCCGCTCCAGCTGGG + Intronic
981430009 4:144646845-144646867 CCCACTCAGCAGCTCCAGCTGGG - Exonic
981996090 4:150977128-150977150 CTTCCTTAGCTGCCCCAGCTGGG - Intronic
985186986 4:187328230-187328252 CTCCATCAGCAGCTTCTGTTAGG + Intergenic
991509379 5:67359985-67360007 TTCAATAAGCAGCTCCAGCATGG - Intergenic
991677833 5:69106220-69106242 CCACAGTAGCAGCTGCAGCTTGG + Intronic
995262625 5:110123098-110123120 CTCCATTAGCCACCTCAGCTGGG + Intergenic
995473367 5:112525449-112525471 CTCCATTGGCAGCTCCATTATGG + Intergenic
998250508 5:140549029-140549051 CTCCTTCAGCTCCTCCAGCTTGG - Exonic
999239393 5:150118774-150118796 CTCGAGAAGCAGCACCAGCTGGG + Exonic
1001241128 5:170070588-170070610 CTCCCTTAGCATCCCCAGTTTGG + Intronic
1005952492 6:30642164-30642186 CTCCACTGCCAGCTCCAGCAAGG + Exonic
1006447964 6:34090523-34090545 CTCCACTCCCAGCTCCAGATGGG - Intronic
1007534449 6:42573004-42573026 CTCCATTTCCAGCTCAACCTGGG - Intronic
1008177688 6:48288597-48288619 CTCCCTTAGCTGCCCCAGATGGG + Intergenic
1019962165 7:4469888-4469910 CTCCATTAGCACAACCAGCAGGG - Intergenic
1023361913 7:39426035-39426057 CGCCGTTAGCAGCCCCAACTGGG + Intronic
1024512582 7:50215321-50215343 TTCCCTCAGCAGCTCCAGCATGG - Intergenic
1026824188 7:73571033-73571055 CAACTTGAGCAGCTCCAGCTAGG + Intronic
1031974402 7:128084727-128084749 CTCCATCAGCTTCTCCAACTGGG - Exonic
1032793303 7:135258273-135258295 CTGCATTTTCACCTCCAGCTTGG - Intronic
1038659636 8:29486126-29486148 CTCCATCACCAGCTCCTGCCAGG - Intergenic
1039763929 8:40608242-40608264 CTCCAACAGCAGCTACAGCAAGG - Intronic
1040555986 8:48477981-48478003 CTGCACTAGCAGCTCCCGCGTGG - Intergenic
1042751543 8:72163050-72163072 CTGCCTTAGCAGCCCCAGCTAGG - Intergenic
1045640760 8:104247826-104247848 CTAGATTGGCATCTCCAGCTTGG - Intronic
1048553810 8:135457055-135457077 CGCCCTTCCCAGCTCCAGCTCGG + Intergenic
1049572675 8:143376584-143376606 CTCCTTCAGCAGCTGCAGGTTGG - Exonic
1051378913 9:16435522-16435544 CTCCATTGGCTGCTCCTGCTGGG - Intronic
1053056310 9:34994902-34994924 CTCTGTGTGCAGCTCCAGCTAGG + Intronic
1053481956 9:38422676-38422698 CTCCATGGGGAGCTTCAGCTAGG + Intronic
1055423565 9:76169596-76169618 ATCCATTAGCAAGTTCAGCTGGG - Intronic
1059332807 9:113546782-113546804 CTACAGCAGCAGCTCCAGCTGGG - Intronic
1062457576 9:136646742-136646764 CCCCAGTAGCAGCTACGGCTGGG + Intergenic
1188290408 X:28381000-28381022 CTCCATTAGTAACTCCATATGGG + Intergenic
1189097613 X:38156906-38156928 CTCCTTTACCGGCTCCAGCTAGG - Exonic
1189841695 X:45086046-45086068 ATCCATTAGGAGATCCAGCTTGG - Intronic
1190916210 X:54812959-54812981 CACCATGAGCAGACCCAGCTTGG - Exonic
1194348225 X:92793187-92793209 CTCCCTTAGCTGGCCCAGCTGGG - Intergenic
1196151702 X:112381429-112381451 CTCCAGTAGCTGTTCCCGCTGGG - Intergenic
1196362982 X:114888378-114888400 ATACAGTAGAAGCTCCAGCTTGG - Intronic
1199601864 X:149545785-149545807 CTCCACCAGCAGCTCCCGCCAGG - Exonic
1200656555 Y:5909816-5909838 CTCCCTTAGCTGGCCCAGCTGGG - Intergenic
1201900537 Y:19043188-19043210 GTCCTTTTGCAGCTACAGCTCGG + Intergenic