ID: 922316256

View in Genome Browser
Species Human (GRCh38)
Location 1:224445045-224445067
Sequence GACCTGGGTGATGGTTTCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 858
Summary {0: 1, 1: 0, 2: 12, 3: 92, 4: 753}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922316256_922316261 -2 Left 922316256 1:224445045-224445067 CCCGTGAAACCATCACCCAGGTC 0: 1
1: 0
2: 12
3: 92
4: 753
Right 922316261 1:224445066-224445088 TCATGAAATAGAACGTTACCAGG 0: 1
1: 0
2: 1
3: 12
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922316256 Original CRISPR GACCTGGGTGATGGTTTCAC GGG (reversed) Intronic