ID: 922316256

View in Genome Browser
Species Human (GRCh38)
Location 1:224445045-224445067
Sequence GACCTGGGTGATGGTTTCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 858
Summary {0: 1, 1: 0, 2: 12, 3: 92, 4: 753}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922316256_922316261 -2 Left 922316256 1:224445045-224445067 CCCGTGAAACCATCACCCAGGTC 0: 1
1: 0
2: 12
3: 92
4: 753
Right 922316261 1:224445066-224445088 TCATGAAATAGAACGTTACCAGG 0: 1
1: 0
2: 1
3: 12
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922316256 Original CRISPR GACCTGGGTGATGGTTTCAC GGG (reversed) Intronic
900700406 1:4045123-4045145 TACCTAGGTGATGGGTTGACAGG + Intergenic
900853701 1:5163858-5163880 TACCTCGGTGATGGATTAACAGG - Intergenic
901866480 1:12110037-12110059 GGCCTGGGGGATGGTGCCACTGG - Exonic
902263565 1:15245592-15245614 GACCCAAGTGATGGCTTCACAGG - Intergenic
902744751 1:18466277-18466299 TACCTAGGTGATGGGTTGACAGG + Intergenic
902794182 1:18790136-18790158 GACCTGGATGCTGGCTTCCCAGG + Intergenic
903386073 1:22927680-22927702 GACCTAGTTGGTGGTTGCACAGG + Intergenic
903890291 1:26565417-26565439 GAGCTGGGTACTGGTTACACAGG - Intronic
904298056 1:29536134-29536156 GATTGTGGTGATGGTTTCACAGG + Intergenic
904365234 1:30006817-30006839 TACCTAGGTGATGGTTTGATAGG - Intergenic
904648161 1:31984003-31984025 GATCTGGTTGATGGTTATACAGG + Intergenic
904676839 1:32204050-32204072 GTCCTGGGGGCTGGTTTCAGCGG + Intronic
904801305 1:33094660-33094682 GACCTTGGTGGTGGCTTCCCTGG + Exonic
904889738 1:33770900-33770922 GCCCTTGGTGAAGGTTTTACAGG + Intronic
905419291 1:37828620-37828642 GACCGGGGTGCTGGTTACATGGG + Intronic
905548951 1:38820706-38820728 GACCTGGGTGGTGGTTACAAAGG + Intergenic
905970542 1:42138616-42138638 GATTGTGGTGATGGTTTCACAGG - Intergenic
906226557 1:44127314-44127336 GACCTGAGTGACAGTTTCACAGG - Intronic
906249288 1:44299083-44299105 GACCTGGGTGGTAGTTACCCAGG + Intronic
906488767 1:46251394-46251416 GTCCTGGATGATGGGTTCACGGG - Intronic
906904127 1:49869655-49869677 TACCTAGGTGATGGGTTCATAGG + Intronic
907070704 1:51532088-51532110 GACCTTGGTAATCGTTTCAGGGG + Intergenic
907224942 1:52936878-52936900 GACCTGGGTGATGGTAGCAAGGG + Intronic
907466299 1:54639978-54640000 GATCTGGGTGCTGGTTTCATGGG + Intergenic
907695304 1:56720698-56720720 TACCTAGGTGATGGGTTGACAGG - Intronic
909314770 1:74201837-74201859 TACCTAGGTGATGGGTTGACAGG - Intronic
909442221 1:75710155-75710177 GATTGTGGTGATGGTTTCACAGG + Intergenic
909544919 1:76835647-76835669 GAACTGTGTGATCTTTTCACAGG + Intergenic
909660987 1:78081916-78081938 GATCTGGGTGATGGTTAAACAGG - Intronic
910324761 1:85993634-85993656 GATCTTGGTGATGGTTTCACAGG + Intronic
910340991 1:86187227-86187249 GTTTAGGGTGATGGTTTCACAGG - Intergenic
911504443 1:98731032-98731054 TACCTGGGTGATGGGTTGATAGG + Intronic
911563928 1:99440105-99440127 GATCTGGGTGGTGGTTACATAGG + Intergenic
911826714 1:102495872-102495894 GACAATGGTGATGGTTTCACAGG + Intergenic
912660189 1:111520923-111520945 GACTGTGGTGATGGTTTCACAGG - Intronic
913266009 1:117045262-117045284 GACCTAGGTTGTGGTTTCATGGG + Intergenic
913549155 1:119899724-119899746 GATAATGGTGATGGTTTCACAGG + Intergenic
914407020 1:147385629-147385651 TACCTAGGTGATGGTTTGATAGG - Intergenic
915883488 1:159698924-159698946 GATCTGGGTAATGGCTCCACAGG + Intergenic
916172865 1:162014142-162014164 GAGCTGGTTGGTGGTTACACAGG + Intronic
916559349 1:165919895-165919917 GATTTTGGTGATGGTTTCAGAGG - Intergenic
918146627 1:181762146-181762168 GACCATGGCAATGGTTTCACAGG + Intronic
918279813 1:182993405-182993427 CACCTGGATGGTGGTTACACAGG + Intergenic
918678625 1:187322771-187322793 AACCTGGATGATGGGTTCATAGG + Intergenic
918728191 1:187952782-187952804 GACTTGTGTGATGGTTTCATGGG + Intergenic
919324129 1:196084029-196084051 GAACATGGTGATGGTTTCCCAGG + Intergenic
919365249 1:196651356-196651378 GACCTTGGTGGTGGTTTCACAGG + Intergenic
920053514 1:203177295-203177317 GACCTGGGTGGTGGTTACACAGG + Intergenic
920167939 1:204049360-204049382 AACCTAGGTGATGGGTTGACAGG - Intergenic
921758082 1:218882261-218882283 GACCTGGGTGAGGCTTTGGCAGG + Intergenic
921965480 1:221083718-221083740 GATCTGGGTGCTGGATGCACGGG + Intergenic
922316256 1:224445045-224445067 GACCTGGGTGATGGTTTCACGGG - Intronic
922439289 1:225639247-225639269 GACCTGGTTGGTGGCTACACAGG + Intronic
922451907 1:225744293-225744315 CACCTGGGTGATGGGTTGATAGG + Intergenic
922515362 1:226203984-226204006 GACTAGGGTGATGGATTCCCAGG + Intergenic
922640700 1:227228184-227228206 CACCTAGGTGATGGGTTGACAGG + Intronic
923840211 1:237662704-237662726 GACATGAGAGATGGTTTCACGGG - Intronic
1062805509 10:416802-416824 GCTCTGGGTGATGGTTTCCCAGG - Intronic
1063098098 10:2925979-2926001 GACCTGGGTGAGGGAGCCACTGG + Intergenic
1063413026 10:5851355-5851377 GATTTTGGTGATGGTTTCACGGG - Intergenic
1063635371 10:7777399-7777421 TATCTGGGTGGTGGTTCCACAGG + Intronic
1063669718 10:8090311-8090333 TACCTAGGTGATGGTTTGATAGG - Intergenic
1063748033 10:8908271-8908293 TACCTGGGTGATGGGTTGATAGG + Intergenic
1063761195 10:9078892-9078914 GACCTGGCTTATGGTTACAAGGG + Intergenic
1064003811 10:11684560-11684582 TACCTAGGTGATGGGTTGACAGG + Intergenic
1064289636 10:14021703-14021725 AATCTGGGTGGTGGTTACACAGG + Intronic
1064430048 10:15262944-15262966 GCCCTGGTGGCTGGTTTCACAGG - Intronic
1064657577 10:17571020-17571042 TACCTGGGTGATGGGTTGACAGG + Intergenic
1064713881 10:18155131-18155153 TACCTGGGTGGTGGCTCCACAGG - Intronic
1064778829 10:18810657-18810679 GATTGTGGTGATGGTTTCACAGG - Intergenic
1064785984 10:18894818-18894840 TACCTAGGTGATGGGTTGACAGG + Intergenic
1064968004 10:21034891-21034913 CACCTAGGTGATGGGTTGACAGG - Intronic
1065270289 10:24024026-24024048 GGTCTGGGTGGTGGTTACACAGG + Intronic
1065338079 10:24675487-24675509 GACTGTGGTGATGTTTTCACTGG + Intronic
1065940470 10:30559779-30559801 GAGCTGGGTGATGGATACATAGG - Intergenic
1066165479 10:32784308-32784330 TACCTGGGTGATGGGTTGATAGG - Intronic
1066228728 10:33411222-33411244 TACCTAGGTGATGGGTTGACAGG - Intergenic
1066585388 10:36928430-36928452 GACCTGGGTGACAGTTTCTTAGG + Intergenic
1067749377 10:48960030-48960052 CAGCTTGGTGAGGGTTTCACTGG + Intronic
1067756081 10:49006733-49006755 TACCTAGGTGATGGGTTGACAGG + Intergenic
1068409491 10:56636505-56636527 TATCTGGGTGATGGGTTGACAGG - Intergenic
1068546299 10:58349735-58349757 GAGCTGGGTGCTGGTTTCACAGG - Intronic
1068714112 10:60168636-60168658 TACCTAGGTGATGGGTTCATAGG - Intronic
1068903120 10:62292501-62292523 TACCTAGGTGATGGGTTGACAGG - Intergenic
1068961439 10:62870477-62870499 GAGCTGGGTGCTGGTCACACAGG + Intronic
1069015200 10:63421496-63421518 GACCTGGGGGATAGTTACACAGG + Intronic
1069130726 10:64698692-64698714 TGCCTGGGTGATGGGATCACTGG + Intergenic
1069435927 10:68382804-68382826 GACCTGGGTGGAGGTTACGCAGG + Intronic
1069472043 10:68702216-68702238 GACCTGGATGGAGGTTACACAGG - Intergenic
1070717049 10:78730055-78730077 GACCTGGGTGGTGTTTACATAGG - Intergenic
1070737763 10:78876131-78876153 GAGCTGGATGCTGGTTTCCCAGG + Intergenic
1071271019 10:84007405-84007427 AACCTGGGTGATGGGTTGATAGG - Intergenic
1071814773 10:89221126-89221148 GATTATGGTGATGGTTTCACAGG + Intronic
1071852809 10:89592378-89592400 GATCTGGGTGATGGCTATACAGG + Intronic
1072011737 10:91307905-91307927 AATCTGGGTGTTGGTTTTACAGG - Intergenic
1072181804 10:92990709-92990731 TACCTAGGTGATGGGTTGACAGG - Intronic
1072270877 10:93775155-93775177 GACCTGGGTGCTGGTTACAAGGG - Intronic
1072643693 10:97234315-97234337 TACCTAGGTGATGGGTTTACAGG + Intronic
1073128447 10:101168156-101168178 TACCTAGGTGATGGGTTGACAGG + Intergenic
1073571318 10:104583150-104583172 CACCTGGGTGATGGGTTAATGGG + Intergenic
1073831701 10:107391752-107391774 GATTTTGGTGATGGTATCACAGG - Intergenic
1073862140 10:107758564-107758586 GATTGTGGTGATGGTTTCACAGG - Intergenic
1074156034 10:110800574-110800596 GACTTTGGTGGTGGTTTTACGGG - Intronic
1074384544 10:113006537-113006559 GATCTGGGTCGTGGTTACACAGG - Intronic
1074564881 10:114568294-114568316 TACCTAGGTGATGGGTTGACAGG + Intronic
1074595822 10:114866059-114866081 TACCTGGGTGATGGGTTGATAGG - Intronic
1074744692 10:116520619-116520641 GATCATGGTAATGGTTTCACGGG - Intergenic
1074797897 10:116967515-116967537 GATGGTGGTGATGGTTTCACAGG - Intronic
1074917334 10:117970162-117970184 GAGCTGGGTGGTGAGTTCACAGG + Intergenic
1075251070 10:120874489-120874511 AACCTAGGTGATGGGTTGACAGG - Intronic
1075263353 10:120981013-120981035 CATCTGGGTGCTGGTTTCACAGG - Intergenic
1075422403 10:122311728-122311750 GGTCTGGGTGCTGGTTACACAGG - Intronic
1075425357 10:122337752-122337774 GTTCAGGGTGATGGTTACACAGG + Intronic
1075547975 10:123369838-123369860 GATCTGGGTGCTGGTTGCATGGG + Intergenic
1075820698 10:125306440-125306462 GACCTGGGAGGTGGTTACAAGGG - Intergenic
1076208263 10:128620523-128620545 GATCTGGGCCATGGTTACACAGG - Intergenic
1076349051 10:129802072-129802094 GACTGGGGTGTTGGTTACACAGG - Intergenic
1076437838 10:130458905-130458927 GACTGGGAGGATGGTTTCACAGG + Intergenic
1076805059 10:132851461-132851483 GAAGGTGGTGATGGTTTCACGGG - Intronic
1077149508 11:1064009-1064031 TACCTAGGTGATGGGTTGACAGG - Intergenic
1077406610 11:2385282-2385304 GGAGTTGGTGATGGTTTCACGGG - Intronic
1077428930 11:2505148-2505170 CACCTAGGTGATGGGTTGACAGG - Intronic
1077431139 11:2516591-2516613 CACCTGTGTGTTGGTTTCAGGGG - Intronic
1078283727 11:9930048-9930070 TACCTAGGTGATGGGTTGACAGG + Intronic
1078371911 11:10754492-10754514 GATTGTGGTGATGGTTTCACAGG - Intronic
1078805406 11:14695602-14695624 TACCTAGGTGATGGGTTAACAGG - Intronic
1079120870 11:17684023-17684045 GCCCTTGGTGATGGCTTCCCTGG - Intergenic
1079204770 11:18404901-18404923 GAGCTGGGTGGTGGGTTCACAGG - Intronic
1079350455 11:19687452-19687474 GACCTGGATGGTGGTTACACAGG - Intronic
1079996568 11:27300921-27300943 AACCTGAGTGATGGTTATACGGG - Intergenic
1080782512 11:35443292-35443314 TACCTAGGTGATGGATTGACAGG - Intronic
1080788929 11:35502343-35502365 TACCTGGGTGATGGATTGATAGG - Intronic
1081402175 11:42656057-42656079 TACCTGGGTGATGGGTTGATAGG + Intergenic
1081641751 11:44760443-44760465 GATCTGGGTTTTGGTTGCACAGG + Intronic
1081719846 11:45280578-45280600 GACGTGGGTGCTGGTTACAGAGG - Intronic
1084496557 11:69508084-69508106 GATCTTGGTGGTGGTTTCATGGG - Intergenic
1084922913 11:72486069-72486091 GATCTGGGTGATAGTTCCACAGG + Intergenic
1085508973 11:77075774-77075796 GACCTGGGTGGTGGTTCCATGGG - Intronic
1086253261 11:84843183-84843205 GATTATGGTGATGGTTTCACAGG + Intronic
1086976948 11:93143005-93143027 TACCTAGGTGATGGGTTGACAGG + Intergenic
1087583505 11:100089950-100089972 TACCTAGGTGATGGGTTGACAGG + Intronic
1087696719 11:101387021-101387043 GATCTAGGTAATGGTTACACAGG - Intergenic
1088308110 11:108431545-108431567 GATCTGGGTGACGGTTACATAGG + Intronic
1088661431 11:112051083-112051105 TACCTGGGTGATGGGTTGACAGG + Intronic
1089034722 11:115375411-115375433 GACCTCGGTAATGGTTACTCGGG + Intronic
1089663058 11:119998276-119998298 GAATTGGCTCATGGTTTCACAGG + Intergenic
1090686944 11:129132023-129132045 CACCTAGGTGATGGGTTGACAGG - Intronic
1090694786 11:129228762-129228784 TACCTAGGTGATGGGTTGACAGG + Intronic
1091909001 12:4213738-4213760 GACTTGGGTGATGGTTACATGGG - Intergenic
1092043870 12:5410857-5410879 GATCTGGGTGATAGTTACATAGG - Intergenic
1092325031 12:7521979-7522001 TACCTAGGTGATGGGTTGACAGG - Intergenic
1093156658 12:15693956-15693978 CACCTAGGTGATGGGTTGACAGG + Intronic
1093510360 12:19919824-19919846 TACCTGGGTGATGGGTTGATAGG - Intergenic
1093545197 12:20337300-20337322 TACCTAGGTGATGGGTTAACAGG - Intergenic
1094345751 12:29466660-29466682 GATCTGGGTGTTGGTTACATGGG + Intronic
1094439177 12:30456225-30456247 GACAGTGGTGATGGTTTCATAGG - Intergenic
1094722448 12:33078226-33078248 TACCTAGGTGATGGGTTGACAGG - Intergenic
1095160416 12:38907414-38907436 GATTTTGGTGATGGCTTCACAGG - Intronic
1095215433 12:39542058-39542080 AACCTGGGTGGTGGTTAAACAGG + Intergenic
1095501374 12:42843195-42843217 TACCTAGGTGATGGGTTGACAGG - Intergenic
1095851818 12:46817575-46817597 GAACTGGGTTTTGGTTTCAGGGG - Intronic
1095877042 12:47090537-47090559 GATTTGGGTGATGGTTACAAGGG - Intronic
1096602497 12:52739697-52739719 GAGGTGGGTGATGGGTACACAGG + Intergenic
1096997971 12:55851351-55851373 GATCTGAGTGATGGCTTCATAGG - Intergenic
1097204696 12:57310705-57310727 GATTGGGGTGATGGTTTCACAGG - Intronic
1097475802 12:60054278-60054300 GAGGTGGGTGATGGGTACACAGG + Intergenic
1098481767 12:70969952-70969974 TACCTGAGTGATGGGTTGACAGG + Intergenic
1099653742 12:85462358-85462380 GACTGTGGTGATGGTTTCATGGG + Intergenic
1100505920 12:95220137-95220159 GATCTGGGTGCTGGTTACATGGG - Intronic
1100517911 12:95345796-95345818 GATCTGGGTGGTGATTACACAGG + Intergenic
1100593030 12:96046902-96046924 GATCTGGGTGCTGATTGCACTGG - Intergenic
1100726371 12:97413270-97413292 GAACTGGGTGGTGGTTACATTGG + Intergenic
1100894679 12:99168114-99168136 GATTGTGGTGATGGTTTCACAGG + Intronic
1100995789 12:100299428-100299450 GATCGTGGTGATGGTTTCACAGG - Intronic
1101280934 12:103254820-103254842 TACCTAGGTGATGGTTTGATAGG + Intronic
1101531050 12:105574033-105574055 TACCTAGGTGATGGGTTGACAGG - Intergenic
1101616036 12:106338255-106338277 TACCTGGGTGATGAAATCACTGG - Intronic
1101980176 12:109399262-109399284 GATCTGGGTGGTGGTTACAGAGG - Intronic
1101981816 12:109414066-109414088 AATCTGGGTGCTGGTTGCACAGG + Intronic
1102897001 12:116606189-116606211 AACTTGGGTGATGGTTATACGGG - Intergenic
1103335346 12:120185182-120185204 GATCTGGGTGCTGGTTATACTGG + Intronic
1103428271 12:120857873-120857895 TACCTCGGTGATGGGTTGACAGG + Intronic
1103438602 12:120946520-120946542 GATCATGGTGATGGTTTCACAGG - Intergenic
1103720506 12:122972464-122972486 GATCTGGGTGCTGGTTACATGGG + Intronic
1104374707 12:128254167-128254189 TACCTAGGTGATGGTTTGATAGG + Intergenic
1105072387 12:133242627-133242649 GACCTGGGTGATGCTCCCAGAGG - Intergenic
1105610364 13:21963696-21963718 AACCTAGGTGATGGGTTGACAGG + Intergenic
1105790486 13:23793441-23793463 GATCTGGGTGGTGGTTCCACAGG + Intronic
1106214885 13:27687842-27687864 GATTATGGTGATGGTTTCACAGG + Intergenic
1106683019 13:32027740-32027762 GTCCTGGGTGATGTATTCCCTGG - Intergenic
1107429854 13:40330653-40330675 AGAATGGGTGATGGTTTCACAGG - Intergenic
1107523084 13:41202492-41202514 GACCTGAGTGGAGGTTACACAGG - Intergenic
1107583827 13:41822079-41822101 GATATTGGTGATGGTTTCATGGG + Intronic
1108132538 13:47318273-47318295 GAATGTGGTGATGGTTTCACAGG - Intergenic
1108345392 13:49541331-49541353 TACCTAGGTGATGGGTTGACAGG + Intronic
1108420036 13:50239366-50239388 AAGCTGGGTGATGGGTTCATGGG + Intronic
1110041700 13:70767946-70767968 AACCTGGGTGATGGGTTGATAGG + Intergenic
1110745146 13:79043642-79043664 GATTGTGGTGATGGTTTCACTGG + Intergenic
1111051397 13:82886595-82886617 GAACTGGGTGCAGGTTACACTGG + Intergenic
1111686877 13:91513101-91513123 TACCTAGGTGATGGGTTCATAGG - Intronic
1111862855 13:93730046-93730068 GCCCTGGGTGCTGGTCACACAGG + Intronic
1111915455 13:94355866-94355888 TACCTAGGTGATGGGTTCATAGG - Intronic
1111973190 13:94938599-94938621 GATCTGCATGATGGTTTCATAGG - Intergenic
1112677977 13:101726470-101726492 GATCTAGGTGATGGTTGCACAGG - Intronic
1112736423 13:102425278-102425300 TATCTGGGTGCTGGTTACACAGG + Intergenic
1113182385 13:107644809-107644831 GATCTGGGTGGTGGTTCCAGAGG - Intronic
1114041836 14:18685935-18685957 GGTCTGGGTGCTGGTTTCATGGG - Intergenic
1117230328 14:53710499-53710521 GGCCTGGGTGATGGTTACTTGGG + Intergenic
1117288639 14:54311221-54311243 GATCTGGGTGTTGGTTGCATGGG - Intergenic
1117294719 14:54368779-54368801 GATCTGGGTGCTGGTTACGCGGG + Intergenic
1117301381 14:54431810-54431832 GATCTGGGTGGTAGTTTAACAGG + Intronic
1117733597 14:58747906-58747928 GGCGTGGGTGATGATTTCACAGG - Intergenic
1117868006 14:60169558-60169580 GATTGTGGTGATGGTTTCACAGG - Intronic
1118737456 14:68712132-68712154 GAACTGAGAGATGGGTTCACGGG + Intronic
1118929223 14:70224611-70224633 GACCTGGGTGGTGGTTACGCAGG + Intergenic
1119335799 14:73832579-73832601 GACTTGAGTGTTGGTTACACAGG + Intergenic
1119568898 14:75652620-75652642 GAGCTGGGTGTTGGTTGCATTGG - Intronic
1120278625 14:82410564-82410586 GATGGTGGTGATGGTTTCACAGG - Intergenic
1120368493 14:83602323-83602345 TACCTAGGTGATGGTTTGATAGG - Intergenic
1120901905 14:89582708-89582730 GATCATGGTGATGGTTTCACAGG - Intronic
1121167703 14:91823030-91823052 GACTGTGGTGATGGTTTCATAGG + Intronic
1121266729 14:92608269-92608291 GAACTGGGTGAAGGGTACACAGG + Intronic
1121673912 14:95736679-95736701 GAGCTGGGTGCTGGTCACACAGG + Intergenic
1122240642 14:100364071-100364093 GATTTGGGTGCTGGTTACACAGG + Intronic
1122594900 14:102883534-102883556 GACCTGGGTGTTGGCTTCATGGG + Intronic
1123692474 15:22850037-22850059 AAGCTGGGTGATGGGTACACAGG - Intronic
1123993010 15:25697254-25697276 GCTCTGGGTGTTGGTTTCAAAGG - Intronic
1125532903 15:40425234-40425256 GACCTGCGTGTTGGGTACACAGG - Intronic
1126028355 15:44471491-44471513 GATGATGGTGATGGTTTCACAGG - Intronic
1126145197 15:45467277-45467299 GATTGTGGTGATGGTTTCACAGG - Intergenic
1126236902 15:46396150-46396172 TACCTAGGTGATGGTTTGATAGG + Intergenic
1127183177 15:56447730-56447752 GATTGTGGTGATGGTTTCACAGG - Intronic
1127337234 15:58000113-58000135 TACCTAGGTGATGGGTTGACAGG + Intronic
1128907783 15:71483680-71483702 TACCTAGGTGATGGGTTGACAGG - Intronic
1129559351 15:76550282-76550304 TACCTAGGTGATGGGTTGACAGG - Intronic
1129565717 15:76620911-76620933 TACCTAGGTGATGGGTTGACAGG + Intronic
1129774133 15:78223339-78223361 TACCTAGGTGATGGTTTGATAGG + Intronic
1129828959 15:78654798-78654820 GAGCTGGATGCTGGTTACACAGG - Intronic
1130014792 15:80178270-80178292 GATCTGGGTGCTGGTTGCACAGG - Intronic
1130567292 15:85007442-85007464 GATCTGGGTGCTGGTTATACAGG + Intronic
1130819074 15:87473579-87473601 TATTTGGGTGATGGTTACACTGG + Intergenic
1131018435 15:89077084-89077106 GAGCTGGGTGGTGGTTACACAGG - Intergenic
1131776624 15:95808426-95808448 GATCTGGGTGATGGTTACAAGGG + Intergenic
1132128619 15:99252847-99252869 AACCTAGGTGATGGGTTGACAGG - Intronic
1132257951 15:100394080-100394102 GACCTGGGTGGTGGTTACATGGG - Intergenic
1132301840 15:100780910-100780932 GACCATGGTGATGGTTTCCTGGG + Intergenic
1132325337 15:100964162-100964184 GGCCTGGGTGATGGGTGCAATGG + Intronic
1132653603 16:1032366-1032388 GACCTGGGGGGTGGTTCTACAGG - Intergenic
1133393026 16:5424580-5424602 TACCTAGGTGATGGGTTGACAGG + Intergenic
1133574942 16:7079738-7079760 GATCTAGGTGGTGGTTACACAGG + Intronic
1134035740 16:11029811-11029833 GATCATGGTGATGATTTCACGGG - Intronic
1134427612 16:14166592-14166614 TACCTAGGTGATGGGTTGACAGG - Intronic
1134776755 16:16859849-16859871 TACCTAGGTGATGGGTTGACAGG - Intergenic
1135184300 16:20301616-20301638 GAACGGGGTGATGGTTACACAGG + Intergenic
1135484601 16:22853122-22853144 GATCTGGGTACTGGTTACACAGG - Intronic
1137387556 16:48055518-48055540 GAGCTGGGCCCTGGTTTCACGGG - Intergenic
1137552268 16:49445829-49445851 GATTTTGGTGATGGTTTCATGGG - Intergenic
1137575860 16:49599926-49599948 GATGTGGGTGCTGGTTACACAGG + Intronic
1137601427 16:49758974-49758996 GACCTGGGAAGTGGTTTCAATGG + Intronic
1137735373 16:50719638-50719660 GTCCTGGGAGGTGGTTTCCCCGG - Intronic
1138165756 16:54800179-54800201 GACCTGGCTTGTGGTTTCAAGGG + Intergenic
1138426735 16:56939265-56939287 GGCCTGGGTCCTGGTTTCTCCGG + Exonic
1138720247 16:59071515-59071537 TACCTAGGTGATGGGTTGACAGG - Intergenic
1138890367 16:61135926-61135948 GAATTTGGTGATGGTTTCATGGG + Intergenic
1139089249 16:63624186-63624208 TACCTAGGTGATGGGTTGACAGG - Intergenic
1139191034 16:64863514-64863536 GAACTGGGTGATGGCTATACAGG - Intergenic
1139363786 16:66420348-66420370 GAGCTGGGTGCTGGGTACACAGG - Intergenic
1139676206 16:68525573-68525595 AAACTGGGTGATGGGTACACGGG + Intergenic
1139795372 16:69478933-69478955 GTCCTGGGTGATGGATACATTGG - Intergenic
1140343182 16:74185581-74185603 TACCTAGGTGATGGGTTGACAGG - Intergenic
1140707700 16:77646173-77646195 GATCTGGGTGTTGGTTACATAGG + Intergenic
1141059073 16:80847938-80847960 TACCTTGGTGATGGGTTGACAGG + Intergenic
1141478372 16:84289274-84289296 CACATGGGTGATGGGATCACTGG - Intergenic
1141520171 16:84573443-84573465 GATCTGGGTGGTGGCTTCAAAGG + Intronic
1141838273 16:86557173-86557195 TACCTAGGTGATGGGTTGACAGG + Intergenic
1141866500 16:86753464-86753486 TACCTAGGTGATGGGTTGACAGG - Intergenic
1142323046 16:89397215-89397237 GACCTGGGTGAGGGGAGCACGGG + Intronic
1142627941 17:1203955-1203977 GACCTCGGTGCCGGCTTCACGGG + Intronic
1143370843 17:6438127-6438149 GACCTAGGTGATGGTTACATGGG + Intergenic
1143572862 17:7771449-7771471 GACCTGGGTGATGGGTGCTCCGG - Exonic
1143752532 17:9039583-9039605 GATTGTGGTGATGGTTTCACAGG - Intronic
1144002572 17:11069384-11069406 GACTGTGGTGATGGTATCACAGG - Intergenic
1144034255 17:11351203-11351225 TACCTAGATGATGGTTTCATAGG + Intronic
1144345292 17:14344324-14344346 TACCTGGGTGATGGGATCAACGG - Intronic
1146098659 17:29957412-29957434 TACCTAGGTGATGGTTTGATAGG - Intronic
1146640609 17:34538030-34538052 TACCTGGGAGATTGTTTCTCAGG + Intergenic
1146671009 17:34737792-34737814 TACCTAGGTGATGGGTTGACAGG - Intergenic
1146673488 17:34757709-34757731 GACCTGGGAGGTGGTTTCCTGGG - Intergenic
1147127784 17:38384186-38384208 GGGCTGGGTGATGGATACACAGG - Intronic
1147560585 17:41506560-41506582 GTCCTGGGTGGTGTTTACACAGG - Intergenic
1148641084 17:49188156-49188178 GATCTAGGTGATGGTGACACAGG + Intergenic
1148765076 17:50033912-50033934 AACCTGGGTTCTGGTTACACAGG + Intergenic
1149026574 17:52034546-52034568 GAGCTGGGGGATGGTTACATAGG + Intronic
1149098218 17:52870733-52870755 TACCTGGGTGATGGGATCATGGG + Intronic
1149211097 17:54302156-54302178 GACCTGAGTAGTGGTTTCATGGG + Intergenic
1149234738 17:54577090-54577112 GACCTGGGTAAGGGTTACATAGG - Intergenic
1150727042 17:67659838-67659860 GATTGTGGTGATGGTTTCACAGG - Intronic
1151146371 17:72045425-72045447 TACCTGGCTCATGGTTCCACAGG + Intergenic
1151581796 17:74983474-74983496 GAGCTGGGTGCTGGTTACACAGG - Intergenic
1152054332 17:78011255-78011277 GATCATGGTGATGGTTTAACAGG - Intronic
1152100599 17:78299618-78299640 GACCTGGGTGAGGGTGACATAGG - Intergenic
1152324001 17:79625070-79625092 GATGGTGGTGATGGTTTCACGGG - Intergenic
1152416832 17:80168151-80168173 AACCTAGGTGATGGGTTGACAGG - Intergenic
1152788981 17:82268080-82268102 GACCTTGGTGTCGGTTCCACAGG - Intronic
1153275489 18:3363215-3363237 GAGCTGGGAACTGGTTTCACAGG - Intergenic
1153349495 18:4063005-4063027 CACCTGGATGATGTTTTCAAAGG - Intronic
1153607759 18:6851970-6851992 GACTGTGGTGATGGTTTCATAGG + Intronic
1154299311 18:13179197-13179219 GATTGTGGTGATGGTTTCACTGG - Intergenic
1154299485 18:13180641-13180663 GATTATGGTGATGGTTTCACAGG - Intergenic
1155879203 18:31123029-31123051 GACCTGGGGCAGGGTTACACTGG + Intergenic
1156206521 18:34892047-34892069 GATTGTGGTGATGGTTTCACAGG + Intergenic
1156210929 18:34941678-34941700 GAGCATGGTGATGGTTACACTGG + Intergenic
1156283362 18:35664177-35664199 GATTTGGCTGATGGTTACACAGG - Intronic
1156358498 18:36362716-36362738 CACCTGGGTTATGGTTTCAATGG - Intronic
1156429364 18:37054722-37054744 TATTTGGGTGATGGATTCACTGG + Intronic
1156591404 18:38493278-38493300 GATGTTGGTGATGGTTTTACAGG + Intergenic
1157016821 18:43725070-43725092 TACCTAGGTGATGGGTTGACAGG + Intergenic
1157699713 18:49753526-49753548 AAGCTGGGTGATGGGTTCATGGG - Intergenic
1158605965 18:58896473-58896495 GACATGGGTGGTGGCTTGACTGG - Intronic
1158982351 18:62775766-62775788 GACTGTGGTGGTGGTTTCACAGG - Intronic
1159239127 18:65718196-65718218 TACCTGGGTGATGGGTTGATAGG + Intergenic
1159327887 18:66947733-66947755 CACCTGGGTGATGGGTCGACAGG + Intergenic
1162505121 19:11079136-11079158 GACATGGCTGATGGTTCCAAAGG - Intergenic
1163067193 19:14806468-14806490 TACCTAGGTGATGGGTTGACAGG - Intronic
1163076321 19:14895068-14895090 TACCTAGGTGATGGGTTCATAGG + Intergenic
1164452379 19:28377973-28377995 GATGGTGGTGATGGTTTCACAGG - Intergenic
1164487370 19:28670304-28670326 GATCTGGGTGGTGGTTACATGGG + Intergenic
1164730279 19:30498498-30498520 TACCTAGGTGATGGGTTAACAGG + Intronic
1164887450 19:31794156-31794178 TACCTGGGTGATGGGTTGATAGG - Intergenic
1164980451 19:32609734-32609756 GATGGTGGTGATGGTTTCACAGG + Intronic
1165294168 19:34912796-34912818 TACCTAGGTGATGGGTTGACAGG - Intergenic
1165296893 19:34934719-34934741 GACCAGAGTGATGGTTACAAAGG - Intronic
1165534770 19:36434523-36434545 GACCTGAGTTCTGGTTACACAGG + Intergenic
1165613219 19:37175159-37175181 CACCTAGGTGATGGGTTGACAGG + Intronic
1166042307 19:40211462-40211484 TACCTAGGTGATGGGTTGACAGG - Intronic
1166251611 19:41575566-41575588 GTCCTTGGTGAAGGTTTCAGGGG - Intronic
1166811759 19:45518636-45518658 GATCTGGGAGGTGGTTTCCCGGG - Intronic
1166865587 19:45834678-45834700 GATCTGGGTGATGGTTACACTGG + Intronic
1167084725 19:47301382-47301404 GATCTGAGTGTTGGTTACACAGG - Intronic
1167122540 19:47527244-47527266 GACTGTGGTGATGGTTTCCCAGG + Intronic
1167141803 19:47656705-47656727 GAGCTGAGTGATGCTTACACAGG - Intronic
1167450488 19:49565368-49565390 GATCTGGGTGCTGGTTACATGGG + Intronic
1167731640 19:51261935-51261957 GACCTCAGTGGTGGTTACACTGG - Intronic
1168178122 19:54640351-54640373 TACCTAGGTGATGGGTTGACAGG - Intronic
1168186313 19:54702199-54702221 TACCTAGGTGATGGGTTGACAGG + Intergenic
1168299538 19:55396366-55396388 GACCTGGGTATTGGTTACATAGG - Intronic
1168616972 19:57846050-57846072 GACTCTGATGATGGTTTCACGGG - Exonic
1168637383 19:58007101-58007123 GATCTGGGTGGTGGTTACACAGG + Exonic
1202649013 1_KI270706v1_random:164055-164077 TACCTAGGTGATGGGTTGACAGG + Intergenic
925597882 2:5574200-5574222 GATTGGGGTGATGGTTACACAGG - Intergenic
925819012 2:7780745-7780767 GATCTGGGTGCTGGTTACATGGG - Intergenic
925878922 2:8334236-8334258 TACCTAGGTGATGGGTTGACAGG + Intergenic
925971496 2:9109737-9109759 AGGCTGGGTGGTGGTTTCACAGG + Intergenic
926187855 2:10705637-10705659 GACCTGGGTGGTGGCTTCATGGG + Intergenic
926211861 2:10877173-10877195 GACTTGGGTGGTGGTTACACAGG + Intergenic
926443859 2:12920450-12920472 TACCTAGGTGATGGGTTGACAGG - Intergenic
926479006 2:13364563-13364585 AACCTAGGTGATGGGTTCATAGG + Intergenic
926751838 2:16204313-16204335 GAGCTGGGTGCTGGTTGCAGGGG + Intergenic
927831706 2:26357093-26357115 GAGCTGGGTGGTGGTTACATGGG - Intronic
928145710 2:28773107-28773129 GATCTGGATGATGGTTACTCAGG + Intronic
928319209 2:30269789-30269811 GACCTGGGTAGTGGTTTTATGGG - Intronic
928711126 2:34006831-34006853 GATTGTGGTGATGGTTTCACAGG - Intergenic
930145999 2:48005041-48005063 GACTTGGGTGATTGTTTCAAGGG - Intergenic
930571132 2:53088504-53088526 TACCTAGGTGATGGGTTGACAGG - Intergenic
931468542 2:62514238-62514260 GATCTGGTTGCTGGTTACACAGG - Intergenic
931573463 2:63695713-63695735 GACCTGGGTGCTGGTTACATGGG - Intronic
931703763 2:64929677-64929699 GATTGTGGTGATGGTTTCACTGG - Intergenic
932411503 2:71550522-71550544 CTCCTGGGAGATGGTTTCTCTGG + Intronic
933182096 2:79239047-79239069 TACCTGGGTGATGGGTTGATAGG - Intronic
933568879 2:83983810-83983832 GACCTGAGTGGTGATTACACAGG - Intergenic
934071791 2:88390880-88390902 GAGCTGGGTGATGGGTTCAAGGG + Intergenic
934876147 2:97922811-97922833 AATCTGGGTGGTGGTTACACAGG + Intronic
934990417 2:98916402-98916424 GATCATGGTGTTGGTTTCACAGG + Intronic
935100067 2:99985799-99985821 CACCTGAGTGATGGTTATACAGG + Intronic
935138062 2:100324816-100324838 AACCTAGGTGATGGTTTGATAGG + Intergenic
935177660 2:100663900-100663922 GGCCTGGGTGCTGCTCTCACAGG - Intergenic
935183472 2:100710719-100710741 GACTGTGGTGATGGTTTCACAGG + Intergenic
935668183 2:105532252-105532274 GATCTGGGTGGTGGTTACAGAGG + Intergenic
935952161 2:108339833-108339855 TACCTAGGTGATGGGTTGACAGG - Intergenic
936339864 2:111621600-111621622 GATCTTGGTGGTGGTTTCATGGG + Intergenic
936488781 2:112951771-112951793 TACCTAGGTGATGGGTTGACAGG - Intergenic
936552209 2:113455196-113455218 GACCTAGGTGATGGGTTAATAGG + Intronic
937045735 2:118850480-118850502 GGGATGGGTGAGGGTTTCACAGG + Intergenic
937313013 2:120913853-120913875 GGCCCTGGTGATGGTTTCCCAGG - Intronic
937474323 2:122201616-122201638 TACATGGGTGAAGGTTTCAAAGG - Intergenic
937586649 2:123559699-123559721 TACCTAGGTGATGGGTTGACAGG - Intergenic
938541120 2:132284474-132284496 TACCTAGGTGATGGGTTGACAGG - Intergenic
938829804 2:135039077-135039099 GGCCTGGGTGTTGGGTACACAGG + Intronic
939822376 2:146972878-146972900 GACTTGGGTGTAAGTTTCACAGG - Intergenic
939822500 2:146975101-146975123 GACTTGGGTGTAAGTTTCACAGG + Intergenic
939898446 2:147821092-147821114 GACCTGAATGATGGATGCACAGG - Intergenic
940079212 2:149780851-149780873 GACCTGTGTAATGGTTTAAATGG - Intergenic
940456180 2:153903838-153903860 GACCTGTGGGATGGTTACATGGG - Intronic
940707372 2:157122323-157122345 GATTTGGGTGATGGCTTCATGGG + Intergenic
941089321 2:161156900-161156922 GAACTGGGTGTTTGTTTCTCTGG - Intronic
941181157 2:162260921-162260943 TACCTAGGTGATGGGTTGACAGG + Intergenic
941989383 2:171540091-171540113 AATCTAGGTGCTGGTTTCACAGG - Intronic
942348126 2:175024837-175024859 GATTGTGGTGATGGTTTCACAGG - Intergenic
942571165 2:177315797-177315819 GATCTGGGTGCTGGTTACATGGG + Intronic
942589120 2:177522166-177522188 GACTGGGGTGATGGTTTCACAGG - Intronic
943428911 2:187773136-187773158 TACCTAGGTGATGGTTTGATAGG + Intergenic
943764444 2:191645625-191645647 GATCTGGGTGTTGGTTACATGGG + Intergenic
944116033 2:196187129-196187151 TACCTAGGTGATGGATTGACAGG - Intergenic
944125965 2:196293082-196293104 TACCTGGGTGATGGGTTGATAGG - Intronic
944183198 2:196918779-196918801 GACTAGGGTTTTGGTTTCACGGG + Intronic
944419629 2:199515761-199515783 TACCTAGGTGATGGGTTCATAGG + Intergenic
944524188 2:200601528-200601550 GACCGTGGTGATGGTTTCATGGG + Intronic
944869916 2:203899599-203899621 TACCTAGGTGATGGGTTGACAGG + Intergenic
945158098 2:206860303-206860325 TACCTGGGTGATGGGTTGATAGG - Intergenic
945206627 2:207339957-207339979 CATCTGAGTGTTGGTTTCACAGG - Intergenic
945639652 2:212408173-212408195 TACCTAGGTGATGGTTTGATAGG - Intronic
945884035 2:215355739-215355761 GACCTGGTTGGTGGTGACACAGG - Intergenic
946169294 2:217885034-217885056 GACCTTGATGATGCTTTCAAAGG - Exonic
946780150 2:223186423-223186445 GATCTAGGTGATGATTGCACAGG + Intronic
946832415 2:223740101-223740123 TACCTAGGTGATGGGTTGACAGG + Intergenic
947295239 2:228623701-228623723 GACTGTGGTGATAGTTTCACAGG + Intergenic
947387234 2:229603675-229603697 GATCTGAGTGGTGGTTACACAGG + Intronic
1169281450 20:4270747-4270769 GATTTGGGCGATGGTTACACAGG - Intergenic
1169630713 20:7627533-7627555 GAGCTGGGAGATGGGTGCACTGG + Intergenic
1170151584 20:13232235-13232257 GACTATGGTGATGGTTTTACAGG - Intronic
1170231925 20:14058117-14058139 GACTTGGGTGGTGGTTACATGGG + Intronic
1170480456 20:16760315-16760337 CACCTGGGTGGGTGTTTCACGGG - Intronic
1170570736 20:17630984-17631006 CTCCTTGGTGATGGCTTCACTGG - Intronic
1170867942 20:20176777-20176799 TACCTAGGTGATGGGTTGACAGG + Intronic
1171211940 20:23324026-23324048 AACCTGGGTGCAGGTCTCACTGG + Intergenic
1171870031 20:30517479-30517501 TACCTAGGTGATGGGTTGACAGG - Intergenic
1172139542 20:32712523-32712545 AACCTAGGTGATGGGTTGACAGG + Intronic
1172202332 20:33135355-33135377 GATCTGGGTGGTGGTTGCAAGGG - Intergenic
1172945341 20:38683377-38683399 GGCCTGGGTGTGAGTTTCACAGG + Intergenic
1173952220 20:47002288-47002310 TACCTAGGTGATGGGTTGACAGG - Intronic
1174527182 20:51182273-51182295 GACCTTAATGATGATTTCACAGG - Intergenic
1174566117 20:51465606-51465628 GACCTGAGTGATTGGTCCACGGG - Intronic
1174568946 20:51487392-51487414 TACCTAGGTGATGGGTTGACAGG + Intronic
1174785059 20:53424653-53424675 TACCTAGGTGATGGGTTGACAGG - Intronic
1175214397 20:57383815-57383837 GACTGTGGTGATGGTTTCATGGG - Intergenic
1175273849 20:57754167-57754189 GTTCTGGGAGATGGTTACACAGG - Intergenic
1175420877 20:58832411-58832433 GACCTTGGTGATATTTTGACTGG - Intergenic
1175457632 20:59127358-59127380 GACCTGACTGAGGTTTTCACAGG - Intergenic
1175796532 20:61774609-61774631 TACCTAGGTGATGGGTTGACAGG - Intronic
1176602802 21:8808487-8808509 TACCTAGGTGATGGGTTGACAGG - Intergenic
1176907583 21:14521770-14521792 TACCTAGGTGATGGGTTGACAGG + Intronic
1177854008 21:26381741-26381763 TCCCTGGGTGCTGATTTCACAGG + Intergenic
1178607722 21:34054341-34054363 GACCTGGGTGTTTTTATCACCGG - Intergenic
1178749256 21:35284807-35284829 GATCTGGGTGGTGGTTACACGGG - Intronic
1178846575 21:36178881-36178903 GATTGTGGTGATGGTTTCACAGG - Intronic
1179422320 21:41246689-41246711 GACCTGGCTGATGGTATTTCTGG + Intronic
1179435005 21:41355749-41355771 GACCATGGTGATGGTTGCACAGG + Intronic
1179635954 21:42709358-42709380 TACCTAGGTGATGGGTTGACAGG + Intronic
1179911779 21:44454749-44454771 GATTGTGGTGATGGTTTCACAGG + Intergenic
1180345087 22:11700044-11700066 TACCTAGGTGATGGGTTGACAGG - Intergenic
1180799270 22:18624246-18624268 CAGCTGGGTGATGGTCTCTCCGG + Intergenic
1181222448 22:21371020-21371042 CAGCTGGGTGATGGTCTCTCCGG - Intergenic
1181549767 22:23631024-23631046 TACCTAGGTGATGGGTTGACAGG + Intronic
1181638204 22:24184006-24184028 CAGCTGGGTGATGGTCTCTCTGG - Intronic
1181750043 22:24982887-24982909 GGCCTGGGTGCTGGTTTCCCTGG + Intronic
1181798859 22:25330940-25330962 TACCTAGGTGATGGTTTGACAGG - Intergenic
1181854486 22:25772312-25772334 ACTCTGTGTGATGGTTTCACAGG + Exonic
1182034196 22:27184745-27184767 GCCCTGGATGAGGATTTCACTGG - Intergenic
1182081946 22:27535667-27535689 AAGCTGGGTGAAGGGTTCACAGG + Intergenic
1182702396 22:32251018-32251040 AACCTAGATGATGGGTTCACAGG + Intronic
1182952862 22:34393938-34393960 TACCTAGGTGATGGTTTAATAGG + Intergenic
1184558000 22:45243595-45243617 GATCTGGGGGCTGGTTACACGGG + Intergenic
1184796210 22:46734557-46734579 GATCCGGGTGATGTTTACACAGG + Intronic
1184949119 22:47827450-47827472 TACCTAGGTGATGGGTTGACGGG + Intergenic
949390720 3:3559194-3559216 TACCTAGGTGATGGGTTGACAGG + Intergenic
949810293 3:8000147-8000169 CACCTGGGTGATGGCCTCTCAGG - Intergenic
950626180 3:14248798-14248820 TACATGAGTGATGGTTTCATGGG + Intergenic
950651116 3:14407403-14407425 GATTTGGGTGGTGGTTACACAGG - Intronic
950762795 3:15248592-15248614 GATCTGGGTGATGGTTACCCAGG + Intronic
950823308 3:15786537-15786559 GACTGTGGTGATGGTTTCATAGG + Intronic
951339661 3:21469092-21469114 GACTAAGGTGATGGTTACACTGG + Intronic
951440697 3:22719940-22719962 GATCGTGGTGATGGTTCCACAGG - Intergenic
951843487 3:27060519-27060541 GACCTGGGCAGTGGTTTCATGGG + Intergenic
952295699 3:32060026-32060048 GATCTGGTTGGTGGTTACACAGG + Intronic
952334233 3:32391442-32391464 GATCTGGGCGACGGTTACACAGG + Intergenic
952442795 3:33349927-33349949 GACCCGGATGGTGGTTTTACTGG + Intronic
952506157 3:34008410-34008432 GACCTGGGGGAGGGTCTCAGGGG + Intergenic
952769528 3:36985361-36985383 GACCTGGGTGGTGCATTCAAGGG + Intergenic
952798491 3:37265630-37265652 GATGGTGGTGATGGTTTCACAGG - Intronic
953111001 3:39938079-39938101 GATCTGTGTGCTGGTTACACAGG - Intronic
953193521 3:40711665-40711687 GATCTGGGTGCTAGTCTCACAGG - Intergenic
953481038 3:43252470-43252492 GACCTGGGTGGTGATTATACAGG - Intergenic
953758677 3:45669504-45669526 GATCTGGGTGGTGGTTACAGGGG - Intronic
953843976 3:46412338-46412360 GACTGTGGTGATGGTTTCATTGG + Intronic
954937300 3:54338235-54338257 GGCTTGGGTGATGGGTGCACAGG + Intronic
955402105 3:58599621-58599643 GATCTGAGTGGTGGTTACACAGG + Intronic
955459423 3:59164401-59164423 GATTTTGGTGATGGTTTAACTGG - Intergenic
955603514 3:60673584-60673606 TACCTAGGTGATGGTTTGATAGG + Intronic
955794191 3:62618410-62618432 GGCCTGAGTGATGGTATCATTGG + Intronic
956729158 3:72180805-72180827 GAGCTGGGTGGTGGTTGCATAGG + Intergenic
956960419 3:74392899-74392921 GATCTGGGTGATACTTGCACAGG - Intronic
958617044 3:96507655-96507677 TACCTAGGTGATGGGTTGACAGG - Intergenic
959097889 3:101975385-101975407 CACCTAGGTGATGGGTTAACAGG + Intergenic
959297718 3:104558262-104558284 TACCTAGGTGATGGTTTGATAGG - Intergenic
961527181 3:127512483-127512505 GACCTGGTTGGTGGCTTCATGGG + Intergenic
961639418 3:128355494-128355516 TATCATGGTGATGGTTTCACAGG + Intronic
961860356 3:129912369-129912391 GATCTGGGTGGTGGTTACACAGG + Intergenic
962450510 3:135512432-135512454 TATTTGGGTGATGGTTTCACAGG + Intergenic
962521568 3:136201861-136201883 GACCTAGGTGATGGGTTGATAGG - Intergenic
962542710 3:136399298-136399320 GATGTGGGTGGTGGTTACACAGG - Intronic
964642421 3:158923876-158923898 TACCTGGGTGATGGGTTGATAGG + Intergenic
964651763 3:159019414-159019436 GATCTGGATGGTGGTTACACAGG - Intronic
965284707 3:166804368-166804390 GACCTGGGTGAAGAATACACAGG + Intergenic
965714232 3:171585681-171585703 GACCTGGGTAATGGTTTTATGGG + Intergenic
966474177 3:180325017-180325039 CTGCTGGGTGATGGCTTCACCGG - Intergenic
966756579 3:183377121-183377143 AACCTGGATGATGGGTTGACAGG - Intronic
966809935 3:183834638-183834660 GAGTGTGGTGATGGTTTCACGGG + Intronic
967536616 3:190611696-190611718 GACCTGACTGATGGTTACAAAGG + Intronic
967707872 3:192673473-192673495 TACCTAGGTGATGGGTTGACAGG - Intronic
968854882 4:3112353-3112375 GACCTGGGTGGCGGTTACAAGGG - Intronic
970759405 4:19466335-19466357 GAACTGGCTCATGGTTCCACAGG + Intergenic
971241715 4:24895260-24895282 GCTCTGGGTGGTGGTTACACAGG + Intronic
971289493 4:25323818-25323840 GACTGTGGTGATGATTTCACGGG - Intronic
972593346 4:40508753-40508775 AATCTGGGTGGTGGTTCCACAGG + Intronic
972844963 4:42976536-42976558 AACCTGGGTGCTGGTTTCGTGGG - Intronic
972984823 4:44750539-44750561 TACCTAGGTGATGGGTTCACAGG - Intergenic
973375457 4:49283372-49283394 TACCTAGGTGATGGGTTGACAGG - Intergenic
973376354 4:49289385-49289407 TACCTAGGTGATGGGTTGACAGG - Intergenic
973377280 4:49295540-49295562 TACCTAGGTGATGGGTTGACAGG - Intergenic
973378200 4:49301676-49301698 TACCTAGGTGATGGGTTGACAGG - Intergenic
973379146 4:49307980-49308002 TACCTAGGTGATGGGTTGACAGG - Intergenic
973379954 4:49313676-49313698 TACCTAGGTGATGGGTTGACAGG + Intergenic
973380865 4:49319831-49319853 TACCTAGGTGATGGGTTGACAGG + Intergenic
973381954 4:49326869-49326891 TACCTAGGTGATGGGTTGACAGG + Intergenic
973385480 4:49511484-49511506 TACCTAGGTGATGGGTTGACAGG + Intergenic
974482436 4:62462976-62462998 TAACTGGCTCATGGTTTCACAGG - Intergenic
974498565 4:62666446-62666468 AACCTAGGTGATGGGTTGACAGG - Intergenic
974805162 4:66869807-66869829 TACCTAGGTGATGGTTTGATAGG + Intergenic
975168438 4:71204998-71205020 GTCATGGGTGATGGTGTGACAGG + Intronic
976900965 4:90175440-90175462 GATTGTGGTGATGGTTTCACAGG + Intronic
977697865 4:99986941-99986963 GATTGTGGTGATGGTTTCACAGG + Intergenic
977790881 4:101101719-101101741 GATCTGGGTAGTGGTTTCATGGG - Intronic
978714837 4:111829181-111829203 GCCCTAGGTGATGGTTGCATGGG - Intergenic
979199846 4:117964395-117964417 TACCTAGGTGATGGGTTGACAGG - Intergenic
979520113 4:121656170-121656192 TACCTAGGTGATGGGTTGACAGG + Intergenic
979732292 4:124039728-124039750 TACCTAGGTGATGGGTTGACAGG - Intergenic
979853682 4:125605606-125605628 TACCTAGGTGATGGGTTTACAGG - Intergenic
980342048 4:131563431-131563453 CACCTAGGTGATGGGTTGACAGG - Intergenic
980370602 4:131864533-131864555 AACCTGGATGATGGTTTGATAGG + Intergenic
980508546 4:133756023-133756045 TACCTGGGTGATGGGCTGACAGG - Intergenic
980734836 4:136871077-136871099 TACCTAGGTGATGGTTTGATAGG - Intergenic
980857449 4:138456334-138456356 TACCTAGGTGATGGGTTGACAGG - Intergenic
981071830 4:140548963-140548985 GATCATGGAGATGGTTTCACAGG - Intronic
981206810 4:142051469-142051491 GACTTGGGTGGTGGTTTCATCGG + Intronic
981391878 4:144200370-144200392 AACCTAGGTGATGGGTTCATGGG + Intergenic
981590812 4:146358455-146358477 GATTTGGGTGATGGTTACCCAGG - Intronic
981807422 4:148732829-148732851 GACCTGGGTGTTGGTTACACAGG - Intergenic
982614330 4:157622032-157622054 GACCTGGGTGGTGGTTACAAAGG - Intergenic
982758837 4:159256159-159256181 TACCTAGGTGATGGGTTGACAGG - Intronic
983074860 4:163313907-163313929 TACCTAGGTGATGGGTTGACAGG - Intergenic
983665100 4:170172562-170172584 GATTGCGGTGATGGTTTCACAGG - Intergenic
983667834 4:170202108-170202130 GACCTGGGTTCTGGGTTCACAGG - Intergenic
983973431 4:173902102-173902124 GATCTTGGTGATGGTTTAAACGG + Intergenic
985092671 4:186380420-186380442 AACCTGGGTGATGGAAACACAGG + Intergenic
985819814 5:2151935-2151957 TACCTAGGTGATGGATTGACAGG + Intergenic
986210811 5:5670237-5670259 TACCTAGGTGATGGGTTGACAGG - Intergenic
987144066 5:14974535-14974557 GACCTGGGTTGTGGTTGCTCAGG + Intergenic
987255854 5:16150080-16150102 GATCTGGGTGGTGGTGACACAGG + Intronic
987471225 5:18331067-18331089 TACCTAGGTGATGGTTTGACAGG - Intergenic
988076095 5:26357527-26357549 TACCTGGGTGATGGGTTGATAGG - Intergenic
988312377 5:29577489-29577511 TACCTGGGTGATGGATTTATTGG - Intergenic
988665851 5:33326635-33326657 TACCTAGGTGATGGGTTGACAGG - Intergenic
988755349 5:34243035-34243057 TACCTAGGTGATGGGTTGACAGG + Intergenic
988936541 5:36089012-36089034 GACTTCGGTGGTGGTTTTACAGG - Intergenic
989129354 5:38090601-38090623 GATCAGGTTGATGGTTACACAGG + Intergenic
989227306 5:39044179-39044201 GATCTGGGTGCTGGTTTCACAGG + Intronic
989305948 5:39956041-39956063 TACCTAGGTGATGGGTTAACAGG + Intergenic
990434773 5:55777651-55777673 TACCTAGGTGATGGGTTGACAGG + Intronic
990603480 5:57384406-57384428 TACCTGGGTGATGGGTTGATAGG + Intergenic
990607945 5:57429112-57429134 TACCTTGGTGATGGGTTGACAGG - Intergenic
990738961 5:58892948-58892970 GACCTAGGTGATGGGTTGATAGG + Intergenic
990925903 5:61022422-61022444 GACCTGAATGATGGTTTAATAGG + Intronic
991172180 5:63641257-63641279 TATTTGGGTGATGGTTGCACTGG - Intergenic
992133090 5:73714741-73714763 GCTCTGGGTGATGGTGACACAGG - Intronic
992449922 5:76867170-76867192 GACTGTGGTGATGGTGTCACTGG - Intronic
992582037 5:78189130-78189152 TACCTGGGTGATGGATTGATAGG + Intronic
993006821 5:82437517-82437539 TACCTGGGTGATGGGTTGATAGG - Intergenic
993384678 5:87250974-87250996 TACCTGGGTGATGGGTTCATAGG - Intergenic
993836252 5:92823601-92823623 TACCTAGGTGATAGTTTAACAGG - Intergenic
994061042 5:95476687-95476709 TAACTGGCTGAAGGTTTCACAGG + Intronic
994388139 5:99157512-99157534 TACCTAGGTGATGGGTTGACAGG - Intergenic
995951843 5:117724118-117724140 GACCTGATTGATGGCTTCACTGG - Intergenic
995982427 5:118120803-118120825 TACCTGGGTGATGGGTTGATAGG - Intergenic
996417936 5:123230052-123230074 CACCTAGGTGATGGGTTGACAGG - Intergenic
997138674 5:131354310-131354332 GACCTGGGTGGTAGCTACACAGG - Intronic
997638815 5:135435205-135435227 GACCTGGGTGAAGGTCTGCCTGG + Intergenic
998042496 5:138960961-138960983 GATCTGGGTGGTGGTTACATGGG + Intronic
998649028 5:144096870-144096892 GATCTGGATGGTGGTTACACAGG - Intergenic
998918920 5:147046114-147046136 CAGCTGGGTGATGGGTTCACAGG - Intronic
999058038 5:148602210-148602232 GAGTGTGGTGATGGTTTCACGGG + Intronic
999072521 5:148761160-148761182 GACCACAGTGTTGGTTTCACAGG + Intergenic
999332896 5:150689329-150689351 GGACTGGGTGAGGGTTTTACAGG + Intergenic
1000422198 5:161051000-161051022 GATCTGGGTAATGGTTACATGGG + Intergenic
1000437109 5:161225668-161225690 TACCTAGGTGATGGGTTGACAGG - Intergenic
1001254987 5:170176604-170176626 GATCTGGGTGCTAATTTCACAGG + Intergenic
1001442453 5:171754543-171754565 GACCTGGGTATTGGTTACCCAGG + Intergenic
1001444035 5:171769366-171769388 GAACTGGGTGATGGTTACAAGGG + Intergenic
1001676343 5:173520158-173520180 GATCATGGTGATAGTTTCACAGG - Intergenic
1001840765 5:174874690-174874712 TACCTAGGTGATGGGTTGACAGG - Intergenic
1001847061 5:174931447-174931469 TACCTAGGTGATGGTTTGACAGG + Intergenic
1002627925 5:180545230-180545252 GATTGTGGTGATGGTTTCACGGG - Intronic
1003362092 6:5436982-5437004 GATTGTGGTGATGGTTTCACTGG - Intronic
1003623144 6:7720098-7720120 TACCTGGGTGGTGGTTATACAGG - Intergenic
1003653077 6:7979368-7979390 GACGTGGGTGATAGTTACACAGG - Intronic
1003667394 6:8124222-8124244 GATCTGGGTGCTGGTTACGCAGG - Intergenic
1004323965 6:14656742-14656764 GTTCTGGGTGATGGTTACTCGGG - Intergenic
1004752403 6:18576285-18576307 TACCTAGGTGATGGGTTGACAGG - Intergenic
1004923223 6:20395942-20395964 GACCTGGGTGGTGGTTACAAAGG + Intergenic
1006305973 6:33218989-33219011 TACCTAGGTGATGGGTTGACAGG - Intergenic
1006669237 6:35719379-35719401 GATCTAGGTGATGGTTACATGGG + Intronic
1006745600 6:36339811-36339833 CATCTGGGTGGTGGTTACACAGG - Intergenic
1006791443 6:36703850-36703872 GACCTGGAGGGTGGTTACACAGG - Intronic
1007212752 6:40208864-40208886 AAGCTGGGTGATGGGTTCATGGG - Intergenic
1007422178 6:41726419-41726441 CACCTGGGTGATGGTTGCCTAGG + Intronic
1008434586 6:51460569-51460591 GAGCTGGGTTATGGATTCAAGGG - Intergenic
1008592525 6:53008747-53008769 AAGCTGGGTGATGGCTACACAGG + Intronic
1008980682 6:57480348-57480370 GAACTGGGTGAAGGATACACTGG - Intronic
1009168784 6:60373299-60373321 GAACTGGGTGAGGGATACACTGG - Intergenic
1010046339 6:71448440-71448462 GATCTGAGTGTTGGTTACACAGG + Intergenic
1010207779 6:73338221-73338243 GATCGTGGTGATGGTTTCATGGG + Intergenic
1010674582 6:78726943-78726965 GAACTTGGTGATGGTTACATGGG - Intergenic
1011080523 6:83485815-83485837 TACCTAGGTGATGGGTTGACAGG + Intergenic
1011638530 6:89398257-89398279 GACTGTGCTGATGGTTTCACAGG + Intronic
1012181289 6:96156225-96156247 GACCATGGTGATAGTTGCACTGG - Intronic
1013215524 6:108023875-108023897 TACCTGGGTGATGGGTTGACCGG + Intergenic
1013313531 6:108919970-108919992 GAGCTGGATGATGGGTACACAGG - Intronic
1013386032 6:109632091-109632113 GACCTGGTTGGTGGTTACATGGG + Intronic
1013669785 6:112387677-112387699 TACCTAGGTGATGGGTTGACAGG + Intergenic
1013794600 6:113872993-113873015 GATTTTGGCGATGGTTTCACAGG - Intergenic
1013809037 6:114023921-114023943 GATTATGGTGATGGTTTCACAGG - Intergenic
1015073302 6:129123963-129123985 GACGGTGGTGATGGTTTCGCTGG + Intronic
1015262982 6:131259884-131259906 TACCTGGGTGATGGGTTGATGGG - Intronic
1015940666 6:138448475-138448497 GAACTGGGTGCTGGTTGTACAGG - Intronic
1015944951 6:138490068-138490090 GACCTAGGTAATGGTTATACAGG + Intronic
1015948192 6:138524314-138524336 GATCTGGGTGCTGGTTACATGGG - Intronic
1016134253 6:140519654-140519676 GACCATGGTGATGGTTTCATGGG + Intergenic
1016306571 6:142690687-142690709 GATTTTAGTGATGGTTTCACAGG + Intergenic
1016844659 6:148558753-148558775 GATCTGCCTGATGTTTTCACAGG - Intergenic
1016982656 6:149866962-149866984 GATTGTGGTGATGGTTTCACTGG + Intergenic
1017956292 6:159180562-159180584 TACCTAGGTGATGGGTTGACAGG - Intronic
1018444773 6:163845605-163845627 TTGATGGGTGATGGTTTCACAGG - Intergenic
1018504955 6:164456135-164456157 GCCATGGGTGATGGTGTCAGAGG - Intergenic
1020182795 7:5935309-5935331 GACTGAGGCGATGGTTTCACAGG - Intronic
1020300117 7:6789448-6789470 GACTGAGGCGATGGTTTCACAGG + Intronic
1020706423 7:11549825-11549847 TACCTAGGTGATGGGTTGACAGG + Intronic
1021154587 7:17194449-17194471 GATCTGGGTGCTGGTTACATAGG + Intergenic
1021279290 7:18697393-18697415 GCTCTGGGTGATGGTTTTATGGG - Intronic
1021332494 7:19356129-19356151 GATTATGGTGATGGTTTCACGGG - Intergenic
1021733426 7:23619233-23619255 TACCTAGGTGATGGGTTGACAGG + Intronic
1021823927 7:24528284-24528306 GATTATGGTGATGGTTTCACAGG + Intergenic
1022948316 7:35310410-35310432 GACCTGGGAGATGGTTACACTGG + Intergenic
1023653566 7:42396295-42396317 TACCTGGGTGATGGGATCACTGG - Intergenic
1024652173 7:51413511-51413533 GGCCTGGGAGATGGGATCACTGG + Intergenic
1024860113 7:53828995-53829017 TACCTAGGTGATGGGTTGACAGG + Intergenic
1025037350 7:55604127-55604149 GGCCTGGGAGATGGGATCACTGG + Intergenic
1025603188 7:63018366-63018388 GATCATGGTGATGGTTCCACGGG + Intergenic
1026438448 7:70420835-70420857 GATCGTGGTGATGGCTTCACAGG + Intronic
1026512184 7:71036758-71036780 GACCTCGGTGGTGGTCACACAGG - Intergenic
1026539458 7:71267780-71267802 TACCTAGGTGATGGGTTCACAGG - Intronic
1026560980 7:71448972-71448994 GACTTGGGTGATGGTTTAAACGG + Intronic
1027341321 7:77211112-77211134 GACCTGGGTGGTGGTTACTTGGG - Intronic
1027734602 7:81916843-81916865 AACCTGGGTGATGGGTTGATAGG - Intergenic
1028067635 7:86407089-86407111 GAGCTGTGTGATGGGTACACAGG + Intergenic
1028537076 7:91901576-91901598 AAATTGGGTGGTGGTTTCACTGG + Intergenic
1028887085 7:95946208-95946230 TACCTAGGTGATGGTTTGATAGG + Intronic
1028927596 7:96376182-96376204 AAGCTGGGTGATGGATGCACAGG + Intergenic
1029138900 7:98395541-98395563 GATCTGGGTGGTGGTTACACAGG + Intronic
1029918180 7:104233752-104233774 GATGGTGGTGATGGTTTCACAGG - Intergenic
1030691590 7:112540769-112540791 TACCTGGGTGATGGGTTGACAGG - Intergenic
1030707921 7:112714358-112714380 GCCTTTGGTGCTGGTTTCACAGG - Intergenic
1030832925 7:114249297-114249319 TATCTGGGTGATGGGTTGACAGG - Intronic
1031212759 7:118851534-118851556 GATTATGGTGATGGTTTCACAGG + Intergenic
1031775094 7:125898989-125899011 GACTGTGGTGATGGTTTCACAGG - Intergenic
1032112097 7:129084866-129084888 GACTGTGGTCATGGTTTCACGGG - Intergenic
1033435524 7:141330204-141330226 TACCTAGGTGATGGGTTGACAGG - Intronic
1033792122 7:144803054-144803076 TACCTAGGTGATGGGTTGACAGG + Intronic
1033868026 7:145716308-145716330 TACCTAGGTGATGGGTTGACAGG - Intergenic
1034049147 7:147963825-147963847 GATCTGGGTGATAATTTCATGGG - Intronic
1035748378 8:1978086-1978108 TACCTAGGTGATGGGTTGACAGG - Intronic
1035781602 8:2232441-2232463 TACCTAGGTGATGGATTGACAGG + Intergenic
1035857166 8:2987975-2987997 TACCTAGGTGATGGGTTCACAGG - Intronic
1035878107 8:3213393-3213415 CACCTAGGTGGTGGTTTCATGGG - Intronic
1035900858 8:3457102-3457124 GGCCTGGGTGAGGGATTCAGAGG - Intronic
1035904614 8:3495992-3496014 TACCTAGGTGATGGGTTGACAGG - Intronic
1036009223 8:4702167-4702189 TACCTAGGTGATGGGTTGACAGG + Intronic
1036782045 8:11656492-11656514 GATTGTGGTGATGGTTTCACGGG - Intergenic
1037308822 8:17533845-17533867 TACCTAGGTGATGGGTTGACAGG - Intronic
1037530750 8:19770432-19770454 GATTGTGGTGATGGTTTCACGGG + Intergenic
1037596167 8:20356133-20356155 GATTGTGGTGATGGTTTCACAGG - Intergenic
1038093014 8:24275397-24275419 AACCTAGATGATGGTTTGACAGG + Intergenic
1038457741 8:27688866-27688888 GACCTGGGTGAAGGTTACACAGG + Intergenic
1038555822 8:28514460-28514482 GACTGTGGTGATGGTTTCACAGG - Intronic
1038574867 8:28696298-28696320 GAGCTGGGTGCTGGGTTCACAGG - Intronic
1040711225 8:50191656-50191678 AACCTAGGTGATGGGTTGACAGG - Intronic
1040776577 8:51050657-51050679 TACCTAGGTGATGGGTTGACAGG + Intergenic
1041193397 8:55375815-55375837 TACCTAGGTGATGGGTTGACAGG - Intronic
1041399961 8:57432204-57432226 AACCTAGGTGATGGGTTGACAGG - Intergenic
1041664354 8:60428158-60428180 TACCTAGGTGATGGGTTGACAGG + Intergenic
1042268084 8:66928797-66928819 GAATGTGGTGATGGTTTCACAGG - Intergenic
1042527357 8:69777477-69777499 GACTGTGGTGATGGCTTCACTGG + Intronic
1042769311 8:72362153-72362175 GACAGTAGTGATGGTTTCACAGG - Intergenic
1043792678 8:84492999-84493021 AACCTAGGTGATGGGTTGACAGG - Intronic
1043840045 8:85092197-85092219 TACCTGGGTGATGGGTTGATAGG + Intergenic
1043859587 8:85300350-85300372 TACCTAGGTGATGGGTTGACAGG + Intergenic
1044534204 8:93340844-93340866 TACCTAGGTGATGGGTTGACAGG + Intergenic
1044609793 8:94080236-94080258 GACCTGGGGGCTGGTTTCTGCGG + Intergenic
1046077490 8:109330947-109330969 TACCTAGGTGATGGGTTGACGGG + Intronic
1046309792 8:112420200-112420222 AAGTTGGGTGATGGTTTCATGGG - Intronic
1046544537 8:115632891-115632913 GACATGAGTGATAGTTACACAGG + Intronic
1047052728 8:121130992-121131014 GACCTGTGATATGGTTTAACGGG - Intergenic
1047375860 8:124295314-124295336 GAATATGGTGATGGTTTCACAGG + Intergenic
1048413879 8:134204826-134204848 TACCTAGGTGATGGATTGACAGG - Intergenic
1049900799 9:161992-162014 GACCTAGGTGATGGGTTAATAGG - Intronic
1050247996 9:3712244-3712266 TACCTAGGTGATGGGTTGACAGG + Intergenic
1050414971 9:5406666-5406688 TACCTAGGTGATGGGTTGACAGG + Intronic
1050642866 9:7686947-7686969 GGGCTGAGAGATGGTTTCACTGG + Intergenic
1050942478 9:11477075-11477097 GACCTAGATGATGGTTTGATAGG + Intergenic
1051221242 9:14850624-14850646 TACCTGGGTGATGGGTTGATAGG + Intronic
1051296650 9:15603337-15603359 TACCTAGGTGATGGGTTGACAGG - Intronic
1051703496 9:19851424-19851446 TACCTAGGTGATGGGTTGACAGG - Intergenic
1051792935 9:20828718-20828740 CACCTAGGTGATGGTTTGATAGG - Intronic
1052082415 9:24223513-24223535 CACCTGTGTGGTGGTTACACAGG + Intergenic
1052511131 9:29422228-29422250 TACCTAGGTGATGGATTGACAGG - Intergenic
1052664605 9:31478462-31478484 TACCTGGGTGATGGGATCAATGG + Intergenic
1053111630 9:35465595-35465617 AAGCTGGGTGATGGGTACACGGG + Intergenic
1053336034 9:37272430-37272452 GACCCGGGTGATGGTTACATAGG - Intronic
1053509406 9:38674848-38674870 GACCTAGGTGATGGTTACACAGG + Intergenic
1053743830 9:41172272-41172294 GACCTAGGTGATGGGTTAATAGG - Intronic
1054349108 9:64002087-64002109 GACCTAGGTGATGGGTTAATAGG - Intergenic
1054483442 9:65693026-65693048 GACCTAGGTGATGGGTTAATAGG + Intronic
1054684513 9:68258987-68259009 GACCTAGGTGATGGGTTAATAGG + Intronic
1054747309 9:68867625-68867647 GATTGTGGTGATGGTTTCACAGG + Intronic
1054833435 9:69651325-69651347 GATCTGGGTGGTGGTTACACAGG + Intronic
1055003872 9:71483841-71483863 CTCCTGGCTGATGGATTCACAGG - Intergenic
1055028046 9:71743330-71743352 GACCTGGGTGGTGGCTACACAGG + Intronic
1056265526 9:84893100-84893122 GACAGGGGTTATGGTTACACAGG - Intronic
1056849318 9:90068887-90068909 GATTGTGGTGATGGTTTCACAGG - Intergenic
1057838523 9:98466398-98466420 GACCTGGGTGGTAGTTACATGGG + Intronic
1057936682 9:99245762-99245784 GGCCTGAGTGGTGGTTACACAGG - Intergenic
1058725264 9:107797269-107797291 GACTGTGGTGATGGTTTCATGGG - Intergenic
1059111550 9:111562681-111562703 TACCTAGGTGATGGGTTGACAGG - Intronic
1059193358 9:112347859-112347881 TAGCTGGTTGTTGGTTTCACAGG + Intergenic
1059257530 9:112945038-112945060 GACCGTGGTGATGGTTTCAGGGG + Intergenic
1059845075 9:118266382-118266404 TACCTAGCTGATGGTTTAACAGG - Intergenic
1060264135 9:122100569-122100591 GATCTGGGTGTTGGTTTCTTCGG - Intergenic
1060464669 9:123892618-123892640 TACCTAGGTGATGGATTGACAGG + Intronic
1060617096 9:125027200-125027222 GTCCTGGGAGAGGATTTCACTGG - Intronic
1061187889 9:129065678-129065700 AACCTGGGTGCTGGTTATACAGG - Intronic
1061614206 9:131768789-131768811 GACCCTAGTGATGGTTTGACGGG + Intergenic
1061965200 9:134009873-134009895 CAGTTGGGTGATGGTTGCACAGG - Intergenic
1062333618 9:136055396-136055418 GGCCTGGGGGATGCTTTCAGGGG - Intronic
1062361663 9:136191154-136191176 GACCGTGGCGATGGTTGCACAGG - Intergenic
1203700125 Un_GL000214v1:127918-127940 TACCTAGGTGATGGGTTGACAGG - Intergenic
1203701039 Un_GL000214v1:133902-133924 TACCTAGGTGATGGGTTGACAGG - Intergenic
1203550053 Un_KI270743v1:159562-159584 TACCTAGGTGATGGGTTGACAGG + Intergenic
1203567826 Un_KI270744v1:106621-106643 TACCTAGGTGATGGGTTGACAGG - Intergenic
1203568887 Un_KI270744v1:113608-113630 TACCTAGGTGATGGGTTGACAGG - Intergenic
1203569470 Un_KI270744v1:117856-117878 TACCTAGGTGATGGGTTGACAGG - Intergenic
1203570420 Un_KI270744v1:124137-124159 TACCTAGGTGATGGGTTGACAGG - Intergenic
1185749614 X:2600255-2600277 AACCTAGATGATGGGTTCACAGG + Intergenic
1186138242 X:6543062-6543084 TACCTGGTTGATGGGTTGACAGG - Intergenic
1186158064 X:6746497-6746519 TACCTAGGTGATGGGTTGACAGG - Intergenic
1186385771 X:9109035-9109057 GATTGTGGTGATGGTTTCACAGG - Intronic
1186521470 X:10210382-10210404 GTCCTGGGTGCTGGTTACACAGG - Intronic
1186685142 X:11917798-11917820 TACTTGGGTGATGGGTTCAGTGG + Intergenic
1187108441 X:16269781-16269803 TACCTGGGTGATGGGTTGATAGG - Intergenic
1187491145 X:19752627-19752649 GGTCTGGGTGGTGGTTACACAGG + Intronic
1188054003 X:25520817-25520839 TACCTAGGTGATGGGTTCAAAGG + Intergenic
1188224434 X:27579463-27579485 TACCTGGGTGATGGGTTGATAGG + Intergenic
1188461118 X:30428445-30428467 TGCCTGGGTGATGGAATCACTGG + Intergenic
1188702357 X:33280620-33280642 GATTGTGGTGATGGTTTCACAGG + Intronic
1188799913 X:34516303-34516325 TACCTGGGTGATGGGTTGATAGG + Intergenic
1188965797 X:36549379-36549401 GATGTGGGTGCTGGCTTCACAGG - Intergenic
1189235341 X:39482659-39482681 GATCTGGGTGGTGGTTACATGGG + Intergenic
1189275694 X:39784202-39784224 GTCCTGAGTGCTGGTTACACAGG + Intergenic
1189482386 X:41402494-41402516 TACCTAGGTGATGGGTTGACAGG - Intergenic
1189899053 X:45687107-45687129 GACCTGGGTGATGGTTACTAGGG - Intergenic
1189932529 X:46029405-46029427 GACCATGGTGATGGTATCACAGG - Intergenic
1189950722 X:46227845-46227867 GAATGTGGTGATGGTTTCACAGG + Intergenic
1191183914 X:57590564-57590586 GACCTTGGTCCTGGTTACACAGG + Intergenic
1191277744 X:58621641-58621663 GACCTCTTTGAAGGTTTCACTGG + Intergenic
1191281106 X:58666733-58666755 GACCTCTTTGATGATTTCACTGG + Intergenic
1191287827 X:58756799-58756821 GACCTCTTTGAAGGTTTCACTGG + Intergenic
1191289512 X:58779423-58779445 GACCTCTTTGATGATTTCACTGG + Intergenic
1191296186 X:58868317-58868339 GACCTCTTTGATGATTTCACTGG + Intergenic
1191302493 X:58952313-58952335 GACCTCTTTGAAGGTTTCACTGG + Intergenic
1191318615 X:59167229-59167251 GACCTCTTTGATGATTTCACTGG + Intergenic
1191318925 X:59171344-59171366 GACCTCTTTGATGATTTCACTGG + Intergenic
1191319994 X:59185742-59185764 GACCTCTTTGATGATTTCACTGG + Intergenic
1191329352 X:59311206-59311228 GACCTGTTTGAAGATTTCACTGG + Intergenic
1191334217 X:59376527-59376549 GACCTCTTTGAAGGTTTCACTGG + Intergenic
1191337455 X:59419725-59419747 GACCTCTTTGATGATTTCACTGG + Intergenic
1191342452 X:59486001-59486023 GACCTCTTTGATGATTTCACTGG + Intergenic
1191345812 X:59531203-59531225 GACCTGTTTGAAGATTTCACTGG + Intergenic
1191348896 X:59572340-59572362 GACCTCTTTGAAGGTTTCACTGG + Intergenic
1191360356 X:59725415-59725437 GACCTCTTTGAAGGTTTCACTGG + Intergenic
1191395556 X:60195979-60196001 GACCTGTTTGAAGATTTCACTGG + Intergenic
1191418787 X:60507223-60507245 GACCTCTTTGATGATTTCACTGG + Intergenic
1191421851 X:60548204-60548226 GACCTCTTTGATGATTTCACTGG + Intergenic
1191423700 X:60573123-60573145 GACCTCTTTGATGATTTCACTGG + Intergenic
1191425548 X:60597805-60597827 GACCTCTTTGAAGGTTTCACTGG + Intergenic
1191426926 X:60616320-60616342 GACCTCTTTGAAGGTTTCACTGG + Intergenic
1191431500 X:60678023-60678045 GACCTCTTTGAAGGTTTCACTGG + Intergenic
1191439135 X:60780017-60780039 GACCTCGTTGAAGATTTCACTGG + Intergenic
1191445833 X:60869676-60869698 GACCTCTTTGATGATTTCACTGG + Intergenic
1191446612 X:60879965-60879987 GACCTCTTTGATGATTTCACTGG + Intergenic
1191452506 X:60958829-60958851 GACCTGTTTGAAGATTTCACTGG + Intergenic
1191454050 X:60979401-60979423 GACCTCTTTGATGATTTCACTGG + Intergenic
1191460322 X:61063577-61063599 GACCTCTTTGATGATTTCACTGG + Intergenic
1191460940 X:61071807-61071829 GACCTCTTTGATGATTTCACTGG + Intergenic
1191468226 X:61169342-61169364 GACCTCGTTGAAGATTTCACTGG + Intergenic
1191478315 X:61304589-61304611 GACCTCGTTGAAGATTTCACTGG + Intergenic
1191481397 X:61345567-61345589 GACCTCTTTGATGATTTCACTGG + Intergenic
1191500740 X:61604445-61604467 GACCTCTTTGATGATTTCACTGG + Intergenic
1191512837 X:61766409-61766431 GACCTCTTTGATGATTTCACTGG + Intergenic
1191529039 X:61983116-61983138 GACCTCTTTGATGATTTCACTGG + Intergenic
1191534035 X:62049642-62049664 GACCTCGTTGAAGATTTCACTGG + Intergenic
1191561155 X:62462553-62462575 GACCTCGTTGAAGATTTCACTGG - Intergenic
1191561462 X:62466667-62466689 GACCTCGTTGAAGATTTCACTGG - Intergenic
1191849263 X:65573626-65573648 AAGCTGGGTGATGGGTTCATGGG + Intergenic
1192221757 X:69202141-69202163 GACCTAGGTGGTGGTTACAGAGG - Intergenic
1192720477 X:73691673-73691695 TACCTAGGTGATGGGTTGACAGG - Intergenic
1192856132 X:75014301-75014323 TACCGAGGTGATGGGTTCACAGG - Intergenic
1193364633 X:80617260-80617282 TACCTAGGTGATGGGTTGACAGG - Intergenic
1193850121 X:86527278-86527300 GACTGTGGTGATGGTTTCATAGG - Intronic
1193997724 X:88387028-88387050 GAACTGTGTAATGGTATCACTGG - Intergenic
1194194430 X:90874051-90874073 TACCTAGGTGATGGGTTGACAGG + Intergenic
1194450462 X:94039643-94039665 AATCTGGGTAATGGTTTCATGGG - Intergenic
1194456227 X:94106975-94106997 GACCTAGATGATGGATTCATAGG + Intergenic
1194500135 X:94672433-94672455 TACCTAGGTGATGGGTTGACAGG + Intergenic
1194859652 X:98980842-98980864 GATTTGGGTGATGGTTTCATGGG - Intergenic
1195034649 X:100961356-100961378 GACCTGGGTGGTGGTTACAAGGG + Intergenic
1195511424 X:105720286-105720308 ATTGTGGGTGATGGTTTCACAGG - Intronic
1195550545 X:106164574-106164596 AACCTAGGTGATAGTTTGACAGG + Intergenic
1195590099 X:106614905-106614927 GAGGGGGGTGATGGTTACACAGG - Intronic
1195784382 X:108502717-108502739 GACCTGGGTGTTAGTTACAAAGG - Intronic
1195789324 X:108565332-108565354 AAGCTGGGTGATGGGTTCATGGG - Intronic
1196115246 X:111992268-111992290 GATTGTGGTGATGGTTTCACAGG + Intronic
1196567294 X:117223849-117223871 GATGGTGGTGATGGTTTCACTGG - Intergenic
1196600690 X:117598514-117598536 TACCTAGGTGATGGGTTGACAGG + Intergenic
1196741107 X:119026809-119026831 TTCCTAGGTGATGGTTTGACAGG + Intergenic
1197548169 X:127853940-127853962 TACCTAGGTGATGGGTTGACAGG - Intergenic
1198236570 X:134741039-134741061 GATCTGGGTATTGGTTACACGGG + Intronic
1198238662 X:134762040-134762062 GACCTGGGTGATGGTTACTTGGG - Intronic
1198238693 X:134762257-134762279 GACCTGGGCGATGGTTACTTGGG - Intronic
1198238707 X:134762368-134762390 GACCTGGGTGATGGTTACATGGG - Intronic
1198799718 X:140436375-140436397 GCCCTGGGTGCTGGTTTCATAGG + Intergenic
1198814217 X:140570166-140570188 GCCCTGGGTGTTGGTTACACAGG + Intergenic
1199419052 X:147621827-147621849 GACCGTGGTGATGGTTTCAGGGG + Intergenic
1199784596 X:151093120-151093142 GATAATGGTGATGGTTTCACAGG - Intergenic
1199880622 X:151971942-151971964 GATCTAGGTGTTGGTTACACGGG + Intronic
1199982749 X:152929738-152929760 TACCTGGGTGATGTTTCCAAAGG + Intronic
1199998307 X:153041203-153041225 GACTGTGGTGATGGGTTCACAGG - Intergenic
1200388808 X:155921329-155921351 GATCTGGGTGGTGGTTACATGGG - Intronic
1200541046 Y:4456443-4456465 TACCTAGGTGATGGGTTGACAGG + Intergenic
1200900938 Y:8431230-8431252 CACCTGGATGCTGGTTTCAGTGG + Intergenic
1201257014 Y:12117962-12117984 TACCTAGGTGATGGGTTGACAGG - Intergenic
1201367328 Y:13222177-13222199 TACCTAGGTGATGGGTTGACAGG + Intergenic