ID: 922319427

View in Genome Browser
Species Human (GRCh38)
Location 1:224472630-224472652
Sequence CTGGGGAAAAGGATTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 575
Summary {0: 1, 1: 0, 2: 4, 3: 47, 4: 523}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922319427 Original CRISPR CTGGGGAAAAGGATTGAGGA TGG Intronic
900597842 1:3490590-3490612 CTGGGGAAAAGGAGAAAAGAGGG + Intronic
901126201 1:6930572-6930594 CTGGGGAACAGCAGTGATGAGGG - Intronic
901238700 1:7680726-7680748 CGGGGGAAAATGTTTGAGGGCGG + Intronic
901281638 1:8040914-8040936 CTAGGAAAATGGAGTGAGGAAGG - Intergenic
901853773 1:12031487-12031509 CTGGGGGGTAGGATTGAGGTGGG + Intronic
902543593 1:17172108-17172130 TTGGGGACAAGGGTTGAGAAAGG + Intergenic
902678209 1:18023755-18023777 TTGGGGAAAAGGTGGGAGGAAGG + Intergenic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
902800816 1:18828911-18828933 CTGGGAGAAAGGACTGAGAATGG + Intergenic
903172020 1:21560289-21560311 CTGGGTAGAAGGAATGAGCATGG + Intronic
903804292 1:25993362-25993384 AAGGGGAAAACGATTGTGGAGGG - Intronic
904105548 1:28079064-28079086 CTGGGGAAAAAAAATGAGAATGG - Intronic
904254183 1:29244092-29244114 CTGGGGAGAAAGATTGAGATGGG + Intronic
905238379 1:36566014-36566036 CTGGGGAATGGGATGGATGATGG - Intergenic
905242675 1:36590971-36590993 CTGGGGAAGGGGATGGAGGAAGG + Intergenic
905347339 1:37319866-37319888 CTGGGGATTGGGAATGAGGAAGG + Intergenic
905764806 1:40591487-40591509 CAGGGGTACAGGGTTGAGGAAGG - Intergenic
906378948 1:45319343-45319365 GTGGGGGAAAGGATTTAGGATGG - Intergenic
906562652 1:46770507-46770529 CAGGGGAAAAGGGTGGAGGGTGG - Intronic
906953058 1:50349944-50349966 CAAGGGAAAAGGGTTGAGGGAGG - Intergenic
907150464 1:52281427-52281449 CTTGGAAAAATGATTGAGGACGG - Intronic
907464070 1:54623578-54623600 GTGGGGAAGAGGATTGGGGCGGG - Intronic
908382122 1:63606544-63606566 CAGGGGAGAAAGATGGAGGAAGG + Intronic
908558183 1:65278964-65278986 ATGGGGAAGGGGATGGAGGAGGG - Intronic
908578753 1:65490849-65490871 CTGGGGAAACGCAATCAGGAAGG - Intronic
909093953 1:71263734-71263756 CTTGGGAAATGGATTTTGGAAGG + Intergenic
909172517 1:72314809-72314831 CTGGGGAAGAGGTATGTGGATGG - Intergenic
910060216 1:83082138-83082160 CTTGTCAAAAGCATTGAGGATGG + Intergenic
910408973 1:86920199-86920221 ATGGGGAAAATAATTGAGAATGG + Intronic
910530102 1:88226059-88226081 TTGGGGAAAAGGATTGAAGGAGG + Intergenic
910868093 1:91806137-91806159 TTAGTGAAAAGGATGGAGGAGGG - Intronic
912212338 1:107569516-107569538 CTGGGGAAGAGGTATGTGGATGG + Intergenic
912811746 1:112800346-112800368 CTGGGGAGAAGCAGTGAAGATGG - Intergenic
914965417 1:152253248-152253270 CTGGGGAAGAGGTATGTGGATGG - Intergenic
915038745 1:152949912-152949934 TAGAGGAAAAGGATTGAGGGAGG + Intergenic
915479942 1:156177623-156177645 CTAGGGTAAAGGAGTGAAGAAGG - Exonic
915583492 1:156830433-156830455 CTGGGCACAAGGGTGGAGGAGGG - Intronic
915616470 1:157043356-157043378 ATGGGGAGAAGCGTTGAGGAGGG + Intronic
915883935 1:159702957-159702979 CAGGGGAAAATGTTTTAGGAAGG - Intergenic
917764620 1:178202667-178202689 CTGGGGAAGAGGTATGTGGATGG + Intronic
918774581 1:188611406-188611428 CTAGGGAAAAGGTTTGTGGGTGG + Intergenic
919068891 1:192728723-192728745 CAGGGGAAATGATTTGAGGAGGG - Intergenic
919913111 1:202123913-202123935 CAGGGGAGAAGGGCTGAGGAAGG - Intronic
920170599 1:204070087-204070109 CTGGAGACCAGGATGGAGGAGGG + Intergenic
920380256 1:205530877-205530899 CTGGGGTGGAGGGTTGAGGAGGG - Intronic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
920973800 1:210766498-210766520 CTGGGCAACAAGATTGAGGGGGG + Intronic
921720889 1:218469824-218469846 CTGGGGAAAAGATTTGTCGATGG + Intergenic
922085513 1:222343253-222343275 CTGGGGAAAGGGAGTCAGGAAGG + Intergenic
922319427 1:224472630-224472652 CTGGGGAAAAGGATTGAGGATGG + Intronic
922468317 1:225860019-225860041 CTGGGGTACAGGAAGGAGGAAGG + Intronic
922912916 1:229232524-229232546 CTAGGCAACAGGATGGAGGATGG + Intergenic
922946790 1:229523247-229523269 CTGGAGGAAAGGAGGGAGGATGG - Intronic
923163151 1:231335659-231335681 GTGGAGAAAAGGTTTGAAGAAGG - Exonic
924451512 1:244182921-244182943 CTGAGAAATAGGAGTGAGGATGG + Intergenic
1063191289 10:3697222-3697244 CTGGGGAGGAGGAATGAGGATGG - Intergenic
1063545054 10:6972804-6972826 CTGTGTAAAAGGATAGAGAAAGG - Intergenic
1063877859 10:10498639-10498661 ATGGGGAAGAGGCTAGAGGAAGG - Intergenic
1064642133 10:17425932-17425954 CTGTGGAAAAAGAGTGGGGATGG - Intronic
1066247547 10:33598048-33598070 CAGGGGAAAAAAATTGAGGCAGG - Intergenic
1067218682 10:44325417-44325439 CTGGAGAAGAGGAGTGAGGTAGG - Intergenic
1067922378 10:50472911-50472933 GTGGGGAGCAGGATAGAGGAAGG - Intronic
1067942735 10:50669906-50669928 CTGGTGCTAAGGAGTGAGGAGGG - Intergenic
1068007581 10:51408924-51408946 CTGGGGAAGAGGTGTGTGGATGG - Intronic
1070494825 10:77011915-77011937 TTGGGGAATAGGAATGAGAAAGG + Intronic
1070653158 10:78252465-78252487 GCCGGGAAAGGGATTGAGGAGGG - Intergenic
1070735443 10:78860832-78860854 CTGGGGAAAAGGGCAAAGGAAGG - Intergenic
1070863977 10:79694869-79694891 CTGGTGCTAAGGAGTGAGGAGGG - Intergenic
1070921968 10:80193359-80193381 CTGGAGAAAGGGAAAGAGGAAGG + Intronic
1071546127 10:86531098-86531120 CTGGGGAAGGGGGTTGGGGAGGG + Intergenic
1071630876 10:87217095-87217117 CTGGTGCTAAGGAGTGAGGAGGG - Intergenic
1071895045 10:90057109-90057131 CAGGGGAAAAGGTGGGAGGAAGG + Intergenic
1071932021 10:90483268-90483290 CTTGGGAAAAGGGTAGAAGAAGG - Intergenic
1073318152 10:102597323-102597345 CTGGGGAAAAGGAAGGAGGAAGG - Intronic
1073528356 10:104207258-104207280 CTGGAGAAAAGGGTTGGGGTGGG + Intronic
1073577342 10:104638114-104638136 TTGGGGAAAATGATGGAGGCTGG + Intergenic
1073604503 10:104880343-104880365 CTGGGGGAAAGGATTGTTCAAGG - Intronic
1073635003 10:105188853-105188875 CTGGGTGAAAGGATTGAGTCGGG + Intronic
1073768162 10:106706470-106706492 CTTGGGAAAGGGATGGAGGCTGG + Intronic
1074185472 10:111096834-111096856 CTGGGGCATATGGTTGAGGAGGG - Intergenic
1074245877 10:111692143-111692165 CAGGGGAATAGAATTGAAGATGG + Intergenic
1078005526 11:7529685-7529707 CTGGGGAAATGGATTTTGGGAGG - Intronic
1078516763 11:12029114-12029136 TTGGGGAAAAGGAGTCAGGCTGG + Intergenic
1078724211 11:13914304-13914326 TTGGGGAAAAGGGTTGGGGGTGG - Intergenic
1079321781 11:19457469-19457491 CTGGGAAGAGGGATGGAGGAGGG + Intronic
1079395337 11:20057432-20057454 CTGGGACCAAGGATTAAGGAGGG + Intronic
1079977511 11:27110234-27110256 CTGGGAAAAAGGTAGGAGGAGGG - Intronic
1080778662 11:35410036-35410058 CTGGAGAACAGGATTGGGGCCGG + Intronic
1082002918 11:47403581-47403603 CTGGAAAGAAGGATTGAGAAAGG + Intergenic
1083357888 11:62080821-62080843 CTGGGGAGCAGGATAGAAGAGGG + Intergenic
1083929311 11:65831532-65831554 TTTGAGAAAAGGATGGAGGATGG - Intronic
1084215032 11:67642489-67642511 CTGGGGAAGTGGATGGAGGAAGG - Intergenic
1084361235 11:68669809-68669831 CTGGGGAAAAGGGGTCAGGGTGG - Intergenic
1084604098 11:70162450-70162472 GTGGGGACAAGGAGAGAGGAGGG + Intronic
1084753594 11:71220764-71220786 CTGGGGAAGAGGAATGGGGAGGG + Intronic
1085178163 11:74508729-74508751 GTGGAGAACAGGCTTGAGGAAGG + Intronic
1085318644 11:75561445-75561467 GGGGTGACAAGGATTGAGGAAGG + Intergenic
1085381399 11:76122422-76122444 ATAGGGAAAGGGATTGAGGCAGG - Intronic
1086399809 11:86451279-86451301 CTGGGGAAAAGGTAGGTGGATGG + Intronic
1087152704 11:94872823-94872845 ATGGGGGAAAGGGTTGAGGATGG + Exonic
1087423237 11:97959230-97959252 AAGGAGAAAAGGATGGAGGAAGG + Intergenic
1089432524 11:118436176-118436198 CTCGGGAAAAGGAGGGGGGAAGG - Intergenic
1090417854 11:126552965-126552987 CTGGGGAAGAGGATGTGGGAAGG - Intronic
1091051830 11:132379388-132379410 TTGGGGAAAAGGTATGTGGAAGG + Intergenic
1091556997 12:1581342-1581364 CTGGGGAGAGGGTTTGGGGAAGG + Intronic
1092232370 12:6783268-6783290 CTGGGGGCAGGGTTTGAGGATGG - Intergenic
1092406177 12:8223581-8223603 CTGGGGAAAACCAGGGAGGACGG - Intronic
1092938541 12:13386314-13386336 CTGGGGAGAAGGAACAAGGAAGG - Intronic
1093036431 12:14336312-14336334 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1093121113 12:15272864-15272886 CTGGGGACATGGAGTGGGGAAGG - Intronic
1094545203 12:31398321-31398343 CTGGGGAAAGGCATTGATGATGG - Exonic
1095140108 12:38651429-38651451 TTGCGGAAAAGGAATGAGGCAGG + Intronic
1095485607 12:42681257-42681279 CTGAGGAACAGGACTGGGGAAGG - Intergenic
1095844299 12:46729342-46729364 CTGGGGAAGAGGTATGTGGATGG - Intergenic
1096572604 12:52532473-52532495 CTGGGGCCAAGGCTTGAGGAGGG - Intergenic
1096844797 12:54400558-54400580 CAGAGGAAAAGGTTTGAAGAAGG + Intronic
1096978022 12:55710854-55710876 CAGGGGACAAGGATGGAGGGGGG + Intronic
1096982453 12:55736245-55736267 ATGGGGAAAGGAATTGAGGCGGG - Intergenic
1097326710 12:58285394-58285416 CTGGGAATAAGAATGGAGGAAGG + Intergenic
1098159884 12:67639834-67639856 CACTGGGAAAGGATTGAGGAGGG + Intergenic
1099020308 12:77395483-77395505 CTGGAAAAATGGATTGAGGTAGG + Intergenic
1099054329 12:77819605-77819627 CAGTGGGAAAGCATTGAGGAGGG + Intergenic
1099366019 12:81766016-81766038 TTGGGGAAAAGGTATGTGGATGG + Intergenic
1099535412 12:83837599-83837621 CTGGGGTAAGGAAATGAGGAAGG - Intergenic
1100448966 12:94687093-94687115 CTGGGGATAAGGAAGGATGATGG + Intergenic
1100765947 12:97865820-97865842 CTGGGGGGATAGATTGAGGAGGG - Intergenic
1101348107 12:103904929-103904951 CTGGGGAATCTCATTGAGGAAGG - Intergenic
1101440207 12:104698241-104698263 CTGGAGAAATGGGTTGAGGTTGG - Intronic
1101744949 12:107532337-107532359 CTGGGGACAAGGATGCTGGATGG - Intronic
1101799824 12:108011508-108011530 GTGGTGAACAGGAGTGAGGAAGG - Intergenic
1101842906 12:108340701-108340723 CTGAATTAAAGGATTGAGGATGG - Intergenic
1102451495 12:113045058-113045080 GGGGGGAAAAGGAAGGAGGAGGG + Intergenic
1102646479 12:114407064-114407086 CTGGAGAAAGGGATGGAGGGAGG + Intronic
1102709091 12:114909620-114909642 CTGGCGAAAAAGATGGAAGAAGG - Intergenic
1103200159 12:119081654-119081676 CTGGGGAACAGGATGCAGGAAGG + Intronic
1104082833 12:125445887-125445909 CTGGGATGAAGGATTGAGGCTGG - Intronic
1104202721 12:126607389-126607411 CTGGGGGTGAGGGTTGAGGATGG - Intergenic
1104328828 12:127825498-127825520 CTGGGGCAGAGCAGTGAGGACGG - Intergenic
1105683298 13:22752058-22752080 GTGGGGAAAGGGAGTGAGGCGGG - Intergenic
1105728359 13:23187301-23187323 CTGAGGAAGAGGCTTGTGGATGG - Intronic
1106544519 13:30718487-30718509 ATGGAGAAAAGGATGGAGGAAGG - Intronic
1107967472 13:45610371-45610393 TTGGGGAAAAGGGTTGGGGGTGG - Intronic
1108223646 13:48265222-48265244 TTGGGGAATGGGACTGAGGAAGG - Exonic
1108583728 13:51849688-51849710 CTGAGTAAAAGGGTTGAGGCGGG - Intergenic
1108991667 13:56666282-56666304 GGTGGGAAAAGGATAGAGGATGG + Intergenic
1109483322 13:62985534-62985556 CTGGGGAAGAGGCTTGTGGATGG - Intergenic
1109519114 13:63485433-63485455 TTGGGGAAAAGGTATGTGGATGG + Intergenic
1110236321 13:73221407-73221429 GTGGGGAAAAGGATTGCAGAGGG - Intergenic
1111108316 13:83674482-83674504 CGGAAGAAAAGAATTGAGGAAGG - Intergenic
1111399970 13:87721391-87721413 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1112177965 13:97047294-97047316 ATGAGGAGAAGGAATGAGGAGGG - Intergenic
1112511869 13:100016872-100016894 CTGAGAAAGAGGATTTAGGACGG + Intergenic
1114042210 14:18689414-18689436 CTGGGGAAAGGGAGTGTGGGAGG + Intergenic
1114492273 14:23110661-23110683 ATGGGGATAAGGAGAGAGGATGG + Intergenic
1114761909 14:25325351-25325373 CTGGGGAAAAGCATCAAGGTGGG + Intergenic
1114781291 14:25540955-25540977 ATGCTGAAAAGGAGTGAGGATGG + Intergenic
1116239686 14:42324771-42324793 CAGAGGAAAAGGACTGGGGATGG + Intergenic
1118073460 14:62271431-62271453 CTGGGGAAGAGGTTTGTGGGAGG - Intergenic
1118988986 14:70781032-70781054 CTGGGGAAAAGCACAGAGGATGG - Intronic
1119620203 14:76126133-76126155 CTGAGGAAAACTATTGGGGAAGG + Intergenic
1120199398 14:81519794-81519816 TTTGGGCAAAGGAATGAGGAAGG + Intronic
1120498327 14:85262952-85262974 CTGGGGAAGAGGTATGTGGATGG - Intergenic
1121010041 14:90514423-90514445 CTGGGGAAATGGGGTGAGGATGG + Intergenic
1121798918 14:96757215-96757237 AGGGGGAAGAGGATGGAGGAGGG + Intergenic
1122730636 14:103794696-103794718 CTAGGTAAAAGGACTGAGAAAGG + Intronic
1124369775 15:29097805-29097827 CTGGGGCAAAGGAGTGAAGGGGG - Intronic
1125328677 15:38562638-38562660 CTAGGGAGAAGTATTGTGGAAGG - Intronic
1126538318 15:49793618-49793640 ATGGGAAAAAGGATTCATGAAGG + Intergenic
1126750336 15:51870510-51870532 CTGGCCAAAATGATTGAGAAGGG - Intronic
1126767310 15:52022005-52022027 AGGGGGAAAAAGATTGAGAATGG + Intronic
1127191546 15:56536608-56536630 CTGGAGTAAAGGCATGAGGAAGG + Intergenic
1128713276 15:69887897-69887919 CAGGAGAAAAGGAAGGAGGAAGG + Intergenic
1128846424 15:70901105-70901127 CTGGGGAACAGGAGGAAGGAGGG - Intronic
1129107476 15:73319608-73319630 CTGGTGAGAATCATTGAGGAGGG - Intergenic
1130060202 15:80564173-80564195 CTGGGGAAAATGATGGATGCTGG - Intronic
1130126626 15:81099312-81099334 TTGGGGTAAAGGATTGGGCAGGG - Intronic
1130133800 15:81164896-81164918 CTGGGGCACAGGATGGAGGGTGG + Intronic
1130514590 15:84616498-84616520 CTGGGTAAAAGCAATGAGGAAGG - Intronic
1130935233 15:88464610-88464632 CTGGGGAATTGGATTAAGGGTGG - Intronic
1131069776 15:89458867-89458889 CTCAGGCAAAGGATTGGGGATGG - Intergenic
1131371698 15:91887264-91887286 CTGGGGAAAATGGCCGAGGAAGG - Intronic
1131755891 15:95561584-95561606 CTGGGGAAAAGGTTGAAGTAGGG - Intergenic
1131937779 15:97525791-97525813 AAGGGGAAAAGGATAGAAGAAGG + Intergenic
1132941907 16:2512733-2512755 CTGGGGAAGGGGCTTGAGGGAGG + Intronic
1133299964 16:4776433-4776455 CTGGGGCAGGGGAATGAGGAAGG + Intergenic
1133640616 16:7713540-7713562 TTTGGGAAAATGAGTGAGGAAGG - Intergenic
1133761166 16:8799305-8799327 CTGGGAAGAAAGATGGAGGAAGG - Intronic
1134774113 16:16837085-16837107 CTGGGGGAAAGGAGAGGGGAGGG + Intergenic
1134824598 16:17274461-17274483 CAGGGGAAAAGGATATAGGAAGG + Intronic
1134829980 16:17315096-17315118 CTGGGGAAAAGGCAGAAGGAGGG + Intronic
1135866239 16:26105029-26105051 CGGGGGATAAGGCTTGAAGAAGG - Intronic
1137249414 16:46731232-46731254 CCGGGGCACAGGATTGGGGAGGG + Intronic
1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG + Intergenic
1137534132 16:49304716-49304738 CTGGGGAAAGGGAGTGGAGAAGG + Intergenic
1138482658 16:57314068-57314090 CTGAGGAAAGGGAATGAGAAGGG + Intergenic
1139472384 16:67185108-67185130 TTGGGGGAAAAGATTGGGGAAGG - Intronic
1139889401 16:70238966-70238988 GTGGGGAGAGGGAATGAGGAAGG + Intergenic
1140057801 16:71540745-71540767 CTGGTGACAAGCATAGAGGATGG + Intronic
1140107379 16:71973176-71973198 CTGGGCAAAAGGAGGGAGGAGGG - Intronic
1140289714 16:73641749-73641771 TTGGGGAATAGGATTGGGGTGGG + Intergenic
1140923023 16:79556600-79556622 ATGGGGACAAGGGTTGAGCAAGG + Intergenic
1143476383 17:7205845-7205867 ATGGGGATGGGGATTGAGGATGG - Intronic
1143513485 17:7408126-7408148 CGGGGGGAAAGGAGGGAGGAGGG - Intronic
1143752425 17:9038301-9038323 ATGGGGAAAAGGAGTTAGTAGGG - Intronic
1144601821 17:16622596-16622618 CTGTGGAAAAGCCTTCAGGAGGG - Exonic
1146175476 17:30663650-30663672 CTGTGGATAAGGATGGAGGGAGG - Intergenic
1146348927 17:32079696-32079718 CTGTGGATAAGGATGGAGGGAGG - Intergenic
1146679026 17:34793685-34793707 CTGGGCAAAGGCATGGAGGATGG - Intergenic
1146910668 17:36646485-36646507 CTGGGGAAGAGGGTGGAAGAGGG + Intergenic
1148773588 17:50080599-50080621 CTGGGGAAAGGCATGGAGGTGGG - Intronic
1148821423 17:50361943-50361965 CTTGGGAAAGGGAGGGAGGATGG - Intronic
1149267308 17:54941013-54941035 CTAGGGAAAAGGAGAGAGGGAGG - Intronic
1149637281 17:58181027-58181049 GGAGGGAAAAGGAGTGAGGAGGG - Intergenic
1149921512 17:60664911-60664933 CTGGGGAGAGAGATTGAGGCAGG - Exonic
1150893287 17:69179588-69179610 CTGGGGAAAAGAAAGGAGGAAGG + Intronic
1151539596 17:74758294-74758316 CTGGGGGAAAGGACAGATGAAGG + Intronic
1151585460 17:75005631-75005653 CTGGGGGAGAGGAGTGTGGAAGG + Exonic
1152348945 17:79772501-79772523 CTGGGGACAGGGAAGGAGGAAGG + Intergenic
1153089802 18:1330790-1330812 TTGGGGAAAAGGTATGTGGATGG + Intergenic
1153746590 18:8185907-8185929 CTGGGGAACAGGACTGTGTATGG - Intronic
1154031245 18:10756062-10756084 ATGGGGATAAGGATAAAGGATGG + Intronic
1154068551 18:11131727-11131749 TTGGGGAAGAGGTTTGTGGATGG + Intronic
1156245655 18:35295377-35295399 CTGGGGGAAAAGTATGAGGATGG - Intergenic
1156504346 18:37579603-37579625 CTGGGGAAGAGCAAAGAGGAAGG + Intergenic
1156504368 18:37579729-37579751 CTAGAGAAAAGGATTCAGGAAGG - Intergenic
1156510305 18:37630925-37630947 CTGGGGAAAAGGGGGGATGAAGG - Intergenic
1156766638 18:40664370-40664392 CTAGGAAAATGGATTGTGGAAGG - Intergenic
1157051627 18:44172763-44172785 CTGGGGAAATGGAACAAGGAAGG + Intergenic
1157589319 18:48826900-48826922 GTGGGGAAATGGAATGGGGAAGG + Intronic
1157595338 18:48860658-48860680 CTGGGGAAAAGGATGGGAGTGGG + Exonic
1157702387 18:49770395-49770417 CTGGGGAAAAGGTGGGAGGGGGG - Intergenic
1157711315 18:49851701-49851723 CAGGGGAAATGGCTTGAGGCTGG - Intronic
1157998414 18:52587496-52587518 TTGGGGAAGAGGTTTGTGGATGG - Intronic
1158257750 18:55572407-55572429 CTGAGAAAATGGAGTGAGGAGGG + Intronic
1159067877 18:63589798-63589820 CTGGGGAAAAGGACTGAGAAAGG + Intronic
1159908950 18:74125332-74125354 CTAAGGAAAAGGGATGAGGATGG + Intronic
1160848988 19:1180670-1180692 CTGGGGAAGTGGGTGGAGGAAGG - Intronic
1161019280 19:2000399-2000421 GTGGGGAAAACCTTTGAGGAGGG + Intronic
1161845347 19:6709035-6709057 CTTGGGATCAGGAGTGAGGATGG - Intronic
1162983490 19:14254261-14254283 CTGTGGATAAGGATGGAGGGAGG + Intergenic
1163442691 19:17329633-17329655 CAGGAGAGAAGGATGGAGGAGGG + Intronic
1163987678 19:20968609-20968631 CTGGGGAATAGAGTTCAGGAAGG + Intergenic
1164596016 19:29530981-29531003 CTGGGAGAAGGGATTGGGGATGG + Intronic
1164918321 19:32069889-32069911 GTGGAGAAAAAGATTGGGGAGGG - Intergenic
1165077274 19:33286844-33286866 CAGGGGTAAGGGAATGAGGATGG + Intergenic
1165920981 19:39297817-39297839 CTGGGGAGAAGGAGACAGGAGGG - Intronic
1166075849 19:40413400-40413422 GGGGGGAAAAGGAATGGGGAGGG + Intergenic
1167502068 19:49854109-49854131 CTGGGGCAAAGGCTGGAGGTGGG + Intronic
1167569253 19:50276729-50276751 TTGGGGGAAAGGAGAGAGGATGG - Intronic
1167647914 19:50715784-50715806 CTGGGGAGAAGGCTTGGGGTAGG + Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1167729688 19:51244665-51244687 CTGGGGAAGAGGAGTCAAGATGG - Intergenic
1168467445 19:56614883-56614905 CTGGGGATGGGGGTTGAGGAAGG - Intronic
1168539242 19:57196773-57196795 CTGGGGAAGAGGGATGTGGATGG - Intronic
925831891 2:7904016-7904038 CAGGAGAAAAGGGATGAGGATGG - Intergenic
926254928 2:11185037-11185059 CTGGGGTATGGGAGTGAGGAGGG - Intronic
927263306 2:21116742-21116764 CTGGAGGAGAGGAGTGAGGAGGG + Intergenic
927908073 2:26876234-26876256 CTGGTGAACAGAATGGAGGAAGG + Intronic
928914986 2:36461025-36461047 CTGGGAAACAGAATTGAGAAAGG + Intronic
929248960 2:39732010-39732032 CTCGGGAAGAGGAATGTGGATGG - Intergenic
929279358 2:40061257-40061279 GTGAGGAGGAGGATTGAGGACGG - Intergenic
929918544 2:46155783-46155805 GTGGGGAGAAGGATGGAGAAAGG - Intronic
929950297 2:46405128-46405150 CTGGGGATAAGGATGGAAGGAGG - Intergenic
930055200 2:47246525-47246547 CTGGGGATATGCAGTGAGGAAGG - Intergenic
930102751 2:47615930-47615952 CTGGGGAAATGGATGAAGAAAGG - Intergenic
931282694 2:60808010-60808032 TTGGGGAAAAGGTATGAGGCTGG + Intergenic
932068549 2:68592434-68592456 CAGGGGAAAAGCATAGAGAATGG + Intronic
932343653 2:70982142-70982164 CTAGGGAAAAGGCTGGGGGAGGG - Intronic
932369834 2:71177754-71177776 CTGGGGAGGAGGAGTCAGGAAGG + Intergenic
934050577 2:88207189-88207211 TTGGAGAAAAGGTTTGTGGATGG + Intergenic
934737274 2:96695912-96695934 CTGGGGAAAGGCACGGAGGAAGG - Intergenic
935195509 2:100812638-100812660 ACGGGGAGAAGAATTGAGGAAGG + Intergenic
935564219 2:104589620-104589642 CTGGGGAAGAGGTATGTGGATGG - Intergenic
938240910 2:129741733-129741755 CTGGGGAACAGGCAGGAGGAAGG - Intergenic
938241049 2:129742530-129742552 GTGTGAGAAAGGATTGAGGAGGG - Intergenic
938268005 2:129943117-129943139 CTGGGGAAAGGGAGTGTGGGAGG - Intergenic
938665502 2:133531155-133531177 ATGGTGAAAGGGAATGAGGAAGG + Intronic
938675038 2:133624125-133624147 TTGGGGAAAAGGGTGGGGGATGG + Intergenic
938964394 2:136375504-136375526 CAAGGAAAAAGGAGTGAGGAAGG + Intergenic
939788593 2:146545480-146545502 TTGGGGAAAAGGTATGTGGATGG - Intergenic
940997444 2:160164999-160165021 CTGGGAACAAAGACTGAGGAGGG - Intronic
941010769 2:160297197-160297219 CAGGGGAGAAAGATGGAGGAGGG + Intronic
941312166 2:163947084-163947106 GCGGGAAATAGGATTGAGGATGG + Intergenic
943058746 2:183015948-183015970 CTGGGAAAAAGGCTTGAGAGGGG + Intronic
943239502 2:185364887-185364909 CTGGAGAAAAGGCATGGGGATGG - Intergenic
943252971 2:185553333-185553355 CTGAGGAAAAGGTTTTAGGTAGG - Intergenic
944518362 2:200536506-200536528 CTGGGGAAAAAAATAGAGGCTGG + Intronic
945143761 2:206715065-206715087 CTGGGCAAAGGCATGGAGGATGG + Intronic
945151042 2:206792289-206792311 CTGTTGAAAATGAGTGAGGATGG + Exonic
945405337 2:209440860-209440882 CTGGGTAACAGGCTTCAGGAGGG - Intronic
945698578 2:213141300-213141322 GTGGGGAAAAAGATTGTGGATGG - Intronic
945935249 2:215897230-215897252 CTGGGGAGAATTATTGAGCAGGG + Intergenic
946024601 2:216664346-216664368 CTGGGGTACAGGTTTGGGGAGGG + Exonic
946555309 2:220849836-220849858 CTGGCTAAAAGGATAGAGTAAGG + Intergenic
947503312 2:230687584-230687606 CTGGGGTAAAGGCTAGATGACGG + Intergenic
948108036 2:235430711-235430733 CCGGGGAAAAGTCCTGAGGAAGG - Intergenic
1168903189 20:1383184-1383206 CTGGGTAACAGGACTGAAGAAGG + Intronic
1169206403 20:3742540-3742562 CTGGGGTAAAAGTTGGAGGATGG + Intronic
1169499702 20:6147717-6147739 CTGGGGATAATGAATAAGGAAGG + Intergenic
1170830973 20:19840269-19840291 CCAGGGAAAAGGAGTGGGGAAGG - Intergenic
1170987687 20:21273614-21273636 CTGGGGGAGAGCATGGAGGAGGG - Intergenic
1171062514 20:21979824-21979846 CTATGTAAAAGGACTGAGGAAGG + Intergenic
1171358911 20:24572828-24572850 CAGGGGTTAAGGATGGAGGAAGG + Intronic
1173019838 20:39257946-39257968 CCGGGGAAAAGAGTGGAGGATGG - Intergenic
1173037166 20:39423467-39423489 CTAGGGAAAAGGAATGAAGTTGG - Intergenic
1173107496 20:40151579-40151601 TTGGGGGAAAGGATTCAGGTAGG - Intergenic
1173854002 20:46238052-46238074 CTGTGGAGAAGGGCTGAGGATGG - Intronic
1173929586 20:46807569-46807591 CTGGGGGAAGGGACAGAGGAAGG + Intergenic
1174324899 20:49771373-49771395 TAGGGGAACAGGTTTGAGGAGGG - Intergenic
1174607450 20:51771181-51771203 CTGGGGACATGGATATAGGATGG - Intergenic
1174976012 20:55335282-55335304 CTGGGGAAAAGGATATGGGATGG - Intergenic
1175108983 20:56632553-56632575 CTGCTTAAATGGATTGAGGATGG + Intronic
1175289803 20:57868169-57868191 CTGGGGAGCAGGAGTGAGGGGGG - Intergenic
1175754877 20:61523130-61523152 CTAGGGAGAGGGATGGAGGATGG - Intronic
1175826927 20:61941610-61941632 CTGGGGAAATGAAGTGGGGAGGG - Intergenic
1175921512 20:62452530-62452552 CTGAGGAGAAGGACTGAGGAGGG - Intergenic
1176000328 20:62828741-62828763 CTGGGGACAAGGGATGAGTAAGG - Intronic
1176204971 20:63883337-63883359 CTGGGGCCAAGGAGTGAGCAGGG + Intronic
1178005962 21:28219804-28219826 TTGGGGAAGAGGAATGAGGATGG - Intergenic
1178752213 21:35315718-35315740 CAAGGGACAAGGATTGGGGAAGG + Intronic
1179081181 21:38172037-38172059 TTGGGGAAGAGGCATGAGGAGGG + Intronic
1180626870 22:17199425-17199447 GAGGGGAAGAGGATAGAGGAGGG - Intronic
1181330059 22:22083881-22083903 CACGGGATTAGGATTGAGGAAGG - Intergenic
1181744389 22:24945717-24945739 CTGGGGACAAGCACAGAGGAAGG + Intronic
1181918686 22:26301989-26302011 TTGGCAAAAATGATTGAGGATGG + Intronic
1181975064 22:26723054-26723076 AAGGGGAAATGGATGGAGGAGGG - Intergenic
1182074608 22:27487376-27487398 CTGGGGAGAATGATTGAAGAGGG - Intergenic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1183124126 22:35759141-35759163 ATGGGGAAAAGGAGTGAAGATGG - Intronic
1183405787 22:37629973-37629995 GTGGGGAAAAGGATGCAGGTGGG - Intronic
1183592734 22:38789966-38789988 CTGGGGAAAAAGACTGGGGTTGG + Intronic
1183740435 22:39665858-39665880 CTGGGGAAAGGGGGTGAGGTTGG - Intronic
1183950091 22:41347932-41347954 CTGGGTCAGAGGAGTGAGGAAGG - Intronic
949219521 3:1614250-1614272 GTGGGGATAAGGTTTGAGTAGGG - Intergenic
949723008 3:7012544-7012566 CAGGGGAGAAGGATGGGGGAAGG - Intronic
949838215 3:8291971-8291993 GTGGGGAGCAGGTTTGAGGAAGG + Intergenic
949927172 3:9050682-9050704 CTGGGGAACAGAATTCAAGAAGG - Intronic
950912305 3:16606744-16606766 CTTAGGAAAAGGATGGAGTAGGG + Intronic
953042944 3:39271075-39271097 TTGGGAAAAAGGAATGGGGAAGG - Intronic
953827303 3:46264970-46264992 GCCAGGAAAAGGATTGAGGAAGG - Intronic
954425068 3:50438848-50438870 GTGGGGAAAAGCAAGGAGGAAGG + Intronic
954511395 3:51129034-51129056 CTGGGGAAGAGGTATGTGGATGG - Intronic
954882271 3:53844343-53844365 CTTGGCAAAAGGATAGGGGAGGG - Intronic
955884813 3:63586492-63586514 CTGGGGATAGGGATGGAAGAAGG - Intronic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
956383013 3:68686049-68686071 CTGGGGGAAAGGATGGTGGTGGG - Intergenic
956888782 3:73588531-73588553 GTGGGAAACAGGACTGAGGAGGG - Intronic
957024117 3:75160373-75160395 CTGGAGACAGGGATTGAAGAGGG - Intergenic
957040412 3:75331768-75331790 CTGGGGAGAAGGACAAAGGAGGG - Intergenic
957491842 3:80937479-80937501 CTAGGGAAGAGGATTGTGAATGG - Intergenic
957769036 3:84663935-84663957 CAGGGGAGAAGGAGAGAGGAAGG + Intergenic
959916963 3:111827209-111827231 CTGGTTAAAAGGTTAGAGGAAGG - Intronic
960963113 3:123085689-123085711 CTGGGGAGAAGGAAAGGGGAAGG - Intronic
961243623 3:125433415-125433437 TTAGGGAAAAGGAATGAGGCTGG - Intergenic
962514656 3:136139260-136139282 CTGGGCAAAAGCATTAAGGCGGG - Intronic
963940595 3:151092624-151092646 CTGGGGAAGTGGAGTGAGGGAGG + Intronic
966285492 3:178290240-178290262 ATAGAGAAAAGGATTGAAGAGGG + Intergenic
966445776 3:179999189-179999211 TTGGGGAAAAGGTATGTGGATGG + Intronic
967125263 3:186417790-186417812 ATGGGGGGAAGCATTGAGGAAGG - Intergenic
967389893 3:188945348-188945370 GTGGGGAGAAGGGTTCAGGATGG - Intergenic
968229319 3:196996055-196996077 CTGGGGAAGAGGAAAGAGCAGGG - Intronic
968448048 4:662335-662357 CAGGGCAGAAGGATGGAGGAGGG + Intronic
969032133 4:4223977-4223999 GTGGAGAGAAGGATGGAGGAAGG + Intronic
969343402 4:6556613-6556635 CTGGGGAAGAGGTGTGTGGATGG - Intronic
969563388 4:7963436-7963458 CTGGGGAGAAGGGCTGAGGATGG + Intergenic
970132597 4:12887701-12887723 CTGGGGAAAGGAATAGAGAAAGG + Intergenic
970243396 4:14032802-14032824 CTGGGGAAAGGCAGTGAGCATGG - Intergenic
970377255 4:15471452-15471474 GTGGAAAAAAGGAATGAGGAGGG - Intronic
971408258 4:26342520-26342542 ATGGGAGAAAGGAATGAGGAGGG - Intronic
975442383 4:74426521-74426543 TTGGGGGCAAGGATTGGGGAAGG - Intergenic
975736733 4:77388689-77388711 CTGAGGGTAAAGATTGAGGATGG - Intronic
976085992 4:81407682-81407704 CTGAAGAAAGGGATGGAGGATGG + Intergenic
977116026 4:93030236-93030258 CGGGAGAAAAGGAAAGAGGAAGG - Intronic
977313167 4:95412243-95412265 GTGGTGAAGAGGATTGAGAAGGG - Intronic
978655557 4:111061676-111061698 CTGGGGACAAAGAATGAGGATGG + Intergenic
978759465 4:112340635-112340657 CAGGTGAAAAGGGTTGAGGGGGG - Intronic
978780925 4:112553185-112553207 ATGGGGAAAAGCAATGGGGATGG - Intronic
980060476 4:128123461-128123483 CTGGGTAAAGGGATAGAGAATGG - Intronic
980319677 4:131254386-131254408 CTGGGGAAAACTAGTGAGGTTGG + Intergenic
980641183 4:135582777-135582799 CTTGGAAAAAGAATAGAGGAAGG - Intergenic
981134198 4:141191356-141191378 CTTGGGCAAAGGATTGAGGTGGG - Intronic
981424133 4:144584146-144584168 CTGGTGAGAAGGATGGAAGAAGG - Intergenic
981873624 4:149515829-149515851 TTGGGGAAAAGGTATGTGGATGG + Intergenic
981953999 4:150447853-150447875 TTTGGGAAAAGGAGTGTGGATGG - Intronic
982543819 4:156708879-156708901 CTAGGGAAAAGGCATGAGAATGG - Intergenic
983486226 4:168333954-168333976 CTGGGGAATTGGATTGAGGAAGG - Intergenic
983922089 4:173357110-173357132 GTGGAGATTAGGATTGAGGAAGG + Intergenic
985483831 5:137781-137803 CTGGGCAATAGGATCGGGGACGG + Intergenic
986149224 5:5111635-5111657 CTAAGGCAAATGATTGAGGATGG + Intergenic
987055703 5:14189426-14189448 CTGTAGAATTGGATTGAGGAGGG + Intronic
987153264 5:15062295-15062317 CTGGGGAAGAGGTATGTGGATGG + Intergenic
987572990 5:19688345-19688367 CTGGGGAAGAGGATTCTAGATGG - Intronic
988846730 5:35135208-35135230 CTAAGGAAAAGGCATGAGGAAGG + Intronic
989144770 5:38238000-38238022 CTGGGGAAAGTGGTTGAGAAGGG - Intergenic
989658192 5:43768076-43768098 CTGGGGAAGAGGGTTCAGGTGGG + Intergenic
989731141 5:44650654-44650676 TTTAGGAAAAGGATTGGGGAGGG + Intergenic
991013709 5:61910258-61910280 TTGGGGAAGAGGTTTGTGGATGG - Intergenic
991693157 5:69245270-69245292 GAGGGGAAAAGGAGGGAGGACGG - Intronic
992756309 5:79909897-79909919 CTGGGGAAAAGGCATGAGAAGGG - Intergenic
992920334 5:81510264-81510286 ATGGGGAATAGGTTTGAGGTGGG - Intronic
993302918 5:86235595-86235617 ATGAGGAAAAGGATGGGGGAAGG + Intergenic
995906791 5:117134365-117134387 CTGGGGAAAAAGGATCAGGAGGG + Intergenic
996392117 5:122973161-122973183 CTGGGGAAGAGGTATGTGGATGG - Intronic
1000010650 5:157228541-157228563 CTGGAGAAAAGGCTTGGGGTAGG + Intronic
1000197306 5:158972182-158972204 CTGGGGACACAGATTGAGGTGGG - Intronic
1000303252 5:159973661-159973683 CTGGAAAAAAGCACTGAGGAAGG + Intergenic
1000662440 5:163952262-163952284 ATGGGGAAAAGCACTGAGGGAGG + Intergenic
1001545982 5:172570805-172570827 GAGGGGAAAAGGAAGGAGGAAGG + Intergenic
1001916835 5:175568967-175568989 CTTGGGATGGGGATTGAGGAAGG + Intergenic
1001932161 5:175680916-175680938 GTGTTGAAAAGGACTGAGGAAGG + Intronic
1001975216 5:175993294-175993316 CTGGAGAGAAGGATTGAAGGGGG - Intronic
1002242215 5:177850476-177850498 CTGGAGAGAAGGATTGAAGGGGG + Intergenic
1003423070 6:5975299-5975321 TTAGGGAAAAGGAGTCAGGATGG + Intergenic
1005403302 6:25458014-25458036 CAGGGGAAAGGGAGTAAGGAGGG + Intronic
1005418240 6:25623809-25623831 CTGGGCTAAAGAATTTAGGAAGG - Intergenic
1006062434 6:31433842-31433864 TTGGGGAAGAGGTTTGTGGATGG + Intergenic
1006404874 6:33839079-33839101 CTGGGGAAGAGGAGTGGGGGTGG - Intergenic
1006640257 6:35485975-35485997 GTGGGGAAGGGGACTGAGGAGGG + Intronic
1006795995 6:36732772-36732794 GTGGGGAAAGGGAGTGAGGTTGG - Exonic
1007036405 6:38678467-38678489 CTGGGGAGAATGGGTGAGGATGG + Intronic
1007079338 6:39087629-39087651 CTGGGGAAAGGTTTTGGGGAGGG - Exonic
1007285015 6:40741374-40741396 CTGGGGAGAAGGCTTGAGTTTGG - Intergenic
1007308652 6:40927252-40927274 CTGGGGAAAGTGACTGAAGAGGG + Intergenic
1007582970 6:42970109-42970131 GTGGGGAAAAGGAATGCAGATGG + Intronic
1007654908 6:43446042-43446064 CTGGGGACAAGGGATGGGGAAGG + Intronic
1007694570 6:43724117-43724139 CTGGGGAGAAGGATTGGGATTGG + Intergenic
1007767579 6:44170006-44170028 CTGGGCAAGAGGATTGGGGGAGG + Intronic
1008092615 6:47308832-47308854 GAGGGTAAAGGGATTGAGGAGGG + Intronic
1008340360 6:50356996-50357018 TTGGGGAAAAGGTATGTGGATGG + Intergenic
1010636474 6:78264980-78265002 ATGTGGAAAAGCATTGTGGAAGG - Intergenic
1010885443 6:81232481-81232503 CAGGAGAAATGGATTGAGGCAGG + Intergenic
1011240897 6:85270365-85270387 CAGAGGAAAAGGAATGATGATGG - Intergenic
1011823444 6:91279142-91279164 CTGGGGAAGAGTGTGGAGGAGGG - Intergenic
1012002038 6:93665554-93665576 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1012344674 6:98170951-98170973 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1012545555 6:100415069-100415091 CTAGGGAAAAGGCAAGAGGAGGG + Intronic
1012957724 6:105589200-105589222 CTGGGGAAAATGAGGGAAGAAGG + Intergenic
1013417677 6:109939260-109939282 CTGGGAAACACCATTGAGGAAGG + Intergenic
1013673753 6:112434348-112434370 CGGGGGAAACATATTGAGGAAGG - Intergenic
1013998667 6:116340008-116340030 CTGAGAAAAAGGATTGAGGAAGG + Intronic
1015095359 6:129408970-129408992 CTGGGGAAGAGGTATGTGGATGG - Intronic
1015314526 6:131803631-131803653 TTAGGGAAAAGGAGTCAGGATGG - Intergenic
1015456787 6:133435468-133435490 CTGGGGAAATGGGTTGGTGAGGG + Intronic
1015710141 6:136130327-136130349 CAGTAGAAAAGGAATGAGGAAGG - Intronic
1017123548 6:151045705-151045727 CTGGGGAAAAGGACTCATGCTGG - Intronic
1017274748 6:152553423-152553445 CGGGGGAAAGGGAGTAAGGAGGG - Intronic
1017929302 6:158938494-158938516 CAGGTGAAAAGGAGGGAGGAAGG + Intergenic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1020688906 7:11330253-11330275 CTGGGGCAAATGAGAGAGGAGGG - Intergenic
1021123256 7:16820883-16820905 ATGGGGAAAATGATAGATGATGG - Intronic
1021205676 7:17777021-17777043 CTGGGGATAGGGAATGAGGAGGG - Intergenic
1021242910 7:18226676-18226698 ATAGGGAGTAGGATTGAGGAAGG + Intronic
1023338291 7:39192909-39192931 AAGGAGAAAAGGATGGAGGAAGG + Intronic
1023356422 7:39371540-39371562 CAGGGGTAAAGGATGGAGGGAGG - Intronic
1024316904 7:48028574-48028596 CTTGGGAGAAGGATTAAGAAAGG - Intronic
1024564442 7:50669794-50669816 TTCAGGAAAAGGATTGGGGATGG + Exonic
1025712861 7:63927828-63927850 CTGGGGAAAGGGTGTGAGGCAGG - Intergenic
1026606909 7:71824287-71824309 GGGGGGACAATGATTGAGGAAGG - Intronic
1026904726 7:74056453-74056475 CTGGGGACATGGGTTGAGAAGGG + Intronic
1027406972 7:77872363-77872385 CTGGGGAAGAGGTATGTGGATGG - Intronic
1028490873 7:91410234-91410256 GTGGGGGTAACGATTGAGGATGG - Intergenic
1029263672 7:99322250-99322272 TTAGGGAAAAGGAGTCAGGATGG + Intergenic
1029293817 7:99523250-99523272 CTGGGGTACAGGAAGGAGGAAGG + Intronic
1029540727 7:101180478-101180500 CTGGGGAGTGGGACTGAGGATGG + Intergenic
1030277626 7:107737264-107737286 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1030440068 7:109578459-109578481 CTAGGGAGCAGGATTGAAGATGG - Intergenic
1030656505 7:112173995-112174017 GTGGGGAAAGGCAATGAGGAAGG - Intronic
1031376799 7:121036270-121036292 TTGGGGAAAAGGCTGGGGGATGG - Intronic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1031541022 7:122994574-122994596 CAGTGGAAAAGGATAGAGAAAGG + Intergenic
1031969286 7:128052452-128052474 ATGGGGAAAAGGAGACAGGATGG - Intronic
1032018251 7:128393080-128393102 CTGGGGAAAGGGTTTTGGGAAGG - Intronic
1032150663 7:129426811-129426833 ATGGGGAAAGGAATTGAGGAAGG - Intronic
1032306407 7:130736050-130736072 TTGGGGAAAAGGGTGGAGAATGG - Intergenic
1032527463 7:132590224-132590246 CTGAGGAAATGAACTGAGGAAGG + Intronic
1032583909 7:133129173-133129195 CTGGGGAAAGGGCATGTGGATGG + Intergenic
1034169895 7:149054902-149054924 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1035138801 7:156736516-156736538 TTGGGAAAATGGATTCAGGAGGG - Intronic
1035242391 7:157540717-157540739 CTGGGGAAGGGCCTTGAGGATGG + Exonic
1035536473 8:395070-395092 CTGGTGAAGGGGAATGAGGAAGG + Intergenic
1035917325 8:3638816-3638838 CTGGAGACAAGGTGTGAGGAAGG - Intronic
1036487235 8:9190237-9190259 CTTGAGGAAAGGATGGAGGATGG - Intergenic
1037162801 8:15793348-15793370 CAGGGGAAAAGGAGTGGAGAAGG - Intergenic
1037596179 8:20356220-20356242 CTGGGGAGGAGGATGTAGGAGGG - Intergenic
1038209564 8:25503464-25503486 CTCGGGAATAGGACTGAGGAGGG - Exonic
1039261857 8:35780455-35780477 CCGAGGAAAAGGATGGAGGAAGG + Intronic
1039379330 8:37070204-37070226 AGGAGGGAAAGGATTGAGGAAGG + Intergenic
1039563461 8:38531515-38531537 CTTGGGAAGAGGAAGGAGGAAGG + Intergenic
1039947957 8:42146225-42146247 CTGGGGAAAACAGTTGAGGTTGG + Intergenic
1041686320 8:60648144-60648166 CTAGGGAACAGCATGGAGGAAGG - Intergenic
1041688795 8:60669286-60669308 TTGGGGAAAAGCATTGATCAGGG + Intergenic
1043435974 8:80236760-80236782 CTGGGTAAAAGGATCAGGGAAGG + Intergenic
1044285887 8:90411817-90411839 TTGGGGAAGAGGTATGAGGATGG - Intergenic
1044591579 8:93917711-93917733 GGGGGGAAGAGGATGGAGGAGGG - Intronic
1044820721 8:96154147-96154169 TTGGGGAGAAGGACAGAGGACGG - Intronic
1045737422 8:105313060-105313082 CTGTGGAAGAGGATTGGGAATGG + Intronic
1047198807 8:122746150-122746172 CTGGGAAAGAGGATTTTGGAGGG - Intergenic
1048340882 8:133537596-133537618 CTGGAGAAAAGCATCCAGGAGGG + Intronic
1048748504 8:137643585-137643607 ATGTTGAAAAGGAGTGAGGAAGG + Intergenic
1049169214 8:141148234-141148256 CTGGTGGAAAGGAGGGAGGAGGG + Intronic
1049350562 8:142162246-142162268 ATGGGTAAATGGATAGAGGATGG + Intergenic
1049440784 8:142608632-142608654 TTGGGGAAAAGAATTGAGTCTGG - Intergenic
1049832465 8:144710778-144710800 TTGGGGAAGAGGGATGAGGAAGG + Intergenic
1050124526 9:2342920-2342942 CTGGGAAAAAGGTATGTGGATGG + Intergenic
1050474348 9:6024224-6024246 GTGGGTAAAACCATTGAGGAAGG - Intergenic
1050482761 9:6103231-6103253 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1050688283 9:8196878-8196900 CTAGGGAATAGGATTCATGAGGG - Intergenic
1051363610 9:16304228-16304250 CTGGGGAAAGTGTTTTAGGAAGG + Intergenic
1051871153 9:21739032-21739054 CTGGGGAAAGGAATTGGAGAGGG + Intergenic
1052561478 9:30089360-30089382 CTGGGGAAGAGGTATGTGGACGG - Intergenic
1052609210 9:30748653-30748675 CTGGGGAAAAGGGTGGTGGTAGG + Intergenic
1052842125 9:33301055-33301077 CTGAGGAAGAGGATTTAGGAAGG - Intronic
1052917232 9:33932754-33932776 GTGGGGATAAGGAATGAGGATGG - Intronic
1053576294 9:39359268-39359290 CTGGGAAAGAAGATTGAAGATGG - Exonic
1053934860 9:43140102-43140124 CTGGGGAAAAGGATCCAAGCTGG - Intergenic
1054097863 9:60917959-60917981 CTGGGAAAGAAGATTGAAGATGG - Intergenic
1054119265 9:61193589-61193611 CTGGGAAAGAAGATTGAAGATGG - Exonic
1054588488 9:66988973-66988995 CTGGGAAAGAAGATTGAAGATGG + Intergenic
1054844315 9:69776527-69776549 TTGGGGGAAAGGATTGAAGGGGG - Intergenic
1055250452 9:74297172-74297194 ATGGGTAAAATGTTTGAGGAAGG - Intergenic
1055494113 9:76837562-76837584 ATGTGGAAAAGGATAGAGCAGGG + Intronic
1055654108 9:78436560-78436582 GTGGGGAGGAAGATTGAGGAAGG + Intergenic
1055986517 9:82060142-82060164 CTGGGAAAGAGGATTGAAGATGG + Intergenic
1056406881 9:86283090-86283112 CTGGGGAGAAGGGTGGAGGGTGG - Intergenic
1056459369 9:86794776-86794798 GTGGGGAGAAAGAATGAGGAGGG + Intergenic
1056584827 9:87920990-87921012 CTGGGAAAGAGGATTGAAGATGG - Intergenic
1056612054 9:88131950-88131972 CTGGGAAAGAGGATTGAAGATGG + Intergenic
1056655174 9:88503076-88503098 CTGGGGAGAAGGATGGAGCTGGG + Intergenic
1056824951 9:89870584-89870606 CTGGAGAAAAGGAATCAGGCTGG - Intergenic
1057160648 9:92886043-92886065 CTGGGAAAGAGGATTGAAGATGG - Intergenic
1057527099 9:95812508-95812530 CTGGGAAAAAGAAAAGAGGATGG - Intergenic
1057987025 9:99727345-99727367 CTGGGGGTAAGGATGGGGGATGG + Intergenic
1058033908 9:100230056-100230078 CTGGGGTACAGGAATGAGCACGG - Intronic
1058383475 9:104405964-104405986 CTGGGGAAAAGAACTGAGCTAGG - Intergenic
1058424839 9:104867223-104867245 GTGGGGAACAGGAGAGAGGAAGG + Intronic
1058692511 9:107531623-107531645 ATGGGGGAAAGGATTGGGGGTGG - Intergenic
1058954164 9:109930186-109930208 TTGGGGAGAAGGAATGAGAAAGG - Intronic
1061201010 9:129138586-129138608 GTCGGGAAAGGGACTGAGGAGGG - Intronic
1062135563 9:134925636-134925658 CTGGGGAAGAGGTATGTGGATGG + Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187527199 X:20065059-20065081 TGGGGGCAAAGGATTAAGGAAGG - Intronic
1187811059 X:23177378-23177400 CTGAGGATTAGGATTGGGGATGG + Intergenic
1189068941 X:37844338-37844360 CTGGGGAATGGGACTGGGGATGG - Intronic
1189935363 X:46062506-46062528 CTGGGGAGCAGGAATGGGGAAGG - Intergenic
1190143679 X:47870972-47870994 ATGGGCAAATGGATTAAGGAAGG - Intronic
1190552957 X:51603622-51603644 CTGAGGAAATGGATGGGGGAGGG - Intergenic
1190912849 X:54788447-54788469 CTGGGGAAGAGGAGAGAGGATGG - Intronic
1190918105 X:54824923-54824945 CTGGGGAAGAGGAGAGAGGATGG + Intergenic
1190975465 X:55396249-55396271 CTGAGGAAAATGATAGAAGACGG + Intergenic
1191764662 X:64684335-64684357 TTAGGGAAAAGGATTCAGGGTGG + Intergenic
1193138296 X:77997939-77997961 CTGGGGAATAGGGTTAAGGCAGG - Intronic
1193268647 X:79504288-79504310 TTGGGAAAAGAGATTGAGGAAGG + Intergenic
1194291185 X:92073215-92073237 CTGGAAAGAAGCATTGAGGAGGG - Intronic
1195250066 X:103034931-103034953 CTGGGGAAACGTAGTGTGGAGGG - Intergenic
1195429101 X:104768303-104768325 GTGGGGGAAAGGGTTGAGGCAGG - Intronic
1195452045 X:105026042-105026064 CTGCGGAAAAGCATTGATGGGGG + Intronic
1195809702 X:108816222-108816244 TTGGGGAAAAGGTATGTGGATGG - Intergenic
1195993278 X:110704664-110704686 CTGGGGACAGTGATTGAGCAGGG + Intronic
1196511133 X:116513930-116513952 CTGGGGAAAAGGTGGGAGGGGGG - Intergenic
1196761744 X:119207070-119207092 ATGGGGTAAAGGAATGTGGATGG + Intergenic
1197100151 X:122643789-122643811 GTGAGGAACAGGATTTAGGAGGG - Intergenic
1198692493 X:139299668-139299690 CTGGGGGACAGGATAGAGGGTGG - Intergenic
1199617744 X:149671374-149671396 TTGGGGAAGTGGATGGAGGAGGG + Intergenic
1199624898 X:149731875-149731897 TTGGGGAAGTGGATGGAGGAGGG - Intergenic
1199728484 X:150607550-150607572 ATAGGGAAAAGGATAAAGGAAGG - Intronic
1199825742 X:151497922-151497944 TTGGGGAAGAGGATGGGGGAGGG - Intergenic
1199895915 X:152127753-152127775 TTGGGGAAGAGAATGGAGGAGGG - Intergenic
1199951364 X:152708678-152708700 TTGGGGAAGAGGATGGAGGAGGG + Intergenic
1199954011 X:152727902-152727924 TTGGGGAAGAGGATGGAGGAGGG + Intronic
1199955681 X:152740551-152740573 TTGGGGAAGAGGATGGAGAAGGG - Intergenic
1199958319 X:152759783-152759805 TTGGGGAAGAGGATGGAGGAGGG - Intergenic
1200316665 X:155139980-155140002 GTGGGGAAAAGCATGGGGGAAGG + Intronic
1200608693 Y:5297790-5297812 CTGGAAAGAAGCATTGAGGAGGG - Intronic
1200883688 Y:8246644-8246666 TTTGGGAAAAGGATTCTGGAAGG - Intergenic
1200909927 Y:8522933-8522955 ATTGGGAAAAGGATTCATGAGGG + Intergenic