ID: 922326253

View in Genome Browser
Species Human (GRCh38)
Location 1:224531153-224531175
Sequence GACACTGATGTGACTACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 112}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922326253 Original CRISPR GACACTGATGTGACTACAGC TGG (reversed) Intronic
901006187 1:6172705-6172727 GACACTGAGGTGACTCAGGCTGG + Intronic
906475648 1:46167595-46167617 GAACCTGGTGAGACTACAGCTGG - Intronic
918533130 1:185545258-185545280 TACACTGCTGTTAGTACAGCAGG + Intergenic
918928321 1:190816913-190816935 GATACTGATGTACCTACAGCTGG - Intergenic
919777150 1:201201735-201201757 GACCCTGATGTGTCTTAAGCTGG - Exonic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
923892954 1:238235867-238235889 GACTCCCATGTGACAACAGCAGG + Intergenic
1062786378 10:268776-268798 GACACTGGTGTGACTGGAGAGGG + Intergenic
1063076915 10:2726245-2726267 GATGCTGATTTGACTAGAGCAGG - Intergenic
1064842284 10:19607136-19607158 GACACTGATCTGACTTCAATAGG - Intronic
1065820863 10:29523975-29523997 GACACTGATGTGTTCACGGCAGG + Exonic
1067087408 10:43250236-43250258 GACACTGGTTTCACTACAGCTGG + Intronic
1067537093 10:47120373-47120395 GACAATGATATGACTACATGTGG + Intergenic
1067901608 10:50247510-50247532 GACCCTGCTGTGCCTACTGCTGG + Intronic
1068301569 10:55148985-55149007 TACATTGATGTGAATATAGCAGG - Intronic
1069898824 10:71695508-71695530 GACTCTGATGTGACCACGGTAGG + Intronic
1070163370 10:73879756-73879778 GGTACTGATGTGACGACAGGCGG + Intergenic
1074307704 10:112294160-112294182 GTCACTGCTGTAACTCCAGCAGG - Intronic
1076449175 10:130544455-130544477 GACACTGATGTCACTCCTTCAGG + Intergenic
1078616551 11:12871215-12871237 GACACTGCTGTCGCTGCAGCTGG - Intronic
1081075482 11:38667900-38667922 GACACTGAGGGGAATTCAGCCGG - Intergenic
1083259905 11:61517263-61517285 GCCACTGATGAGACTAAAACTGG - Intronic
1088688626 11:112305709-112305731 GGCACTGATGTGACCAGATCTGG + Intergenic
1093241065 12:16675278-16675300 CCCACTGATGTGACTACTGTAGG + Intergenic
1093678410 12:21971235-21971257 GACACTGAAGTGGTTAGAGCAGG - Intergenic
1094013239 12:25831295-25831317 GCCACTCAGGAGACTACAGCAGG - Intergenic
1097383959 12:58927277-58927299 GGCACAACTGTGACTACAGCAGG + Intergenic
1101286321 12:103317006-103317028 GCCACTGTGGTGACTAGAGCTGG - Intronic
1105418101 13:20230925-20230947 GCCACTGCAGTGACTAAAGCTGG - Intronic
1107228077 13:38075327-38075349 GACAAAGATTTGACTACAGGTGG + Intergenic
1107357339 13:39582130-39582152 GAGACTGATGTGTCTACAGGAGG - Intronic
1107458052 13:40573256-40573278 GACACAGATGTGCCCACATCTGG - Intronic
1108452337 13:50579721-50579743 GAGCCTGATGTCACTACATCGGG - Intronic
1109636505 13:65124722-65124744 GGCACTGGTGTGACTATAGAAGG + Intergenic
1110294421 13:73846096-73846118 GATACTGATGTGATAACAGTTGG + Exonic
1114958249 14:27849695-27849717 GGCACTGATGTGATGCCAGCAGG - Intergenic
1115103071 14:29726527-29726549 GACACTTATGTCAATACAGGTGG + Intronic
1118644207 14:67821096-67821118 GACACTGATCTGACTTTTGCAGG + Intronic
1120007453 14:79375437-79375459 GACACTCCTGAGACTTCAGCAGG - Intronic
1122852357 14:104543502-104543524 GACACTGATGAGAATGAAGCCGG + Intronic
1124547113 15:30640115-30640137 GACCCAGATGTAACTATAGCAGG - Intronic
1124780712 15:32630077-32630099 GACCCAGATGTAACTATAGCAGG - Intronic
1126158534 15:45587430-45587452 GACACTCATGTCCCTCCAGCTGG - Exonic
1126158715 15:45588615-45588637 GACAGTGATGTGACAGCAGCGGG - Intronic
1127708102 15:61567204-61567226 GTCACTGATGTCTATACAGCAGG - Intergenic
1128213138 15:65916194-65916216 GCCACTGATGTGGTCACAGCTGG + Exonic
1129623025 15:77166824-77166846 GACACTAATGTGACAAAAGCAGG + Intronic
1131512758 15:93058416-93058438 GGCACTGATGTGAGCAAAGCCGG + Intronic
1135857246 16:26023066-26023088 TACACTGAAGTGAATACAGTTGG - Intronic
1141072988 16:80975046-80975068 GCCCCTGCTGTGACTGCAGCTGG + Exonic
1149796174 17:59522123-59522145 GTCACTCGTGTGACTACATCAGG - Intergenic
1152814160 17:82397656-82397678 GGCACTGCTGTGTCTGCAGCAGG + Intronic
1154939112 18:21093279-21093301 GCAAATGATGTGACTGCAGCTGG - Intronic
1158713442 18:59857677-59857699 GACACTGAGGAGTCTACAGAGGG - Intergenic
1159966597 18:74601106-74601128 GACACTGATGTGTCTGCTTCGGG + Intronic
1160487230 18:79304676-79304698 GGCTCTGAGGTGCCTACAGCAGG - Intronic
925186360 2:1849449-1849471 GACATTGATGTGGCTTCACCAGG - Intronic
925456868 2:4023469-4023491 GACACTGAGCTGGCTGCAGCAGG - Intergenic
925807667 2:7667103-7667125 GAAACTGATGTATCTACAGAAGG - Intergenic
931351768 2:61496878-61496900 GACAATGATGCAACTAAAGCAGG - Exonic
935193109 2:100794056-100794078 GACACAGCTGTGACTCCTGCCGG - Intergenic
935384083 2:102483136-102483158 GACACTGCTGTGACCTCTGCTGG + Intronic
937773149 2:125745648-125745670 GAGACCAATGTGACCACAGCAGG + Intergenic
939791193 2:146579140-146579162 GACACTGGTGTGATTATAGATGG + Intergenic
945301891 2:208222154-208222176 GAGACTGGTGTTACTACAGGAGG - Intergenic
948537498 2:238657057-238657079 GACACTGATGTGTCTGCTGCGGG + Intergenic
1170753207 20:19171157-19171179 GACAAGGATGTAAGTACAGCTGG - Intergenic
1173170466 20:40719376-40719398 GACACTCATGTGACAACTGTGGG - Intergenic
1174486320 20:50863668-50863690 GACTCTGATGTGACAGCAGTTGG + Intronic
1175647378 20:60686070-60686092 GACAATGATGACAGTACAGCAGG - Intergenic
1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG + Intronic
1178876592 21:36419003-36419025 GACACTGAAGTGACTTCACTTGG - Exonic
1182971990 22:34587858-34587880 GAAACTGTTGTGAGTGCAGCTGG - Intergenic
950668799 3:14513050-14513072 GACTCTGGTCTGACTAGAGCAGG - Intronic
952738917 3:36716795-36716817 GAGAAGGGTGTGACTACAGCAGG + Intronic
952967563 3:38630713-38630735 GCCTCTGCTGTGACAACAGCTGG - Intronic
954735004 3:52699991-52700013 GACACTCTAGTGACTAGAGCAGG + Intronic
955403662 3:58611394-58611416 GTCACTGGTGTGGCTTCAGCAGG + Intronic
962130387 3:132667140-132667162 GATACTGATGTTACTACTTCAGG - Intronic
962915909 3:139903111-139903133 GACATAGATATGACTACATCAGG - Intergenic
966805073 3:183800747-183800769 TACAGTGATGTGACTAGAGGTGG + Intronic
968276723 3:197445954-197445976 GACCCTGATGCAACCACAGCGGG + Intergenic
969297623 4:6279110-6279132 GTCACTGATGTGGCCAAAGCAGG + Intronic
969403315 4:6971664-6971686 GATGCTGATGTGACTACTCCGGG - Intronic
972777908 4:42260367-42260389 GACACTGCTGTAACTACCACAGG + Intergenic
978649017 4:110977965-110977987 GACACTGAGGTGACTATAGTTGG + Intergenic
979633057 4:122924681-122924703 GACACTGAAGAGACTATAGATGG - Intronic
981823381 4:148912200-148912222 GACACTAGTGTGAATACTGCTGG - Intergenic
986981515 5:13453322-13453344 TTCACTAATGTGACTACACCTGG - Intergenic
988478829 5:31612288-31612310 TACAGTGAGGTGAATACAGCAGG - Intergenic
990902836 5:60771773-60771795 GAAACTGATCTCACTAGAGCAGG - Intronic
990998648 5:61759290-61759312 GACAGGGGTGTGACTACAACAGG - Intergenic
992400481 5:76406765-76406787 AACACTTAAGTGACTACAGTGGG + Intronic
993617245 5:90128566-90128588 CACACTGATGAGACGAGAGCAGG + Intergenic
997439304 5:133898145-133898167 AACACTGATGTCACCAGAGCAGG + Intergenic
1003477268 6:6494997-6495019 GCCAGAGGTGTGACTACAGCCGG - Intergenic
1007082834 6:39120784-39120806 GATAATGATGTGTCTAGAGCAGG + Intergenic
1007749768 6:44064730-44064752 GACAATGAAGTGACCACAGGCGG + Intergenic
1011177542 6:84581308-84581330 GACACTGATGGGTCTGTAGCAGG + Intergenic
1019504718 7:1385222-1385244 GACACAGGTGTGGCTACAGCAGG + Intergenic
1020226498 7:6284564-6284586 GAGAGTGGTGTGACTGCAGCAGG + Intergenic
1029854696 7:103503735-103503757 GACACTGCTGTTAATACAGTGGG + Intronic
1031592377 7:123609446-123609468 GACACTGATGTGACAGGTGCTGG + Intronic
1034219947 7:149436452-149436474 GACACTGATGGGGCAACAGGTGG - Intronic
1037710313 8:21350351-21350373 GACTCAGCTGTGAGTACAGCAGG + Intergenic
1038067641 8:23979759-23979781 GACACTCATATAACTGCAGCTGG - Intergenic
1038382721 8:27112138-27112160 GACAATGATGTGAGTTCAACAGG + Intergenic
1038604498 8:28985624-28985646 GGCAGTGATCTGAGTACAGCTGG - Intronic
1042482424 8:69319281-69319303 GAGACAGGTGTGACTACAGAAGG - Intergenic
1044537204 8:93370883-93370905 GACACAGATGTGGCTACACAGGG + Intergenic
1048295914 8:133213087-133213109 GCCTCTACTGTGACTACAGCGGG + Exonic
1049037084 8:140085189-140085211 GTCACTCCTGTAACTACAGCAGG - Intronic
1051346702 9:16157542-16157564 GAAGCTGATTTCACTACAGCTGG - Intergenic
1053678783 9:40465216-40465238 GGCACTGATGTGATGCCAGCAGG - Intergenic
1053928768 9:43093569-43093591 GGCACTGATGTGATGCCAGCAGG - Intergenic
1054284940 9:63159726-63159748 GGCACTGATGTGATGCCAGCAGG + Intergenic
1054291861 9:63300754-63300776 GGCACTGATGTGATGCCAGCAGG - Intergenic
1054389879 9:64605297-64605319 GGCACTGATGTGATGCCAGCAGG - Intergenic
1054505835 9:65911079-65911101 GGCACTGATGTGATGCCAGCAGG + Intergenic
1057422744 9:94925673-94925695 GACACTGATGTGCACACTGCTGG - Intronic
1058822256 9:108743630-108743652 ACCACAGATGTGACTACAGGGGG + Intergenic
1186816120 X:13239653-13239675 GACACAGAAGTGACTTCAGCAGG + Intergenic
1190939558 X:55027394-55027416 GACAGAGAGGTGACTAAAGCAGG + Intronic