ID: 922326281

View in Genome Browser
Species Human (GRCh38)
Location 1:224531304-224531326
Sequence TGGAACTCTATGGGGAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 182}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922326270_922326281 11 Left 922326270 1:224531270-224531292 CCTGCCCTCATGAAGCCTGGAAC 0: 1
1: 0
2: 4
3: 23
4: 258
Right 922326281 1:224531304-224531326 TGGAACTCTATGGGGAAAACAGG 0: 1
1: 0
2: 3
3: 22
4: 182
922326271_922326281 7 Left 922326271 1:224531274-224531296 CCCTCATGAAGCCTGGAACTCCA 0: 1
1: 0
2: 2
3: 29
4: 217
Right 922326281 1:224531304-224531326 TGGAACTCTATGGGGAAAACAGG 0: 1
1: 0
2: 3
3: 22
4: 182
922326269_922326281 12 Left 922326269 1:224531269-224531291 CCCTGCCCTCATGAAGCCTGGAA 0: 1
1: 2
2: 4
3: 52
4: 418
Right 922326281 1:224531304-224531326 TGGAACTCTATGGGGAAAACAGG 0: 1
1: 0
2: 3
3: 22
4: 182
922326272_922326281 6 Left 922326272 1:224531275-224531297 CCTCATGAAGCCTGGAACTCCAT 0: 1
1: 0
2: 1
3: 7
4: 165
Right 922326281 1:224531304-224531326 TGGAACTCTATGGGGAAAACAGG 0: 1
1: 0
2: 3
3: 22
4: 182
922326275_922326281 -4 Left 922326275 1:224531285-224531307 CCTGGAACTCCATGGAGCCTGGA 0: 1
1: 0
2: 1
3: 21
4: 249
Right 922326281 1:224531304-224531326 TGGAACTCTATGGGGAAAACAGG 0: 1
1: 0
2: 3
3: 22
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922326281 Original CRISPR TGGAACTCTATGGGGAAAAC AGG Intronic
900706824 1:4086141-4086163 TGGAAGGATATGGGGAAAAAGGG + Intergenic
900733220 1:4276629-4276651 TGGACCTCTATGGGCAAAAAGGG - Intergenic
901285303 1:8073916-8073938 TGGAACTCTGTTGAGAAAAAGGG - Intergenic
902202317 1:14843055-14843077 TGCAACTGTATTGGGAAGACTGG - Intronic
904368320 1:30032414-30032436 TGCAACTACATGTGGAAAACAGG - Intergenic
904880679 1:33694461-33694483 GAGAACAGTATGGGGAAAACTGG - Intronic
906560128 1:46750358-46750380 TGGAAGTCTCTGGGGAACCCAGG - Intergenic
911059306 1:93733975-93733997 TGGATTTCTATAGGGAGAACTGG + Intronic
911391041 1:97243771-97243793 TGGGACTCTCTTGGGCAAACTGG - Intronic
915727257 1:158026481-158026503 TGGGACGCTATGTGGAAAAGTGG + Intronic
915888159 1:159745615-159745637 TTGAAATTTATGGAGAAAACTGG - Intergenic
916349152 1:163829399-163829421 TGGAAAATGATGGGGAAAACAGG - Intergenic
917103529 1:171469584-171469606 TGGAACTCAGTAGGGAAAAAAGG + Intergenic
919632973 1:199977004-199977026 TGTAAATATGTGGGGAAAACTGG - Intergenic
921466317 1:215492451-215492473 TGGAAGTCTAGGAGGAAAAATGG + Intergenic
922326281 1:224531304-224531326 TGGAACTCTATGGGGAAAACAGG + Intronic
922759621 1:228119241-228119263 TGGAGCTCCTTGGGAAAAACAGG - Intergenic
922856464 1:228779204-228779226 AGGAAGTCCATGGGGAAACCTGG - Intergenic
923900587 1:238322103-238322125 TGAGACTGTCTGGGGAAAACTGG + Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
1063367252 10:5498905-5498927 TGGGACTCTCCGGGGAAACCTGG - Exonic
1065424655 10:25587049-25587071 TGTAACCATATGTGGAAAACAGG + Intronic
1066791410 10:39068486-39068508 TGGAAGCCTATGGGGAAAAAAGG + Intergenic
1069143745 10:64862558-64862580 TTGAACTCAAGGGGGAAAAAGGG - Intergenic
1069623554 10:69852783-69852805 TGGACCTCGCTGGGCAAAACTGG + Intronic
1069707249 10:70466764-70466786 TGGAACACTCTGGGGAGAAGGGG + Intergenic
1070181832 10:74021513-74021535 GGGAACTCTCTGGAGTAAACAGG + Intronic
1070315321 10:75304947-75304969 TGGAACTATGAGGGGAAAAAAGG + Intergenic
1071787177 10:88914637-88914659 TGGAATACTCTGTGGAAAACTGG + Exonic
1072442819 10:95471867-95471889 TGGAGCTTTATGAGGATAACAGG - Intronic
1072517620 10:96201284-96201306 TGGAACTACATGAGGAAAATTGG - Intronic
1078340381 11:10494446-10494468 TGGAACTGTATGGTTAAAAATGG + Intronic
1079178779 11:18169802-18169824 GGGAAATTTATGAGGAAAACAGG - Intronic
1079712323 11:23701299-23701321 TGGAAACATCTGGGGAAAACAGG - Intergenic
1080552152 11:33382043-33382065 TGGAATTCTAGGGCGATAACAGG + Intergenic
1080657194 11:34267255-34267277 TGGAATTCCATGGAGAAACCTGG + Intronic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1081564728 11:44251050-44251072 TGGAACTATATCCAGAAAACAGG - Intergenic
1081595029 11:44453154-44453176 TGAAACTCTATGGGGAGCAGCGG + Intergenic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083188089 11:61029483-61029505 TGAAACTCTATGGCAAAAAAAGG + Intergenic
1084878124 11:72149122-72149144 TGGGACTCCTTGGGGAAAACAGG + Intergenic
1086153781 11:83643298-83643320 TGAAACTCTGTGGGGGAAAATGG + Intronic
1087863913 11:103199413-103199435 TGGAAATCTTTGGAGAAAACAGG - Exonic
1087952708 11:104243581-104243603 TGGAACTCTATGAAGTAAATGGG - Intergenic
1089053063 11:115562717-115562739 TAGAACTCAAGGGAGAAAACTGG + Intergenic
1090201519 11:124861258-124861280 TGGAACCCTGTGGGGAAAGGGGG + Intergenic
1091589698 12:1835943-1835965 TGGCACCCTCTGGGGAAAGCAGG + Exonic
1091594722 12:1869544-1869566 TGGAACTCAAGAGGAAAAACAGG - Intronic
1093363155 12:18257227-18257249 TGAAACTCTATTGTGGAAACAGG + Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1100075509 12:90778032-90778054 TGGAACTCGAAGGAGAAAAGTGG + Intergenic
1102995232 12:117344788-117344810 TGCATTTATATGGGGAAAACAGG + Intronic
1103617672 12:122165049-122165071 TGAGAATCTGTGGGGAAAACAGG + Intergenic
1104611903 12:130235604-130235626 AAGAACTCTTTGGAGAAAACAGG + Intergenic
1105773235 13:23632697-23632719 TGGGACTCTGTGGGGAGACCTGG - Intronic
1107765257 13:43727514-43727536 TGGCTTTCTATGAGGAAAACTGG + Intronic
1108343254 13:49518493-49518515 TGGAACACTATGGGAAAATTAGG - Intronic
1109378966 13:61533356-61533378 TTGAAGTGAATGGGGAAAACTGG + Intergenic
1109469546 13:62787785-62787807 TGGAACTCTTGGGGGAAAACAGG + Intergenic
1110839813 13:80128956-80128978 TGGAAATCTTAGGGGAAAATGGG + Intergenic
1111567971 13:90041710-90041732 TGGAATTCTCTGTGGATAACGGG + Intergenic
1111875174 13:93884223-93884245 TAAAATTCTATGGGGAAAAGAGG - Intronic
1112126927 13:96478485-96478507 TGGAACTCTATGGAGGATAATGG - Intronic
1113242174 13:108350149-108350171 TTCAACCTTATGGGGAAAACGGG + Intergenic
1116204979 14:41853657-41853679 TGGAACTCAGAGGGGAAATCAGG + Intronic
1119305512 14:73604990-73605012 TGGGACTCATTGGGAAAAACAGG - Intergenic
1119669153 14:76505721-76505743 TGGAACTCTGGGTGGAACACAGG - Intergenic
1119669569 14:76508215-76508237 TGGACCTCTAGGTGGAACACAGG + Intergenic
1120518588 14:85499665-85499687 AAGAACACTATGGGGAAAACTGG + Intergenic
1122122987 14:99564480-99564502 TGCAACTCAATAGGGAAATCAGG - Intronic
1126085477 15:45007295-45007317 TGGAACTCTTAGGGAAAAACAGG + Intergenic
1126205300 15:46038503-46038525 TGGCTCCCTATGGGGAAAATGGG - Intergenic
1126627615 15:50699955-50699977 TGGAACTCTTTTGAGACAACTGG + Intergenic
1128327369 15:66733800-66733822 TGGAAGGCAATGGAGAAAACTGG + Intronic
1130955919 15:88627244-88627266 AGGAACTCTATGGAGGGAACTGG - Intronic
1133443216 16:5837697-5837719 TGGAGCTCTAAAGGTAAAACAGG - Intergenic
1133499227 16:6349781-6349803 TGGAAAACCATGGGGAAAAATGG - Intronic
1135048955 16:19177027-19177049 TGGATATCTAGGGGGCAAACAGG - Intronic
1138604566 16:58080322-58080344 TGTAACACTGAGGGGAAAACAGG - Intergenic
1140793937 16:78417821-78417843 GGGCACCCTATGTGGAAAACAGG + Intronic
1153500455 18:5744109-5744131 TGGGACTCTCTGGGGCACACTGG + Intergenic
1155548438 18:26939723-26939745 TGGAACTTCACGGGGGAAACAGG + Intronic
1155590157 18:27418843-27418865 TGGTTCTCTATGGGAAAAAAGGG - Intergenic
1156296973 18:35801346-35801368 GGGAACCCTATGGGGATGACTGG + Intergenic
1157644541 18:49253957-49253979 TGGACCTCTATGGGGATCACAGG - Intronic
1159273823 18:66189779-66189801 TGGAAAGATATGGGGAAATCTGG - Intergenic
1162189775 19:8935816-8935838 TGGACTACTATGGGAAAAACTGG + Exonic
1164338026 19:24351810-24351832 TTGAAGTCTATGGTGAAAAACGG + Intergenic
1166064509 19:40349351-40349373 TGGCTCCTTATGGGGAAAACTGG - Intronic
1166357299 19:42234711-42234733 TGGTGCTGTATGGGGAAAGCTGG - Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166900910 19:46062081-46062103 TGGAACTCCTTGGGAAAAACAGG - Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
927599450 2:24427882-24427904 TGGAACACTGTGGGCAAAATGGG - Intergenic
929158921 2:38812406-38812428 TGAAACTCTCTGGGGGAAAATGG + Intronic
929190272 2:39133545-39133567 TGGAAATAGATGGGGAAAAAAGG - Intergenic
929297085 2:40260418-40260440 TGGAAGCCTATGGGAAAAAAAGG - Intronic
931812396 2:65867468-65867490 TGGAGCTCTTTGGGGAAGAGTGG - Intergenic
931946660 2:67316576-67316598 TGGAACTCTACTGGGAAAAAAGG + Intergenic
932062615 2:68522962-68522984 TGGAATCCTAAGGGAAAAACTGG + Intronic
932683671 2:73849466-73849488 TGGAATTCTCTGTGGAAAACTGG + Exonic
934084900 2:88501902-88501924 TGGAAATTTATGGGGAAAACAGG + Intergenic
935603775 2:104948944-104948966 TGGAAATCTCTGGGGAGAACAGG + Intergenic
936884313 2:117291700-117291722 TGCAACTATATGGGTGAAACTGG + Intergenic
939175191 2:138740043-138740065 TGGAACGCCATTGTGAAAACTGG - Intronic
939828432 2:147044040-147044062 TGGAAACATATGGGGAAAAGGGG + Intergenic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
943362134 2:186932354-186932376 TGGAAATCTAAGGAGAAATCAGG + Intergenic
948278734 2:236730147-236730169 GTGGACTCTGTGGGGAAAACAGG - Intergenic
1168729705 20:65890-65912 TGGAATTCAATGGAGAAGACTGG - Intergenic
1168755805 20:316805-316827 AGGAATTCATTGGGGAAAACAGG + Intergenic
1170074635 20:12406116-12406138 TGGATCTTTCTGGGGAGAACAGG + Intergenic
1175001641 20:55635538-55635560 TGTATCTCAATGTGGAAAACAGG - Intergenic
1175619565 20:60431815-60431837 TGGAACTCTATTGAGTAAAGAGG + Intergenic
1178935421 21:36857720-36857742 TGGGCTTTTATGGGGAAAACAGG - Intronic
1179391943 21:41002089-41002111 TGTAAATCTATGGTGAAAGCTGG + Intergenic
1182575073 22:31267554-31267576 TGGAACTGCATTGGGAGAACTGG - Intronic
1185269797 22:49924114-49924136 TGGAACTCTTTGGGAGAAACTGG - Intronic
1203304875 22_KI270736v1_random:102202-102224 TGGAGTTCTATGGAGAAAAATGG + Intergenic
949330247 3:2914722-2914744 TGGAAGGGTTTGGGGAAAACTGG - Intronic
950086063 3:10258793-10258815 TGGATCTCTTTGGGGAATGCAGG - Intronic
953022287 3:39122490-39122512 TGGAACTCTTTGGGGAAAGCTGG - Intronic
953492197 3:43361844-43361866 TGGGACTCTCCGGTGAAAACAGG + Intronic
954303165 3:49711930-49711952 TGGAAGTCTGTGTGGAAAAGTGG - Intronic
954614453 3:51962468-51962490 CAGAACCCTATGGGGAAAACAGG + Intronic
956952908 3:74302801-74302823 ATGAACTCTGTTGGGAAAACAGG + Exonic
958911279 3:99996770-99996792 GAGAACAGTATGGGGAAAACCGG + Intronic
959171217 3:102846959-102846981 TGGTAATTTATGGAGAAAACAGG + Intergenic
960029045 3:113039487-113039509 TTGAACAAGATGGGGAAAACAGG - Intergenic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
962020852 3:131500316-131500338 TGGAACTGTATGGTGAAGAAAGG - Intronic
963192537 3:142488526-142488548 AAGAACACTATTGGGAAAACTGG + Intronic
965098385 3:164264955-164264977 TGGAAAGCTATGAGGAAATCTGG - Intergenic
965469081 3:169067712-169067734 TGTAACTGTATTGGGAAGACGGG + Intergenic
967538393 3:190634633-190634655 TGAAAGCCTATGGGTAAAACTGG + Intronic
970378822 4:15484714-15484736 TGAAACTCTATTGGGGAAAGTGG - Intronic
971318629 4:25587527-25587549 AGGAAGTCTAAGGTGAAAACAGG + Intergenic
971788228 4:31133150-31133172 TCTAACTCAATGGGGAAAAAAGG + Intronic
971797802 4:31251014-31251036 TGCAACAGTATGGGGGAAACTGG + Intergenic
971934203 4:33126523-33126545 TAGAATGCTATGGGGAAAAAAGG - Intergenic
974297377 4:60019156-60019178 TGGGACTCTATGGGAGAATCGGG + Intergenic
975368829 4:73560263-73560285 TGGACTTCTGGGGGGAAAACTGG - Intergenic
975741798 4:77436269-77436291 AGGACCTTGATGGGGAAAACTGG - Intergenic
979586380 4:122423242-122423264 AGGAAATTAATGGGGAAAACTGG + Intronic
980792961 4:137643356-137643378 TGTGCTTCTATGGGGAAAACTGG - Intergenic
981770348 4:148300982-148301004 TGGGGCTCCATGAGGAAAACAGG - Intronic
983005661 4:162481880-162481902 TGGAACTCTATGGATATAATAGG + Intergenic
984566793 4:181340693-181340715 TGGCACTTCATGGGGTAAACTGG - Intergenic
986182626 5:5407642-5407664 TGGAACACTATGGGGATGGCAGG + Intergenic
986971539 5:13342937-13342959 TGTAACTATGTGTGGAAAACAGG - Intergenic
989838323 5:46025077-46025099 TTGAAGTCTATGGTGAAAAAAGG + Intergenic
990123904 5:52490879-52490901 GGAAACTCTATGGATAAAACAGG - Intergenic
991055126 5:62311868-62311890 AGGAACTCTATGAGGTAAGCAGG + Intronic
991153170 5:63396474-63396496 TGGAAGGCTTTGTGGAAAACAGG - Intergenic
991273562 5:64816102-64816124 TAGAGCTCTATGGAGAAAACAGG - Intronic
994431375 5:99666440-99666462 TGTAGCTCAATGGGGAAAAAAGG - Intergenic
1003493304 6:6642263-6642285 TGCAACTGTATGGGGAGAACTGG + Intronic
1005938997 6:30546917-30546939 TGGAATGTTTTGGGGAAAACTGG - Intronic
1006785818 6:36666433-36666455 TGGAACAGTCTGGGGCAAACTGG + Intergenic
1008697731 6:54060707-54060729 TGGAACTATATAGAGAAAAAAGG + Intronic
1009716783 6:67408063-67408085 TGGAACTCCTTGGGAAAAACAGG + Intergenic
1010719146 6:79262714-79262736 TGGGACTCCTTGGGCAAAACAGG - Intergenic
1010989898 6:82468963-82468985 TGTAACTGTGTAGGGAAAACAGG - Intergenic
1014219205 6:118783048-118783070 GGAAACCCTCTGGGGAAAACAGG + Intergenic
1014715325 6:124858172-124858194 TGCAATTCTATGTGGAAAAAAGG - Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1017625262 6:156341434-156341456 TGGATGTTTCTGGGGAAAACTGG + Intergenic
1019029884 6:169000869-169000891 TGAGACCCCATGGGGAAAACAGG + Intergenic
1019113745 6:169739477-169739499 TGGAAGTCTGTGGGGAGAATGGG + Intergenic
1019792345 7:3024263-3024285 TGGAAAATTATGGGGACAACAGG + Intronic
1020350549 7:7214286-7214308 TGGAACTCCTTGGGAAAAACAGG - Intronic
1023457366 7:40355034-40355056 TGGAACTCTATGGAGAAGGCAGG - Intronic
1023488419 7:40711620-40711642 TGGAGGTCTATGGGGAGGACTGG - Intronic
1024968029 7:55042532-55042554 TGGAACTATAAGTAGAAAACAGG - Intronic
1025534341 7:61929509-61929531 TTGAGCCCTATGGGGAAAAATGG + Intergenic
1026879933 7:73901764-73901786 GGCAACTCAATGGAGAAAACGGG - Intergenic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1032947753 7:136871247-136871269 AGGGAGTCTCTGGGGAAAACGGG + Intronic
1034479251 7:151307296-151307318 TCCGACTCTATGGGGAACACAGG - Intergenic
1037449598 8:19003535-19003557 TGAAACTCAATGGGGAGAAAAGG - Intronic
1038024796 8:23578773-23578795 TGGAGGGCTATGGAGAAAACAGG - Intergenic
1040126657 8:43745489-43745511 TTGAGCCCTATGGGGAAAAACGG + Intergenic
1042873199 8:73416678-73416700 TGGAAGGCTGTGGGGAAACCTGG - Intergenic
1047581565 8:126222099-126222121 TGGGATTCCATGAGGAAAACAGG + Intergenic
1050401601 9:5262007-5262029 TGGAACTCCTTGGGGAAAAGAGG - Intergenic
1051714262 9:19964967-19964989 TTGAACTCCATGGGGAAGACAGG - Intergenic
1051947589 9:22589148-22589170 AGGAACACTGTAGGGAAAACTGG + Intergenic
1056432199 9:86539081-86539103 TGAAACTCTTAGGAGAAAACAGG + Intergenic
1057780672 9:98047458-98047480 TGGGACTCCTTGGGTAAAACAGG + Intergenic
1057789894 9:98118009-98118031 TGGAACTCCAAGGTGAAAAGGGG - Intronic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1060859756 9:126944773-126944795 AGGGACACTGTGGGGAAAACTGG - Intronic
1188647181 X:32583763-32583785 TGGATCTATATGGGAAAAAATGG + Intronic
1189650056 X:43178921-43178943 TGGCACTCCATAAGGAAAACAGG - Intergenic
1191577704 X:62724781-62724803 TTGAAACCTATGGGGAAAAACGG - Intergenic
1191579965 X:62749859-62749881 TGGAGGTCTATGGTGAAAAATGG - Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1193983682 X:88214300-88214322 TGCAATTCTATGGGGAACAGTGG + Intergenic
1194131474 X:90087737-90087759 TGGGACTCCATGGGAAAAACAGG - Intergenic
1195926756 X:110033808-110033830 TGGAAGTATAAGGGGAAAACAGG - Intronic
1199021021 X:142878956-142878978 GAGAACAATATGGGGAAAACCGG - Intergenic
1201054255 Y:9973014-9973036 TGTGACTCTCTTGGGAAAACTGG + Intergenic
1202607525 Y:26651694-26651716 TGGAACTCTATGGAGAGGAGTGG + Intergenic
1202608730 Y:26661097-26661119 TGGAACTCTATGGAGAGGAGTGG + Intergenic
1202609098 Y:26663945-26663967 TGGAACTCTATGGAGAGGAGTGG + Intergenic
1202609478 Y:26666798-26666820 TGGAACTCTATGGAGAGGAGTGG + Intergenic