ID: 922331262

View in Genome Browser
Species Human (GRCh38)
Location 1:224578543-224578565
Sequence GAGTCTCTCATTTTGGTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 141}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922331256_922331262 16 Left 922331256 1:224578504-224578526 CCCCTGTATTCCGTATCCATTGT 0: 1
1: 0
2: 1
3: 4
4: 79
Right 922331262 1:224578543-224578565 GAGTCTCTCATTTTGGTGACTGG 0: 1
1: 0
2: 2
3: 9
4: 141
922331258_922331262 14 Left 922331258 1:224578506-224578528 CCTGTATTCCGTATCCATTGTCT 0: 1
1: 0
2: 1
3: 5
4: 66
Right 922331262 1:224578543-224578565 GAGTCTCTCATTTTGGTGACTGG 0: 1
1: 0
2: 2
3: 9
4: 141
922331260_922331262 0 Left 922331260 1:224578520-224578542 CCATTGTCTTTCTCTTTCTTAGT 0: 1
1: 0
2: 19
3: 215
4: 1929
Right 922331262 1:224578543-224578565 GAGTCTCTCATTTTGGTGACTGG 0: 1
1: 0
2: 2
3: 9
4: 141
922331257_922331262 15 Left 922331257 1:224578505-224578527 CCCTGTATTCCGTATCCATTGTC 0: 1
1: 0
2: 1
3: 5
4: 80
Right 922331262 1:224578543-224578565 GAGTCTCTCATTTTGGTGACTGG 0: 1
1: 0
2: 2
3: 9
4: 141
922331259_922331262 6 Left 922331259 1:224578514-224578536 CCGTATCCATTGTCTTTCTCTTT 0: 1
1: 0
2: 4
3: 91
4: 1012
Right 922331262 1:224578543-224578565 GAGTCTCTCATTTTGGTGACTGG 0: 1
1: 0
2: 2
3: 9
4: 141
922331255_922331262 29 Left 922331255 1:224578491-224578513 CCTTGTTTTTGATCCCCTGTATT 0: 1
1: 0
2: 2
3: 23
4: 260
Right 922331262 1:224578543-224578565 GAGTCTCTCATTTTGGTGACTGG 0: 1
1: 0
2: 2
3: 9
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922331262 Original CRISPR GAGTCTCTCATTTTGGTGAC TGG Intronic
903830448 1:26171173-26171195 GAGTCTCTCTTCTTCGTTACGGG + Exonic
905585900 1:39118088-39118110 GAGCCTCCCATTTCAGTGACAGG - Intronic
909451231 1:75799770-75799792 AGGTCTCTGGTTTTGGTGACTGG + Intronic
910267687 1:85356823-85356845 GAGTCTCTTCTTTTGGTCAAAGG - Intronic
911397974 1:97335989-97336011 AAGTCTCTCTTTGAGGTGACTGG + Intronic
913702845 1:121390216-121390238 GAGTTCATCATTTTTGTGACTGG + Exonic
914002728 1:143706036-143706058 GAGTCTCTTTTTCTGTTGACTGG - Intergenic
914043408 1:144070720-144070742 GAGTTCATCATTTTTGTGACTGG + Intergenic
914134678 1:144889775-144889797 GAGTTCATCATTTTTGTGACTGG - Exonic
914770430 1:150679411-150679433 GGGTCTTTCATTTTGGTAATAGG - Intronic
914909764 1:151775482-151775504 GACTCACTCATTGTGCTGACTGG - Exonic
920490276 1:206408957-206408979 GAGTTCATCATTTTTGTGACTGG + Intronic
920935700 1:210432448-210432470 GAGTCTTTCATTTTGGCAAATGG + Intronic
921447296 1:215261726-215261748 GAGCTTCTCATTTTGGGGACAGG - Intergenic
921491335 1:215779785-215779807 GAGTCTGTCATTGTGGTTAGGGG - Intronic
922331262 1:224578543-224578565 GAGTCTCTCATTTTGGTGACTGG + Intronic
923669684 1:236029765-236029787 GAGACTGTCACTTTGCTGACTGG + Intronic
924422225 1:243920009-243920031 GTCTCTCTCATTATGGTAACTGG - Intergenic
924788674 1:247222870-247222892 CAGTCTCTCAATTTTGAGACTGG - Intergenic
1063526680 10:6793238-6793260 AAGTGTCCCAGTTTGGTGACGGG - Intergenic
1065177035 10:23087799-23087821 GAGTCTGTCGTTTTGGTGACTGG - Intergenic
1067035801 10:42915726-42915748 GAGTCTCCCATGTTTGTCACAGG + Intergenic
1069189130 10:65465790-65465812 GCCTCTCTCATTTATGTGACTGG + Intergenic
1069841698 10:71343811-71343833 TAGTCTTGCATTTTGGTGATAGG + Intronic
1069857424 10:71449018-71449040 CAGTCACCCATTTTGGTGACTGG - Intronic
1072288602 10:93941197-93941219 AAGTCTCTCATTTACGTGACCGG + Intronic
1074264221 10:111885114-111885136 GAGTTTCTGATTTTGGTGTTTGG + Intergenic
1076084534 10:127614704-127614726 CAGTTTCCCATTTTGTTGACGGG - Intergenic
1079370803 11:19850374-19850396 GCGTCTGTCATTTTGGTGACTGG + Intronic
1083572209 11:63766822-63766844 GAGACTCCCATTTTGGGGATGGG + Intronic
1097668798 12:62512653-62512675 GAATCTGTCATTCTGGTGTCTGG + Intronic
1097875504 12:64639314-64639336 GAGTCTCTCATTGTGGTCCTAGG - Intronic
1098522491 12:71449258-71449280 GAGACCCCAATTTTGGTGACTGG - Intronic
1098929895 12:76399139-76399161 TAGACTCTCATTTTAGTGAGGGG + Intronic
1098930514 12:76407013-76407035 AATACTCTCATTTTGGTCACAGG - Intronic
1102642316 12:114378011-114378033 GAGGCTCTACTTTTGGTGACTGG - Intronic
1102954458 12:117050580-117050602 GAGTCCCTCATCTGGGTGTCAGG - Intronic
1105899111 13:24741387-24741409 GAGTCACTCATTCTGGTGGGAGG - Intergenic
1106114741 13:26807498-26807520 GAGTCACTCATATTAGTGACAGG + Intergenic
1108323112 13:49305600-49305622 GAATCTCTCGCTCTGGTGACGGG + Intergenic
1109202426 13:59445769-59445791 GAAGCTCACATTTTGGTGAGAGG + Intergenic
1110608722 13:77464665-77464687 CAGTCTATCAATTTGGTGAATGG + Intergenic
1110716066 13:78705581-78705603 GAGACTCTCATTTTCTTCACTGG + Intergenic
1110955703 13:81549950-81549972 GAGTCTATCATTCTGGGGTCTGG + Intergenic
1113336149 13:109378088-109378110 GAATGTATCATTTTGGGGACAGG - Intergenic
1113945601 13:114042508-114042530 GAGTTTCTCACTTCAGTGACTGG - Intronic
1115428621 14:33290064-33290086 GAGTCTATCATTTTCCTGATGGG - Intronic
1115556527 14:34548749-34548771 GAGTCTCTGCTTTTTGAGACAGG + Intergenic
1116133499 14:40891067-40891089 GATTCTATCATTCTGGTGTCTGG + Intergenic
1118940256 14:70328442-70328464 GAGTTTGTCATTTTTTTGACTGG - Intronic
1119640193 14:76308978-76309000 GAGACTCCCATTCTGATGACTGG - Intergenic
1124043115 15:26123359-26123381 GGTTCTCTGATTTTGGAGACGGG + Intergenic
1129786806 15:78315164-78315186 GAGTCTTTCATTCTGCTGAAAGG + Intergenic
1131953555 15:97706791-97706813 GAGTCTCTCACTCTGTTGCCAGG - Intergenic
1132586835 16:709255-709277 GAGTCTCCCATCTAGGTGGCTGG + Intronic
1141060497 16:80862806-80862828 AAGTCTGTCATTCTGGTGATTGG - Intergenic
1141633870 16:85303575-85303597 GTGACTCCCATTTTGTTGACAGG + Intergenic
1142733688 17:1880595-1880617 GAGTCTCTGATTTCGGTGGACGG + Exonic
1144994651 17:19259208-19259230 GTGTTTCTCCTTTTGGTGATAGG + Intronic
1146485176 17:33236919-33236941 TTGTCTCACATTTTGGTGCCAGG - Intronic
1149349320 17:55771394-55771416 GTGTCTGTAATTTTGGTCACTGG + Intronic
1150865246 17:68842332-68842354 GTGCCTCACATTTTGATGACAGG - Intergenic
1154016244 18:10620454-10620476 GGGTGTCCCATTTTGGTGAGTGG - Intergenic
1154189271 18:12215196-12215218 GGGTGTCCCATTTTGGTGAGTGG + Intergenic
1157638889 18:49191940-49191962 CATTCACTCATTTTGGAGACGGG + Intronic
1157698064 18:49739469-49739491 GAGTCTGTCATTTTGGAGCTAGG + Intergenic
1158722710 18:59939792-59939814 AAAGCTCTCATTTTGGTAACAGG - Intergenic
1160604895 18:80042739-80042761 GAGTCTCTCACTCTGCTGCCTGG - Intronic
1163065822 19:14794011-14794033 GTGTCTCTCATATTGATGAGTGG + Intronic
1163574318 19:18101634-18101656 GAGTCTCTCTTTTTTTAGACAGG + Intronic
1165747315 19:38237609-38237631 GAGTGTCTCATTTTGTTGCCCGG + Intergenic
1165794588 19:38511596-38511618 GAGTCTCTCTCTTTGGTAAGTGG + Exonic
926766244 2:16325114-16325136 GAGTCTGACATTTTGGACACTGG + Intergenic
927632905 2:24789668-24789690 CAGCCTCTCATTTTGCTCACTGG - Intergenic
929291137 2:40193322-40193344 GAGTATCCAATTTTTGTGACTGG + Intronic
935382460 2:102466416-102466438 GTGTGTCTGATTTTGGTGATAGG + Intergenic
936160957 2:110083945-110083967 GTGTCTCTCCTTTTGTTGCCTGG - Exonic
936183706 2:110287409-110287431 GTGTCTCTCCTTTTGTTGCCTGG + Intergenic
940186304 2:150987758-150987780 GAGTCTCTGAGTTTGAAGACAGG + Intergenic
947633830 2:231670269-231670291 GGGTCTCTCAGCTTGGGGACTGG - Intergenic
948346578 2:237303836-237303858 GAATCTATCATTTTGGGGTCTGG - Intergenic
1168758202 20:330414-330436 GAGTCTCTAATTGACGTGACTGG - Intergenic
1170236388 20:14109886-14109908 GTGTCTTTCATTTTGGTATCAGG - Intronic
1173203597 20:40972923-40972945 GAGTCTCTCACTGTGTTGCCAGG + Intergenic
1177514293 21:22128108-22128130 GAGTCTCTCATTTCTGCCACAGG + Intergenic
1179789010 21:43744999-43745021 CAGTCTCCCTTTTTGGTGTCTGG - Intronic
1181944643 22:26506649-26506671 GAGTGTCTCCTTTTGGTGGCAGG - Intronic
1182353947 22:29713770-29713792 GAGTCCCTGATGTTGGGGACTGG - Intergenic
1182413848 22:30208492-30208514 GAATCTTTTATTTTGGTGCCAGG + Intergenic
1183084693 22:35479397-35479419 GAGTCTCTGTTTATGGTGATGGG + Intergenic
953040169 3:39249318-39249340 GCATCTCTCATTTTGTGGACTGG - Intergenic
954647775 3:52142038-52142060 GAGTCTGGCATTCTGTTGACAGG - Intronic
956059609 3:65336238-65336260 GAGTGTCTCGTTTTGATGCCTGG - Intergenic
957738623 3:84233805-84233827 GGATCTCTCATTTTGGGGTCTGG + Intergenic
959423804 3:106160428-106160450 GAGACTCTCATTGTGGAGAGTGG + Intergenic
964747449 3:160025721-160025743 GAGTGTGGCATTTTGGTAACTGG - Intronic
965778508 3:172258618-172258640 GAGTCTATCCTTTTGCTGAATGG + Intronic
971712611 4:30135685-30135707 GTGTGTGTTATTTTGGTGACTGG + Intergenic
972117073 4:35649907-35649929 GTGACTCTCAACTTGGTGACAGG - Intergenic
978837229 4:113165619-113165641 GATTCCCTCATTTTTGTTACTGG - Intronic
979060463 4:116053094-116053116 GAGTCTTTCCTTTTGATTACAGG + Intergenic
983474726 4:168199325-168199347 GAGTATGTCATTTTGATGTCAGG - Intergenic
984125863 4:175809500-175809522 GAGTATCTCATTATGCTGAGGGG - Intronic
985586623 5:741962-741984 GTGTCTGTCTTTTTGATGACAGG + Intronic
985617417 5:931983-932005 GGGACTCTCAGTTTGGGGACAGG + Intergenic
987313570 5:16703268-16703290 GAGACTCTCATTATGGAAACTGG + Intronic
990262190 5:54034858-54034880 CGGTCTCTCATTGTGTTGACAGG + Intronic
990656278 5:57960030-57960052 GAAGCTATCATTTTGGTGCCAGG - Intergenic
991460124 5:66849346-66849368 GAGTCTCTCCGTTTGTTGGCTGG + Intronic
992516090 5:77493447-77493469 GGCTCTCTCTTATTGGTGACTGG - Intronic
997859083 5:137400266-137400288 CAGTCTCTGTTTGTGGTGACAGG - Intronic
998817134 5:146025995-146026017 GAATCTGTCATTTGTGTGACTGG + Intronic
1000026578 5:157363931-157363953 AAGTCACTCATTTTAGGGACGGG - Intronic
1001904239 5:175458082-175458104 GAGTTTGTTATTTTTGTGACTGG - Intergenic
1002325101 5:178399464-178399486 CAGTCTCTCTTGTTTGTGACTGG + Intronic
1002495726 5:179610212-179610234 GACTCTTGCACTTTGGTGACAGG - Intergenic
1002897104 6:1385625-1385647 GCGTCTCTCCTGTCGGTGACTGG + Intergenic
1007381664 6:41494147-41494169 CAGTCTCTCAGTCTGGAGACTGG + Intergenic
1013895216 6:115080261-115080283 GAGTCCCACATTCTGGTTACAGG + Intergenic
1014630242 6:123780545-123780567 GAGTCTCTCATTTATGACACTGG - Intergenic
1015084343 6:129270580-129270602 GAGTTTATTATTTTGGTGTCAGG - Intronic
1015244439 6:131062132-131062154 GAGTCTATTATTTTGGGGAGGGG - Intronic
1016846508 6:148573177-148573199 GAGTCTCTCGGTTTAGTAACTGG - Intergenic
1018273126 6:162101917-162101939 GAGTTCCTGATTTTGGTGAATGG - Intronic
1018514336 6:164562237-164562259 GAATCTATCATTTTGGGGTCTGG - Intergenic
1018945282 6:168343597-168343619 GAGGCTCTCCTTGTGGTGGCCGG - Intergenic
1020092210 7:5348149-5348171 CAGTCTCTCTTTTTGGTGGGGGG - Intronic
1020444209 7:8251470-8251492 GAGTTTTTTATTTTTGTGACTGG - Intronic
1022813349 7:33890341-33890363 GAGACTCTCATTTTCAGGACTGG + Intergenic
1024608353 7:51041413-51041435 CATTCATTCATTTTGGTGACTGG + Intronic
1030369747 7:108685188-108685210 GAGTCTCTCGCTTTGTTGCCAGG - Intergenic
1033607364 7:142937133-142937155 GAGTCTCTCATACTGTTGCCTGG - Intergenic
1037688727 8:21165194-21165216 CAATTACTCATTTTGGTGACTGG + Intergenic
1042858783 8:73294051-73294073 GAGGCTCTCATTTTCCTGGCTGG - Intronic
1044277553 8:90320076-90320098 GAGTATCTCACATTGGTGAATGG - Intergenic
1046327616 8:112670694-112670716 GTGTTTCCCATTTTGGTGAATGG - Intronic
1048199547 8:132360405-132360427 GAGGCTCACATTCTGGTGAGAGG - Intronic
1049049089 8:140178597-140178619 GTGTCTCTGATGTTGGTGTCAGG + Intronic
1049530821 8:143153947-143153969 GAGTCTCTCATCCTGGTTAGAGG + Intergenic
1052441467 9:28501600-28501622 GAGACTCTCAATTTGGGGAAGGG + Intronic
1056510676 9:87301989-87302011 TAGTATCTCAGTTTGGTGATGGG - Intergenic
1060911889 9:127357906-127357928 CAGACTCTCATCTTGGGGACTGG + Intronic
1062323536 9:136002185-136002207 GTCTCTGTGATTTTGGTGACTGG + Intergenic
1185525275 X:773615-773637 GGGTTTCTCATGCTGGTGACGGG + Intergenic
1186909313 X:14144549-14144571 GAGTATCTCATATTGGTTACAGG - Intergenic
1187981239 X:24759842-24759864 AAGTCACTCATTCTGGTGAGGGG - Intronic
1189147473 X:38669904-38669926 GACTCTCCCATTTTGCTGATGGG - Intronic
1191674219 X:63777957-63777979 GAATCTATCATTCTGGTGTCCGG + Intronic
1191696626 X:63996846-63996868 GAGTCTTTCATTCTGGGGTCTGG - Intergenic
1193950210 X:87788139-87788161 GGGTCTATCATTCTGGTGTCTGG + Intergenic
1195105182 X:101596592-101596614 GAGTCTCCCATTTAGGTCTCAGG - Intergenic
1199549481 X:149043011-149043033 GAGTTTCTCATTTTGCTGATAGG - Intergenic
1200889251 Y:8305568-8305590 GTGCCTCTCACTTTGCTGACAGG - Intergenic