ID: 922331953

View in Genome Browser
Species Human (GRCh38)
Location 1:224585295-224585317
Sequence TACGTATGTTGAGTGATTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 93}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922331953_922331955 0 Left 922331953 1:224585295-224585317 CCCGCAATCACTCAACATACGTA 0: 1
1: 0
2: 1
3: 5
4: 93
Right 922331955 1:224585318-224585340 ATGAGCATCTGCCATATGCCAGG 0: 1
1: 1
2: 32
3: 256
4: 1285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922331953 Original CRISPR TACGTATGTTGAGTGATTGC GGG (reversed) Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
902655828 1:17867457-17867479 AACATTTGTTGAGTGAATGCAGG - Intergenic
907867093 1:58408885-58408907 TATGTGTGTTGAATGAATGCAGG - Intronic
910636091 1:89409629-89409651 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
910880013 1:91914847-91914869 TCCGTTTGTTGACTGATGGCTGG - Intergenic
911314558 1:96340427-96340449 GACTTATGTTCAGTCATTGCAGG - Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
922058602 1:222065530-222065552 CACTTATGTTGTGTGGTTGCTGG + Intergenic
922331953 1:224585295-224585317 TACGTATGTTGAGTGATTGCGGG - Intronic
1064566740 10:16647299-16647321 TAGGTATGTAAAGTGGTTGCAGG + Intronic
1070477357 10:76843021-76843043 TACTTAGGTTGAGTGTTTGTAGG + Intergenic
1071468982 10:85965958-85965980 CACCTGGGTTGAGTGATTGCTGG - Intronic
1075376970 10:121986236-121986258 AATGTTTGTTGAGTGAATGCTGG - Intergenic
1079230063 11:18641978-18642000 TATCTATGTTGAGAGATTACAGG - Intergenic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1081805795 11:45889846-45889868 AACGTTTGTTGAGTGAATGAAGG - Intronic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1099667699 12:85653331-85653353 TGAGTATACTGAGTGATTGCTGG - Intergenic
1100733267 12:97497588-97497610 TACGTTTGTTTAGTGCTTTCTGG + Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1109183878 13:59246781-59246803 TAAGCATGATGATTGATTGCAGG + Intergenic
1109487402 13:63045043-63045065 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1112017765 13:95345487-95345509 CCCTTATGTTAAGTGATTGCTGG + Intergenic
1116581392 14:46646685-46646707 TCCATATTTTGAGAGATTGCAGG + Intergenic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1122647539 14:103205378-103205400 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123218635 14:106836579-106836601 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1128600568 15:68992161-68992183 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1137364128 16:47846006-47846028 AATGTTTGTTGAGTGAATGCAGG + Intergenic
1140678811 16:77363396-77363418 TTGATATGCTGAGTGATTGCTGG - Intronic
1144321512 17:14126081-14126103 TACTTGTGTTGATTCATTGCTGG + Intronic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1147114418 17:38288330-38288352 TACCTATGTTGAGAGATTCAGGG - Intergenic
1148415191 17:47500869-47500891 TACCTATGTTGAGAGATTCAGGG + Intergenic
1149367288 17:55958663-55958685 TGTGTATGTTGAGTGGTTGGGGG - Intergenic
1155732701 18:29180717-29180739 TCCGTATGTTGAGGGAATGCTGG + Intergenic
1158244100 18:55411247-55411269 GAAGTAAGTTGAGTGATTTCAGG - Intronic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164044060 19:21519279-21519301 TCCCTATGTTGAGGGAATGCTGG - Intronic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1165638722 19:37365635-37365657 TCCTTATGTTGAGGGAGTGCTGG + Intronic
926503501 2:13682733-13682755 TACATATGTTGATTGATGTCTGG + Intergenic
929831833 2:45353389-45353411 TGTGTATTTTGACTGATTGCTGG - Intergenic
930991521 2:57662193-57662215 CACATATGCAGAGTGATTGCGGG + Intergenic
935674512 2:105582816-105582838 TATGTATGTTAAGTGCTTCCAGG + Intergenic
936828345 2:116608889-116608911 TACCTATGTTGAGATATTTCTGG - Intergenic
940544730 2:155069566-155069588 TTCCTATGTTAATTGATTGCTGG + Intergenic
947042681 2:225941672-225941694 CACATATGTTGAGTGATTGCTGG - Intergenic
947076468 2:226350770-226350792 TACGTCTGATGTGTGGTTGCTGG - Intergenic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1175039414 20:56032861-56032883 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1178174817 21:30084377-30084399 TACATCTCTTCAGTGATTGCAGG + Intergenic
1185114312 22:48922778-48922800 TAGATATGTTCAGTGAGTGCTGG - Intergenic
950903815 3:16519744-16519766 CACCTATCTTGAGTGATTGCTGG - Intergenic
956176375 3:66477009-66477031 TACGTCTGTTGAGTGAGAGCAGG + Intronic
959376776 3:105597865-105597887 TACTTATATGAAGTGATTGCTGG - Intergenic
959962313 3:112312426-112312448 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
967993291 3:195147732-195147754 GATGTTTGTTGAGTGAATGCAGG - Intronic
970376133 4:15458994-15459016 TAAATATGTTGAGTGATTGAAGG - Intergenic
971278853 4:25224407-25224429 TCCTTATGTTGAGGGAGTGCTGG + Intronic
972097472 4:35365579-35365601 TGCTTATGTAGAGTTATTGCTGG - Intergenic
972920547 4:43935917-43935939 TAGGTATGTGGCGTTATTGCTGG - Intergenic
978533346 4:109736183-109736205 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
982819281 4:159926446-159926468 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
983147933 4:164241391-164241413 TATGTGTGCTGAGTGATCGCTGG - Intronic
988675870 5:33432553-33432575 TACGGAACTTGAGTGCTTGCTGG - Intergenic
992759559 5:79939455-79939477 TCCATATCTTGAGGGATTGCAGG - Intergenic
993883188 5:93386862-93386884 TAAGTGTGTTGAGTGTTTCCAGG - Intergenic
1000658157 5:163907109-163907131 TATGTGTGTTGAATGATTGTTGG + Intergenic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1006968006 6:38009577-38009599 TACGTATGCTGGGTTATAGCAGG - Intronic
1007270538 6:40632971-40632993 TAAGAAGATTGAGTGATTGCAGG - Intergenic
1011235680 6:85213629-85213651 TACGAATGTTGAGAGGTGGCTGG - Intergenic
1012005119 6:93704212-93704234 TAAATATGTTGAGTGATGGTTGG - Intergenic
1017408618 6:154146553-154146575 AAAATATGTTGTGTGATTGCTGG + Intronic
1018985123 6:168630365-168630387 AACTTATGTTTAGAGATTGCAGG - Intronic
1019053355 6:169201476-169201498 TACGTATATTCAGTGACTGAAGG - Intergenic
1021369095 7:19818960-19818982 GACATATGTGGTGTGATTGCTGG + Intergenic
1022674064 7:32481929-32481951 TCCGTATGTTGAGGGAATGCTGG - Intergenic
1024423614 7:49199979-49200001 TCTGTATGTTGAGGGAGTGCTGG - Intergenic
1031767863 7:125804013-125804035 TTCCTCTGTTGATTGATTGCAGG - Intergenic
1032646087 7:133825461-133825483 TTGGTAGGCTGAGTGATTGCTGG + Intronic
1032670497 7:134077950-134077972 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1033714805 7:143989221-143989243 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1046850397 8:118965658-118965680 GAAGTAAGTAGAGTGATTGCTGG + Intergenic
1047398826 8:124528798-124528820 TCCTTATGTTGAGGGAGTGCTGG - Intronic
1050749832 9:8924134-8924156 TAGGTGTGATGAGTGAGTGCTGG - Intronic
1056006376 9:82275887-82275909 AAGGTATGGTGAGAGATTGCTGG - Intergenic
1056578648 9:87874182-87874204 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1191645369 X:63474910-63474932 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1193868273 X:86763794-86763816 TCTGTTTGTTGACTGATTGCTGG + Intronic
1197360224 X:125492637-125492659 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic