ID: 922332737

View in Genome Browser
Species Human (GRCh38)
Location 1:224591692-224591714
Sequence GCCTAGGGATGCTGGCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 187}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922332737_922332751 5 Left 922332737 1:224591692-224591714 CCAGGAAGCCAGCATCCCTAGGC 0: 1
1: 0
2: 2
3: 19
4: 187
Right 922332751 1:224591720-224591742 CCTCTGGGGTACAGGGAGGGAGG 0: 1
1: 0
2: 4
3: 57
4: 646
922332737_922332747 1 Left 922332737 1:224591692-224591714 CCAGGAAGCCAGCATCCCTAGGC 0: 1
1: 0
2: 2
3: 19
4: 187
Right 922332747 1:224591716-224591738 TCCACCTCTGGGGTACAGGGAGG 0: 1
1: 0
2: 2
3: 19
4: 201
922332737_922332741 -9 Left 922332737 1:224591692-224591714 CCAGGAAGCCAGCATCCCTAGGC 0: 1
1: 0
2: 2
3: 19
4: 187
Right 922332741 1:224591706-224591728 TCCCTAGGCCTCCACCTCTGGGG 0: 1
1: 1
2: 3
3: 21
4: 251
922332737_922332740 -10 Left 922332737 1:224591692-224591714 CCAGGAAGCCAGCATCCCTAGGC 0: 1
1: 0
2: 2
3: 19
4: 187
Right 922332740 1:224591705-224591727 ATCCCTAGGCCTCCACCTCTGGG 0: 1
1: 0
2: 0
3: 16
4: 173
922332737_922332745 -2 Left 922332737 1:224591692-224591714 CCAGGAAGCCAGCATCCCTAGGC 0: 1
1: 0
2: 2
3: 19
4: 187
Right 922332745 1:224591713-224591735 GCCTCCACCTCTGGGGTACAGGG 0: 1
1: 0
2: 18
3: 186
4: 1744
922332737_922332744 -3 Left 922332737 1:224591692-224591714 CCAGGAAGCCAGCATCCCTAGGC 0: 1
1: 0
2: 2
3: 19
4: 187
Right 922332744 1:224591712-224591734 GGCCTCCACCTCTGGGGTACAGG 0: 1
1: 0
2: 3
3: 45
4: 581
922332737_922332749 2 Left 922332737 1:224591692-224591714 CCAGGAAGCCAGCATCCCTAGGC 0: 1
1: 0
2: 2
3: 19
4: 187
Right 922332749 1:224591717-224591739 CCACCTCTGGGGTACAGGGAGGG 0: 1
1: 0
2: 3
3: 32
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922332737 Original CRISPR GCCTAGGGATGCTGGCTTCC TGG (reversed) Intronic
900116874 1:1032851-1032873 GCCGAGAGATTCTGGCCTCCAGG + Intronic
901401335 1:9016976-9016998 GACTAGGGATGCTAGTTTCTAGG - Intronic
903340609 1:22652102-22652124 TGCCAGGGATGCCGGCTTCCAGG + Intergenic
905393629 1:37653412-37653434 GACTAGGGACCCTGGCTCCCTGG - Intergenic
906039539 1:42777407-42777429 CACAAGGGTTGCTGGCTTCCGGG + Intronic
906148452 1:43573682-43573704 CCCTAAGGATGCTGACTTCTGGG + Intronic
907021203 1:51068209-51068231 GCCTAGGGGTGGTGGCATCTTGG - Intergenic
908555715 1:65254748-65254770 GCCTAGGCATCCAGGCTCCCAGG - Intronic
909656551 1:78039811-78039833 ACATAGGGATGCTGGCTACCTGG + Intronic
915724557 1:158008265-158008287 GCCCAGGGGTTCTGGCTCCCAGG - Intronic
916142332 1:161710842-161710864 TGCAAGGGAAGCTGGCTTCCAGG + Exonic
920653099 1:207853199-207853221 GCCTAGGGAGGGTGGAGTCCCGG - Intergenic
922332737 1:224591692-224591714 GCCTAGGGATGCTGGCTTCCTGG - Intronic
922581066 1:226698345-226698367 GGCTAGGGATGCTGACTGCTAGG + Intronic
922797671 1:228348954-228348976 GCCAAGGAATGCTTCCTTCCCGG - Intronic
924149725 1:241116458-241116480 GGCTCTGGCTGCTGGCTTCCCGG + Intronic
1063122061 10:3112089-3112111 CCCTGGGGCTGCTGGCTGCCCGG + Intronic
1067113041 10:43414118-43414140 ACCTAGGGATCCAGCCTTCCTGG - Intergenic
1067532718 10:47086149-47086171 CTCTTGGGATGTTGGCTTCCTGG - Intergenic
1069753648 10:70760659-70760681 GCAAAGGGATGCTGGGTCCCTGG - Exonic
1070289826 10:75106970-75106992 GCCCAGGGAGGCTGGTGTCCTGG - Intronic
1070574672 10:77668766-77668788 GCCCAGGGCTGCCAGCTTCCTGG - Intergenic
1070968194 10:80542881-80542903 GCATAGGAAGGCTGGCTGCCTGG - Intronic
1072472011 10:95721700-95721722 GACTAGGGGTGATGGCATCCCGG - Intronic
1072503281 10:96040608-96040630 GCCCAGGGCTGTTGGCTTCCAGG + Intergenic
1072551281 10:96479550-96479572 CCCTTGGGGTGCTGGGTTCCTGG - Intronic
1073512501 10:104051597-104051619 GGTTAGGGACGCTGTCTTCCAGG + Intronic
1074106017 10:110390198-110390220 GGATAAGGAGGCTGGCTTCCAGG - Intergenic
1076515831 10:131044032-131044054 CCCCAGGGATGAGGGCTTCCAGG - Intergenic
1076518267 10:131062321-131062343 GCCTCTGGATGAGGGCTTCCAGG + Intergenic
1081582887 11:44364766-44364788 CCTTGGGGATGGTGGCTTCCAGG - Intergenic
1081866157 11:46361797-46361819 GCCTAGGGATGGTGGGGCCCGGG - Intronic
1082915268 11:58427763-58427785 GCCTAGGTTGCCTGGCTTCCTGG - Intergenic
1083196755 11:61092681-61092703 GCCTCGGGTTGCTGTCTTCCAGG - Intergenic
1084477421 11:69396801-69396823 GCCTAGTGCTGGTGGCTTCAGGG + Intergenic
1084711937 11:70849018-70849040 GCCCAGGGATGCTGGCTGCAGGG + Intronic
1088606955 11:111541362-111541384 GGGTAGGGATGCTGGATCCCCGG + Intronic
1090792110 11:130099565-130099587 GCCAAGAGTTGCTGACTTCCTGG - Intronic
1090829264 11:130409667-130409689 GCCCAGGCCTGCTGGCTTCATGG + Intronic
1091239700 11:134044135-134044157 GCCTCGGGAGGCTGTCTTGCAGG - Intergenic
1091262552 11:134245823-134245845 CCCCAGAGAGGCTGGCTTCCAGG - Exonic
1092623884 12:10304384-10304406 GTTTATGGAGGCTGGCTTCCTGG - Intergenic
1093661469 12:21762502-21762524 ACCTAGGGAGTCTGGCTTCTGGG + Intergenic
1097190429 12:57216891-57216913 GCCTAGGGACGCGGGGCTCCGGG - Exonic
1097747270 12:63315215-63315237 CCCTAGGGATGCTGGTCACCAGG - Intergenic
1099635460 12:85206149-85206171 GCCTGGGACTGCTGACTTCCAGG + Intronic
1101523693 12:105507910-105507932 ACCTTAGGATTCTGGCTTCCAGG + Intergenic
1103537274 12:121641623-121641645 GCCTAGGCATAGTGGCTGCCGGG - Exonic
1104970464 12:132528491-132528513 GCCACGGGGTGCTGGCTCCCTGG - Intronic
1105432537 13:20350423-20350445 GCCTAGGGCTGCTGATCTCCAGG + Intergenic
1107980764 13:45732281-45732303 GCCTAGGGATTCTGGTTGACAGG - Intergenic
1108506704 13:51118859-51118881 ACCTAGGCATGCTGTATTCCTGG - Intergenic
1110466558 13:75808152-75808174 GCCTAAGTCTGCTGGCCTCCCGG - Exonic
1110915865 13:81020612-81020634 GACTAGGGATGTTGGATGCCAGG + Intergenic
1113626591 13:111852455-111852477 GGGAAGGGCTGCTGGCTTCCGGG + Intergenic
1121422255 14:93824240-93824262 GCCTGTGGCTGCTGGCTTCCTGG - Intergenic
1121425634 14:93849561-93849583 GTGTTGGGATGCTGGCTCCCTGG + Intergenic
1121861917 14:97326454-97326476 ACATAGGGATGGTGGCTCCCGGG - Intergenic
1126464044 15:48944334-48944356 TCCTTGGGCTCCTGGCTTCCAGG - Intronic
1126562247 15:50056558-50056580 CCCTAGGGGTGCTCGTTTCCTGG + Intronic
1126789137 15:52204693-52204715 GCCCCGGGATGCTGGCGCCCAGG - Intronic
1127450876 15:59115189-59115211 GCCTTTGGATGCTGGTTTTCTGG + Intronic
1128236840 15:66073385-66073407 GCTTAGGAGTGCTGGGTTCCCGG - Intronic
1133052099 16:3123048-3123070 GCCAAGTGATGACGGCTTCCAGG - Intergenic
1133156709 16:3880908-3880930 GCGTAGGGAAGCTGGCGGCCCGG + Intergenic
1133387106 16:5378571-5378593 ACCTGGGAATGCAGGCTTCCTGG + Intergenic
1133611956 16:7441909-7441931 GCCCAGAGATGCTGGCAGCCTGG + Intronic
1135408888 16:22218369-22218391 GCTTTGGGATGCTGGTTCCCAGG + Intronic
1136496905 16:30650614-30650636 CCCTAGGGATGATGGCCGCCAGG + Intergenic
1136569726 16:31089369-31089391 CCCTGGGCCTGCTGGCTTCCTGG + Intronic
1139295253 16:65895084-65895106 ACTTAGGGCTGTTGGCTTCCAGG - Intergenic
1140031921 16:71345714-71345736 GCCAAGGGGGGCTGGCCTCCTGG + Intergenic
1141394466 16:83692354-83692376 CCCTAGGGATGCATTCTTCCCGG + Intronic
1141781474 16:86164742-86164764 GCCTCGGAGTGCTGGCTCCCAGG + Intergenic
1142267548 16:89071398-89071420 GCCTCAGGGTGCAGGCTTCCAGG + Intergenic
1143259001 17:5584428-5584450 GCCCCGGGCTGCTGGCTCCCAGG + Exonic
1143343680 17:6233862-6233884 GCCTAGGTAGCTTGGCTTCCAGG + Intergenic
1144741940 17:17588703-17588725 GCCTAGGGGTGCGGGCACCCAGG - Intronic
1146669192 17:34725101-34725123 GCCTAAGGACCCTGGGTTCCAGG - Intergenic
1147875372 17:43617107-43617129 GCCTGGGGAAGATGGATTCCAGG - Intergenic
1153681837 18:7508401-7508423 GCTTGGGGATGCTGTCTTTCAGG - Intergenic
1153828225 18:8896758-8896780 GCCTAGCAATGATGGCTTTCTGG + Intergenic
1155106608 18:22673132-22673154 GGCTAGGGATACTGACTCCCTGG - Intergenic
1155235431 18:23813898-23813920 GCCTAGAGATGCCGACTTCCAGG + Intronic
1155276850 18:24196873-24196895 GCCAAGGGATGACGGCTGCCTGG + Intronic
1156347784 18:36273514-36273536 GCCTGGGGAGGCTGGCTGGCTGG - Intergenic
1156469985 18:37371394-37371416 GCCCAGGGATCCTGGCCTCAGGG + Intronic
1156471339 18:37378883-37378905 GCTCAGGGATGCTGGCTGGCTGG - Intronic
1156762773 18:40613368-40613390 GGCTAGGAATGCTGACTTTCTGG - Intergenic
1156965528 18:43086733-43086755 GCCTGGGGATGCTAACCTCCTGG + Intronic
1157690361 18:49677011-49677033 GGCAAGGGATGCTGACATCCTGG + Intergenic
1157732408 18:50015625-50015647 GGCAAGGGAAGCTGGCTTCCTGG + Intronic
1160566033 18:79787296-79787318 GCCGAGGGTTGCTGGATGCCTGG - Intergenic
1161242133 19:3228445-3228467 GTCTATGGATGGTGGCTGCCTGG + Intronic
1163789285 19:19297101-19297123 GGCTGCGGAGGCTGGCTTCCCGG + Exonic
1165110987 19:33502056-33502078 GCCTGGGGGTGGTGGCTTGCTGG - Intronic
1165446978 19:35861810-35861832 GTCTTGGGATGAGGGCTTCCTGG + Exonic
1165910564 19:39223897-39223919 GCCCAGTGGTGCTGCCTTCCCGG + Intergenic
1166381193 19:42356214-42356236 GTCTAGGGATGGTTGCTCCCAGG + Intronic
1166953742 19:46447992-46448014 GCCTGGCCATGCTGGGTTCCTGG - Intergenic
1167019638 19:46863613-46863635 TCCTAGGGTTGCTGGCTTAGAGG - Intergenic
925709699 2:6726887-6726909 GCCTGGGGAAGAAGGCTTCCCGG - Intergenic
928414345 2:31079230-31079252 TTCTAGGGATGATGGCTTCTGGG + Intronic
929555254 2:42921851-42921873 GACTGGAGATGCTGGCTCCCTGG + Intergenic
931554504 2:63487116-63487138 TCCTACTGATGCTGGCCTCCTGG - Intronic
933682451 2:85114159-85114181 GCCTAGAGATCCTGGTTCCCGGG + Intergenic
934605583 2:95692761-95692783 GCCAAGTCATGCTTGCTTCCAGG + Intergenic
935285734 2:101562329-101562351 GTCAAGGGGTGCTGACTTCCAGG - Intergenic
936539049 2:113335301-113335323 GCCAAGTCATGCTTGCTTCCAGG + Intergenic
937105406 2:119307630-119307652 GCCCAGGGTTGCTGGCTTGCCGG + Intronic
937462977 2:122105191-122105213 GACTTGTGATGCTGGATTCCTGG + Intergenic
937858215 2:126687898-126687920 GCCTTGGTAAGCTGGTTTCCAGG - Intronic
940813612 2:158273984-158274006 GCCAAGGGTTACTGGCCTCCAGG + Intronic
941159264 2:162017551-162017573 CCCTAGGGAGGCTGGCTACAGGG - Intronic
942734598 2:179096088-179096110 TCCTAGGGATGGTGGCCACCAGG - Intergenic
947543812 2:230996424-230996446 GGCTTGGAATGCTGGCTGCCGGG - Exonic
947673123 2:231954063-231954085 GCCTAGGTATGCCGGACTCCTGG + Intergenic
948671853 2:239574051-239574073 GGACTGGGATGCTGGCTTCCAGG + Intergenic
948698990 2:239748923-239748945 GATCAGGGAGGCTGGCTTCCCGG - Intergenic
949008000 2:241661145-241661167 CCCTGGGGATGGTGGCTCCCGGG + Intronic
1172656812 20:36542675-36542697 GCCCAGGAATCCTGTCTTCCAGG + Intronic
1174343960 20:49915780-49915802 GCCTAGGGATGGTGGCTGGCCGG + Intergenic
1174395842 20:50246460-50246482 GCCTAGGGACTCTGTCTTCAGGG + Intergenic
1174416772 20:50372756-50372778 GCCTAGACATGCTAGCCTCCAGG + Intergenic
1174956724 20:55106054-55106076 GCCCATGCATGCTGCCTTCCAGG - Intergenic
1175173759 20:57097394-57097416 GCTCAGGGTGGCTGGCTTCCAGG - Intergenic
1179552253 21:42150752-42150774 ACCTGGTGATGCTGGCTTCCTGG - Intergenic
1181547200 22:23608846-23608868 GCCCAGGGATGCTGGCGTGGAGG - Intronic
1183090940 22:35521514-35521536 GATTAGGAATTCTGGCTTCCGGG - Intergenic
1184208811 22:43023302-43023324 GCCAAGGGGTGCTGCCTACCAGG + Intergenic
1184470012 22:44691048-44691070 GCCTCGGGAAGGTGGATTCCCGG + Intronic
1184944687 22:47794882-47794904 GCCTAGAGTTTCTGGCTTCCAGG - Intergenic
1185153438 22:49179467-49179489 TGCCAGGGATGGTGGCTTCCCGG - Intergenic
949414304 3:3799546-3799568 GCCTAGGGATGCCGCCGCCCGGG - Exonic
950633269 3:14298104-14298126 GCCTAGGAATGCCGGCTTCCTGG + Intergenic
953463221 3:43097838-43097860 GCCTGGGGCTGCTGGCCTCATGG + Intronic
954431086 3:50471190-50471212 GCCTGGAGATGCTGGCTTCAAGG + Intronic
954456937 3:50604764-50604786 GGACAGGGATGGTGGCTTCCAGG - Intergenic
954819344 3:53312143-53312165 TACTAGGGAAGCTGGCCTCCAGG - Intronic
956217763 3:66867495-66867517 GCCCTGGAATGCTGGCTTTCTGG - Intergenic
961436275 3:126920442-126920464 GCCTAGGGATGTGGCTTTCCAGG + Intronic
961661171 3:128469534-128469556 GCCTAGGGTTGCTGTATGCCAGG - Intergenic
962848500 3:139290454-139290476 GCCTAGGGAGGCTGGATGCTGGG + Intronic
965726153 3:171718673-171718695 GCCCAGGGAGGCTGACTTCAGGG - Intronic
967267491 3:187703245-187703267 GTCTAGGGATCCAGACTTCCGGG - Intronic
967842894 3:194021155-194021177 GCCAAGGATTGCTGGCTTCCAGG + Intergenic
967965753 3:194959042-194959064 GTCAAGGGATGCAGGCTCCCAGG + Intergenic
969842265 4:9891244-9891266 GCCGAGGGAAGCTGGCTTCGAGG - Intronic
979563982 4:122133872-122133894 GCCTAAGGATGCTGTCTTGTTGG - Intergenic
981029074 4:140105807-140105829 GGATAAGGATGCTGGATTCCTGG + Intronic
981688385 4:147480570-147480592 GCCGTGGGATGCTGGCTACAAGG + Intergenic
982512020 4:156294673-156294695 GCTTGGGTATGCTGGCTTCCGGG + Intergenic
983560611 4:169097696-169097718 CCCTAGTGATCCTTGCTTCCTGG + Intronic
985622330 5:962180-962202 GCCTGGTGAGCCTGGCTTCCTGG - Intergenic
986928015 5:12782428-12782450 TCCTAGGGATGTTGGCTACAGGG - Intergenic
987250393 5:16095035-16095057 ACCCAGGTATTCTGGCTTCCAGG + Intronic
988536492 5:32073669-32073691 GCCTAGGCAACATGGCTTCCTGG - Intronic
997734546 5:136203694-136203716 GCCTAGGACAGCAGGCTTCCAGG - Intergenic
997739173 5:136238686-136238708 TCCTGAGGATGCTGGCTTCACGG - Intronic
1001651798 5:173321024-173321046 GCCTAGAGATGCTGACTTAGGGG + Intronic
1002461957 5:179378318-179378340 GCCTGGGGATGCATGCTTCCAGG + Intergenic
1004545961 6:16598662-16598684 ACTCAAGGATGCTGGCTTCCTGG + Intronic
1005999962 6:30956838-30956860 GACTGGGAATGCTGGATTCCTGG - Intergenic
1006333065 6:33405886-33405908 TCCTAGCCATGCTGGCCTCCTGG + Intronic
1007632217 6:43278871-43278893 ACCTAGGCATGCTGGCTTTTCGG - Intronic
1014726138 6:124974063-124974085 CCCTTGGGATGCTGGCTCCGGGG - Intronic
1014982319 6:127959340-127959362 TCCTAGAAATGGTGGCTTCCTGG + Intergenic
1018874764 6:167812052-167812074 ACCTGGGCATGCTGTCTTCCGGG - Intergenic
1021052896 7:16011318-16011340 GCCTAGGGTGGCTGACATCCTGG - Intergenic
1021658995 7:22899333-22899355 GCCTGGGGATGCTGGCATAGAGG + Intergenic
1022903991 7:34838137-34838159 CCCCAGGGAGGCTGACTTCCTGG + Intronic
1023481177 7:40636344-40636366 GAGTATGGAGGCTGGCTTCCAGG + Intronic
1026113726 7:67478697-67478719 GACTAGGCATGCTGGGTTCTGGG - Intergenic
1026432203 7:70358546-70358568 CCCTTGGGAGGATGGCTTCCAGG + Intronic
1028981210 7:96969864-96969886 GCATATGGATGCTGGGCTCCTGG - Intergenic
1029045390 7:97622316-97622338 ACCCAGGGATGCTGGCCTCTTGG + Intergenic
1029202849 7:98850679-98850701 GGCTAGGCATGGTGGCTCCCAGG - Intronic
1031793114 7:126135289-126135311 GCCTAGAGATTCTGGTTTACTGG - Intergenic
1035528929 8:336235-336257 GCCTGGGGCTGCCGGCTGCCAGG - Intergenic
1036210368 8:6835665-6835687 GCTTGGGGTTTCTGGCTTCCAGG + Intergenic
1039417848 8:37410721-37410743 GCCTAGGGAGGCTGGGGTCACGG + Intergenic
1042281180 8:67058144-67058166 GGCTATGGCTGCTGGCTTTCTGG - Exonic
1045522315 8:102914027-102914049 GACTAGGGATGCTTGTTTCTTGG + Intronic
1046173294 8:110542065-110542087 GCCTCGGGCTCCTGGCTTCAAGG - Intergenic
1046440024 8:114243633-114243655 GCCAAGGAATGCTGGCAGCCTGG + Intergenic
1047437621 8:124847815-124847837 CCCTAGGGCTGCTGGCTTCCTGG + Intergenic
1049168105 8:141139499-141139521 GCCTGGGGCTGCTGGCAGCCAGG - Intronic
1049483472 8:142839204-142839226 ACCTAGGGAGGCTGGCTGGCTGG + Intronic
1049593854 8:143474540-143474562 GGCCAGTGAGGCTGGCTTCCAGG + Intronic
1051704435 9:19861171-19861193 TCCTAGGGATGGTGGCTACAGGG + Intergenic
1051983745 9:23057348-23057370 GCTTAGGGCTGCAGGTTTCCAGG - Intergenic
1053328696 9:37182901-37182923 GCCTTGAGCTCCTGGCTTCCAGG - Intronic
1056484385 9:87040773-87040795 GGCTAGGGACAGTGGCTTCCAGG + Intergenic
1057801877 9:98195831-98195853 CCCTGGGGCTGCTGCCTTCCAGG - Intergenic
1061257791 9:129462703-129462725 GCCTGGGGATGCTGGGGTCCAGG + Intergenic
1061258789 9:129467792-129467814 GCCCAGGGAGGCTGGTGTCCTGG - Intergenic
1062712414 9:137983840-137983862 GGTTAGGCCTGCTGGCTTCCTGG - Intronic
1185476576 X:419138-419160 GACCACGGATGCTGGCTGCCGGG - Intergenic
1185748920 X:2594744-2594766 GCCCAGGGACGCTGGTCTCCAGG + Intergenic
1191690763 X:63935675-63935697 GCCTAGTCTTCCTGGCTTCCAGG + Intergenic
1195035627 X:100969299-100969321 ACCTAGGCATTCTGGCTTCAGGG - Intergenic
1195459291 X:105105636-105105658 ATCTAGGGCTTCTGGCTTCCAGG + Intronic
1195671940 X:107477279-107477301 CCCTAGGGCTGCTGGCATCCTGG + Intergenic
1196832916 X:119790371-119790393 GGCTAGGGAATCTGGCTTCCTGG + Intronic
1198839220 X:140838736-140838758 GCCCAAGGCTGCTGGCTTGCTGG + Intergenic
1199315615 X:146374285-146374307 GCCTAAGGATTCTTGCTTTCTGG - Intergenic
1199876946 X:151940151-151940173 GCCAAGGAATGCTGGTTGCCAGG + Intergenic
1199991417 X:152989672-152989694 GCTTATGAATGCTGCCTTCCTGG + Exonic
1201432904 Y:13923423-13923445 TCCTAAGGATGATGGCCTCCAGG - Intergenic