ID: 922333819

View in Genome Browser
Species Human (GRCh38)
Location 1:224602231-224602253
Sequence TACATTGCATTTTAGATTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 539
Summary {0: 1, 1: 0, 2: 3, 3: 49, 4: 486}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922333819_922333821 5 Left 922333819 1:224602231-224602253 CCATAAATCTAAAATGCAATGTA 0: 1
1: 0
2: 3
3: 49
4: 486
Right 922333821 1:224602259-224602281 GCATGGATATTATTTTTTAATGG 0: 1
1: 1
2: 5
3: 72
4: 509

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922333819 Original CRISPR TACATTGCATTTTAGATTTA TGG (reversed) Intronic
901892614 1:12280452-12280474 TACATCACATGCTAGATTTAAGG - Intronic
905571046 1:39005972-39005994 AACATTGCATTGAAAATTTATGG + Exonic
905783672 1:40734963-40734985 TACATTAGGTTTTAGAGTTATGG - Intronic
906020085 1:42620372-42620394 TACATTTCATTTTAGGTTTGGGG - Intronic
907004879 1:50902164-50902186 TACTTTGCCTTTTATAATTATGG - Intronic
907838671 1:58135547-58135569 TAACTTTTATTTTAGATTTAGGG + Intronic
908201589 1:61801443-61801465 CACATGGCATTTTGGGTTTAAGG + Intronic
908371216 1:63480113-63480135 TACATGGCATTTTAAATGGAAGG - Intronic
908482035 1:64550327-64550349 TACATTTAATTATAGATTTCTGG - Intronic
908986422 1:70028841-70028863 AACTTTGAAATTTAGATTTATGG + Intronic
909279428 1:73730184-73730206 TACATTCAATTTTAGGTTTTTGG + Intergenic
909734509 1:78940680-78940702 TAAATTACATTATAAATTTAAGG - Intronic
910863961 1:91770394-91770416 TAAACTGCAGTATAGATTTAGGG - Intronic
911279551 1:95905783-95905805 TATAATGCTTTTTAGATTTGAGG - Intergenic
911689320 1:100814065-100814087 TAAATTGTATTTTTGTTTTATGG - Intergenic
911905900 1:103568779-103568801 TACACTGCATTATATATATATGG + Intronic
913121411 1:115744363-115744385 AACAGTGCTTTTTAAATTTAAGG - Intronic
913377314 1:118166919-118166941 ACCATTGCAATGTAGATTTATGG - Intronic
913431903 1:118804373-118804395 TCCATTTTATTTTAGATTCAGGG - Intergenic
913434172 1:118829862-118829884 TCCATTCCATTTTACAATTAAGG - Intergenic
913439524 1:118883386-118883408 TACATTGCATTTTGAAGTTTTGG - Exonic
915025267 1:152823127-152823149 TACATTAGATCTTTGATTTATGG + Intergenic
915151139 1:153832654-153832676 TAATTTTTATTTTAGATTTAAGG + Intronic
916124190 1:161554676-161554698 AAAATTTTATTTTAGATTTAGGG - Intergenic
916772166 1:167921086-167921108 TAAATTAAATTTTAGATTTGGGG + Intronic
917148843 1:171923689-171923711 TAAATTTCATTTTAGATTTGGGG + Intronic
917315877 1:173724981-173725003 TAAAATGCATTTCATATTTAAGG - Intronic
917438344 1:175043950-175043972 TACAATGCAGTTTAGAATTCAGG - Intergenic
917888520 1:179413249-179413271 TAAATTTTATTTTAGATTCAGGG + Intronic
918077895 1:181184221-181184243 TACACTGCATTTTAGAGTTGTGG + Intergenic
918590314 1:186233730-186233752 TAATTTAAATTTTAGATTTAAGG + Intergenic
918866816 1:189911157-189911179 TGTATTTCATTTTAGCTTTAGGG + Intergenic
918992750 1:191719195-191719217 CACATTACATTTTAGACATAAGG + Intergenic
919400718 1:197112963-197112985 TACCTTTTATTTTAGGTTTAGGG - Intronic
920360555 1:205412667-205412689 TACATTTCCTTTCAGATTTAAGG + Intronic
920773554 1:208913601-208913623 CAAATTTCATTTTAGATTCAGGG - Intergenic
920773613 1:208914047-208914069 CAAATTTCATTTTAGATTCAGGG - Intergenic
921750924 1:218793547-218793569 TTCATTACATTTTAGTTTTATGG + Intergenic
921923652 1:220694191-220694213 TACATAGCAATTTAGGTTTGTGG - Intronic
922333522 1:224599032-224599054 TACATTGCAGTCCAGATTTATGG - Intronic
922333581 1:224600038-224600060 TACATTGCATTCTAGAGTTATGG - Intronic
922333819 1:224602231-224602253 TACATTGCATTTTAGATTTATGG - Intronic
922649713 1:227327306-227327328 TTCATTTTATTTTAGATTCAAGG - Intergenic
923113942 1:230916669-230916691 TAAGTTGCATTTTTGAGTTACGG - Intronic
923642673 1:235780981-235781003 TACATGGCATTACAGATGTATGG + Exonic
924216436 1:241826983-241827005 CAAATTGCATTTGAGATTTCTGG - Intergenic
924425810 1:243949260-243949282 TAGAATGCATTTTAAAATTATGG + Intergenic
924895103 1:248329344-248329366 TACTTTGGATATTAGATTTTTGG + Intergenic
1063937198 10:11090163-11090185 CAAATTTCATTTTAGATTCAGGG - Intronic
1064600022 10:16984272-16984294 TACATCCCATGTTAGATCTATGG - Exonic
1065527688 10:26639452-26639474 TACCTTTCATTTAATATTTAGGG + Intergenic
1066471479 10:35702091-35702113 TGTATTTTATTTTAGATTTAGGG + Intergenic
1066526655 10:36287190-36287212 TACATTCCTTTTTAGTTTTGGGG + Intergenic
1067128597 10:43541426-43541448 TACACTTCAGTTTAGATTTTAGG + Intergenic
1068206166 10:53857089-53857111 TAAATTTTATTTTAGATTCAGGG - Intronic
1068377155 10:56195717-56195739 TAACTTTCATTTTAGATTCAGGG + Intergenic
1068382183 10:56270298-56270320 TATATTTTATTTTAGATTTGTGG + Intergenic
1068580000 10:58729314-58729336 CACCTTGCATTTTAAAATTATGG + Intronic
1069163441 10:65118761-65118783 TTCTTTACATTTTAGATTCAAGG + Intergenic
1069210076 10:65745912-65745934 TAAATTTCATTGTAGACTTAAGG + Intergenic
1071148277 10:82600793-82600815 TAATTTTTATTTTAGATTTATGG + Intronic
1071223318 10:83495603-83495625 TACATTAAATATTAGATTTCTGG + Intergenic
1076519790 10:131074350-131074372 TTCATTGCATTTTATATTTTGGG + Intergenic
1076592217 10:131591334-131591356 TACACAGCAGTTTAGATTCAGGG - Intergenic
1076639204 10:131902103-131902125 TACATAGCTTTTTAACTTTAAGG - Intronic
1077652734 11:3988428-3988450 TACATGGCTTTTTAGATTTTCGG - Intronic
1078387162 11:10902836-10902858 TACATTTTATTTTTTATTTAAGG - Intergenic
1079257967 11:18848856-18848878 TCCATTGCATTTTCTATTTCTGG - Intergenic
1079776106 11:24530173-24530195 TACATTGCATTTAAAATTTTTGG - Intronic
1080098632 11:28433878-28433900 AACATTACATTTTAGATGAATGG - Intergenic
1080150067 11:29041763-29041785 AACATAGCATTTTACATTTCTGG - Intergenic
1080177911 11:29389440-29389462 CAAATTTTATTTTAGATTTAGGG + Intergenic
1080343258 11:31293869-31293891 GACATTGAATTTGAGATATATGG - Intronic
1080529208 11:33158248-33158270 TAAATTGCCTTTCAGACTTAAGG + Intronic
1080594512 11:33758641-33758663 TGCATTTCTTCTTAGATTTAAGG - Intronic
1081150283 11:39620126-39620148 TTCTTTGCATTTGTGATTTAGGG + Intergenic
1081399090 11:42621874-42621896 TACATTGCATAATAGAGTTAAGG + Intergenic
1081680014 11:44995548-44995570 TTCATTTTATTTTAGATTCAGGG + Intergenic
1085670169 11:78456319-78456341 TACTTTGAATTGTAGAGTTAGGG - Intronic
1086511376 11:87561763-87561785 TGCATTGCATTTTAGACTCTGGG + Intergenic
1086777309 11:90854563-90854585 TCCTTTGCATTCTACATTTATGG - Intergenic
1087421853 11:97938252-97938274 AACAATGCATGTTACATTTAGGG + Intergenic
1087744160 11:101924187-101924209 TACATTGCACTTTAGGGTAACGG - Intronic
1087805993 11:102556179-102556201 CAAATTGAAGTTTAGATTTAAGG + Intergenic
1088026532 11:105191078-105191100 TACCTTTTATTTTAGGTTTAGGG - Intergenic
1088715893 11:112549309-112549331 TACATGGCATTTTAAAGTCACGG - Intergenic
1088751408 11:112845031-112845053 CACTTTGGATTTTAGATTTTTGG - Intergenic
1090130248 11:124134730-124134752 TAAATTGCATCATTGATTTAAGG + Intronic
1090559308 11:127913596-127913618 TAAATTGTATTTTTGTTTTATGG + Intergenic
1093019890 12:14193624-14193646 TACATGGCTTTTTAGATTTTTGG + Intergenic
1093354590 12:18150799-18150821 TACATTGAATTAAAGATTGAGGG + Intronic
1094004366 12:25731891-25731913 TAGATTACATTTTTGATTTGAGG + Intergenic
1094157685 12:27354558-27354580 TAAATCTCATTTTAGGTTTAAGG - Intronic
1094217365 12:27957698-27957720 TAAATTACACTTTACATTTACGG + Intergenic
1094726749 12:33126651-33126673 TAGAATGCATTGTGGATTTAGGG + Intergenic
1095607716 12:44090188-44090210 TAAATTTTATTTTAGATTCAGGG + Intronic
1096168060 12:49441686-49441708 CACATGGCTTTTTAGATTTTCGG - Intronic
1096568539 12:52502264-52502286 AGCTTTGCATTTTACATTTAGGG + Intergenic
1097065670 12:56318706-56318728 TAAATTTTATTTTAGATTTGGGG + Intronic
1098561670 12:71879922-71879944 CATATTGCATTTTAGACTTTTGG + Intronic
1098971291 12:76859685-76859707 TACAGTTCAATTTAGATGTATGG + Intronic
1099032533 12:77545056-77545078 TATATTAAATTTTAGATTCAGGG - Intergenic
1099116485 12:78632005-78632027 TACATTGAATTTTACATTCCAGG + Intergenic
1099933292 12:89098269-89098291 TAGATTGCATTTTTGGGTTAGGG + Intergenic
1099958500 12:89374466-89374488 TTTTATGCATTTTAGATTTAAGG - Intergenic
1100002024 12:89848816-89848838 TAAAGCCCATTTTAGATTTATGG - Intergenic
1100580629 12:95936358-95936380 CTCATTACATTTTATATTTATGG + Intronic
1101080796 12:101181820-101181842 TGCATTGCTATTTAAATTTAGGG + Intronic
1101783102 12:107854499-107854521 TACATTGCTTTTAGCATTTAGGG + Intergenic
1101969399 12:109302256-109302278 TTCATTGCATTTTACCTTTATGG - Intronic
1102032209 12:109747061-109747083 TACTTTGGATTTTAGATTTGGGG + Intronic
1102370570 12:112379909-112379931 TTAATTGCTTTTTAAATTTATGG - Intronic
1103860969 12:124013501-124013523 TAACTTTCATTTTAGATTTTAGG + Exonic
1104190201 12:126474517-126474539 TAACTTTCATTTTAGATTTGGGG - Intergenic
1105526251 13:21180322-21180344 TTCATTTCATTTTAGAGATAGGG - Intergenic
1106497955 13:30298001-30298023 TAACTTTTATTTTAGATTTAGGG - Intronic
1106704837 13:32269338-32269360 TACATTGCAATTTCTTTTTATGG + Intronic
1107234979 13:38157460-38157482 TTCATTAAATTTTAGATTCAGGG + Intergenic
1107292722 13:38874685-38874707 TACAATTCATTTGAGATTAAGGG - Intronic
1107643180 13:42465531-42465553 CAAATTTCATTTTAGATTCAGGG - Intergenic
1107766867 13:43744897-43744919 TACAATGCATCTTAGCATTACGG + Intronic
1108486968 13:50936432-50936454 TTGATTGCATTTTATGTTTAAGG + Intronic
1109090391 13:58036110-58036132 TACCTTGCAAATTAAATTTATGG + Intergenic
1109242851 13:59912154-59912176 TCCATTACATTTCAGCTTTAGGG + Intronic
1109514189 13:63419986-63420008 GACATTGCACCTTGGATTTATGG - Intergenic
1109532828 13:63674580-63674602 TACATTGTTTTTTACATTTTTGG + Intergenic
1109685462 13:65813610-65813632 TCCATTTCTTTTTAGATTTCAGG - Intergenic
1111080071 13:83293799-83293821 AAAATTACATTTTAGATTGAGGG + Intergenic
1111219794 13:85189318-85189340 TAACTTTTATTTTAGATTTAGGG - Intergenic
1111701999 13:91702276-91702298 TGCATAGCATTTTAGCTTGAAGG + Intronic
1111760663 13:92460200-92460222 TACAGTGCATTAGATATTTAAGG + Intronic
1112067429 13:95808585-95808607 TACATGGCTTTTTAGATTTTTGG - Intronic
1112397692 13:99048109-99048131 TCCATTGTATTTTAAAGTTATGG + Intronic
1112536326 13:100260201-100260223 TCCATTACATTGTTGATTTAGGG - Intronic
1113697818 13:112359784-112359806 TCCATTTTATTTTAGATTTGGGG + Intergenic
1115058919 14:29167715-29167737 TACATTGTATTTTGGAGGTATGG - Intergenic
1115203879 14:30880598-30880620 GACATTGCATTTCTGATTGATGG + Exonic
1115303133 14:31906797-31906819 TACATTTTATTTTAGATTCAGGG + Intergenic
1115461571 14:33666754-33666776 CACATTGCATTTGGGATTTTAGG - Intronic
1115467937 14:33736673-33736695 TTCTTTGCATTTCAGATTTTAGG + Intronic
1115563520 14:34604720-34604742 TACTTTGGATTTCAGATTTTCGG - Intronic
1115969980 14:38934124-38934146 TAAATTGTATTTTTGTTTTATGG - Intergenic
1116195484 14:41719979-41720001 TAACTTTCATTTTAGATTCAAGG + Intronic
1116206494 14:41874152-41874174 TTCATTGCATTTCACATTTGTGG + Intronic
1117853398 14:60000427-60000449 TTAATTTCATTTTAGATTCAGGG - Intronic
1118877865 14:69799615-69799637 TAACTTTTATTTTAGATTTAGGG + Intergenic
1120121680 14:80687716-80687738 TAAATTTTATTTTAGATTCAGGG - Intronic
1120471491 14:84931068-84931090 TATATTGTATTTAAAATTTAAGG - Intergenic
1120664536 14:87290667-87290689 TAAATTCCATTTTAGATTCAAGG + Intergenic
1122426668 14:101612784-101612806 AGCTTTGCATTTTACATTTAGGG - Intergenic
1122465079 14:101927637-101927659 TACATTGTATCTTTGTTTTATGG + Exonic
1124827243 15:33109819-33109841 TAACTTTCATTTTAGATTTGGGG - Intronic
1126886846 15:53159845-53159867 GACATTGCATTTAAGACTTAGGG + Intergenic
1127472155 15:59300004-59300026 TACATTACATTAAAGATTTAGGG - Intronic
1128213686 15:65919487-65919509 TACATTGTTTTTTAGACATAAGG - Intronic
1128282852 15:66411035-66411057 AACATTGCATTTGATATTGATGG - Intronic
1128491778 15:68154259-68154281 TACGTTGAATTTGAGATTCAAGG + Intronic
1130132111 15:81152783-81152805 TACATGACATTTTAGCTTAATGG + Intergenic
1130820580 15:87491058-87491080 TACTTTTTATTTTAGGTTTAGGG + Intergenic
1134284826 16:12851695-12851717 TACCTTTCATTTTAGGTTCAGGG - Intergenic
1134639160 16:15815416-15815438 TCCATTGCGTTTTAAATTTCTGG - Intronic
1135004802 16:18810538-18810560 TTAAATGCATTTTAGACTTATGG + Intronic
1136075310 16:27813096-27813118 TAACTTGCATTTTAGATTCAGGG + Intronic
1137317168 16:47337599-47337621 TGCATGGCTTTTTAGATTTTTGG + Intronic
1137756584 16:50906879-50906901 TAGCTTTTATTTTAGATTTAAGG + Intergenic
1138695132 16:58805980-58806002 TACATTACAGTTTAGAGTTGAGG + Intergenic
1138868913 16:60856972-60856994 TTCATTGCCTTTTACCTTTAGGG + Intergenic
1140425579 16:74858447-74858469 TATATTTTATTTTAGATTCAGGG + Intergenic
1141224467 16:82101961-82101983 TACAATGCATTGTTGATGTACGG - Intergenic
1141275309 16:82582371-82582393 TACATTGCAGATCAGTTTTAAGG + Intergenic
1141687002 16:85576193-85576215 TACAATGCAATTTATTTTTATGG + Intergenic
1142327884 16:89428988-89429010 TTCATTGCATCTTAGATGTTGGG - Intronic
1143250030 17:5516452-5516474 TAAATGGCTTTTTAGATTTAAGG + Intronic
1144578199 17:16443175-16443197 TGCATTACATTTTTCATTTAGGG - Intronic
1146042934 17:29474035-29474057 TACCTTGCATTTTTATTTTACGG + Intronic
1147697188 17:42364503-42364525 TACATAGCATTTTAGATCAGTGG - Intronic
1148378594 17:47174255-47174277 TTCTGTGCTTTTTAGATTTATGG - Intronic
1149087474 17:52735309-52735331 TACATTACTGTTTAGAGTTAGGG + Intergenic
1149109401 17:53009082-53009104 TAAATTGCATTATAAATTTCAGG - Intergenic
1149162829 17:53715212-53715234 GACACTGCAATTTAGATTTCAGG + Intergenic
1149247407 17:54727159-54727181 TATATTGCATTTGAAATGTATGG - Intergenic
1149953982 17:61024556-61024578 TACGGTGCATTTTAGGATTATGG + Intronic
1151038100 17:70824351-70824373 TACCTTGCCTTTTATTTTTATGG - Intergenic
1151111039 17:71678255-71678277 TACTTAGTATTTTAGTTTTAGGG - Intergenic
1152164817 17:78696104-78696126 TACATTGCACTTTAAGATTAAGG - Intronic
1155518548 18:26646673-26646695 CAAAATGCATTTTAGATTTTAGG - Intronic
1156739867 18:40311296-40311318 TACATTGCATTTTATATTTTAGG + Intergenic
1158704313 18:59777865-59777887 TAAATTTTATTTTAGATTCAGGG - Intergenic
1159252546 18:65898539-65898561 TACATTGCATTTTACATTCAAGG + Intergenic
1159350935 18:67271642-67271664 TAACTTTTATTTTAGATTTAGGG + Intergenic
1159517432 18:69475896-69475918 TAACTTTTATTTTAGATTTAAGG + Intronic
1159643904 18:70894785-70894807 TAAATTGCGTATTAAATTTATGG + Intergenic
1159663777 18:71131623-71131645 TCCATTGCATTTTAGAAATGTGG - Intergenic
1159745389 18:72228296-72228318 TAAATTTTATTTTAGGTTTAGGG - Intergenic
1159969451 18:74631268-74631290 TACCTTGCTTTCCAGATTTAAGG - Exonic
1160126792 18:76182278-76182300 TAAATTTCATTTTAGAATTTTGG + Intergenic
1164049678 19:21574148-21574170 TGCATTGCATTTTAGAGACAGGG - Intergenic
1164909171 19:31991915-31991937 TATTTTGTATTTTAGATTCAGGG - Intergenic
1165255241 19:34573775-34573797 TAAATTGTAGTTTAGATTCAAGG + Intergenic
1165267094 19:34669322-34669344 TAAATTGTAATTTAGATTCAAGG - Intronic
1168042088 19:53766768-53766790 TACATGGCTTTTTAGATTTTCGG - Intergenic
928522899 2:32107606-32107628 TATTTTGCATTTTGGATTTTTGG + Intronic
928569179 2:32585758-32585780 TACAATGCATGCTTGATTTAGGG - Intronic
928666181 2:33552648-33552670 TAAATTCCATTTTAAGTTTAAGG + Intronic
929841042 2:45463340-45463362 TATGTTACATTTTAAATTTAAGG - Intronic
930595797 2:53386815-53386837 AACATTGAATTTTATATTTCAGG - Intergenic
930683166 2:54279465-54279487 AACTTTTCATTTTAGAATTATGG + Intronic
931088025 2:58855575-58855597 TACAATACATTTTAGTTGTATGG - Intergenic
931791040 2:65664459-65664481 AACATTGCATTGCAGATTTAAGG - Intergenic
932289585 2:70565463-70565485 TACTATGTTTTTTAGATTTATGG + Intergenic
933032644 2:77350924-77350946 TAACTTGCATTTTAAGTTTAGGG + Intronic
934066815 2:88348985-88349007 TAACTTTTATTTTAGATTTAGGG - Intergenic
935418073 2:102839675-102839697 TACATTGCATTTGAGTTTTGTGG - Intronic
936728214 2:115348503-115348525 AACTTTTTATTTTAGATTTAGGG + Intronic
936927694 2:117754555-117754577 TAGATTGAATAGTAGATTTAAGG - Intergenic
936967022 2:118136869-118136891 TATTTTAAATTTTAGATTTATGG + Intergenic
938213508 2:129488445-129488467 TTGATGGCATTTTAGAATTATGG - Intergenic
939336420 2:140834536-140834558 GAAATTGTAATTTAGATTTATGG - Intronic
939513015 2:143130033-143130055 TAAATTTCATTTAAGATATAGGG + Intronic
939626962 2:144489479-144489501 TACTTTGTCTTTTAGAATTAAGG + Intronic
939704339 2:145433496-145433518 TTCATAGCATTTTTCATTTAAGG + Intergenic
939785803 2:146510571-146510593 AACATTGCATTTTACATAAAAGG - Intergenic
940665469 2:156603229-156603251 TACATTGCATTAGATATGTAAGG - Intronic
940838549 2:158552776-158552798 TACATTGGTTTTTAGACATAAGG - Intronic
941144128 2:161822192-161822214 TACATAGCAATTGAGATTTGGGG + Intronic
941356664 2:164502089-164502111 TACATTGAATTTTTTATTTTTGG - Intronic
941710577 2:168707954-168707976 TACATTTCATTTTTGCCTTAAGG + Intronic
941993619 2:171580525-171580547 TAACTTTCATTTTAGATTTGTGG + Intergenic
942050827 2:172139233-172139255 TAACTTCCATTTTAGATTTGGGG - Intergenic
943250395 2:185514489-185514511 TGTATTGCATTTTAAATTTCAGG + Intergenic
943263568 2:185697174-185697196 TACATTGCATTTTACCTGAAGGG - Intergenic
943602823 2:189941674-189941696 TTCATTGCTTTTTATTTTTAGGG - Intronic
944066837 2:195627931-195627953 TAAAATGCATTTTAGAAATATGG + Intronic
944986188 2:205180380-205180402 TTAATGGCATTTTATATTTAGGG + Intronic
945341246 2:208657794-208657816 TACATTGTATTTTCCATTTGGGG + Intronic
945982389 2:216323255-216323277 TATCTTGCATTTCAGATTGAAGG - Intronic
946901084 2:224372182-224372204 TAAATTGCATTTTTGACATATGG + Intergenic
947067762 2:226249758-226249780 TTTATTGCATATTAGATTTCAGG - Intergenic
948109027 2:235439741-235439763 TTCATTGCTTTTTGTATTTAGGG + Intergenic
948311733 2:236992237-236992259 GACATTGCATTGAAGACTTAAGG - Intergenic
1168732824 20:101850-101872 TTCATTTTATTTTTGATTTATGG - Intergenic
1169613531 20:7411700-7411722 TACCTTTTATTTTAGATTTAGGG + Intergenic
1169836659 20:9887772-9887794 TACATTGCATTTTTATGTTATGG + Intergenic
1170677083 20:18492330-18492352 TGCATTGCATTTTATTTTCATGG + Intronic
1171129635 20:22639380-22639402 TACATGGCCTTCTAGATTCACGG + Intergenic
1173692505 20:44974214-44974236 CAAATTGCGTTTTAGATCTATGG + Intronic
1174940821 20:54924820-54924842 TAGATTTAATTTTAGACTTATGG + Intergenic
1174954471 20:55081834-55081856 TAACTTGCATTTGAGATTCATGG + Intergenic
1174964391 20:55194988-55195010 TAAATTTTATTTTAGATTCAGGG - Intergenic
1177518676 21:22188737-22188759 TAAATTGTATTTAATATTTAAGG + Intergenic
1177867927 21:26535239-26535261 TAACTTTCATTTTAGATTCAGGG - Intronic
1178058200 21:28822951-28822973 TACTTTGCATTTTTGAATTTGGG + Intergenic
1178145896 21:29739469-29739491 TACACTGCCTTTTGGATTTTAGG - Intronic
1178210259 21:30522691-30522713 TACCTTTTATTTTAGATTCAGGG - Intergenic
1178556901 21:33600048-33600070 TAGAGTGCATTTTTGACTTACGG - Intronic
1178858383 21:36269093-36269115 CACATTGGATTTCAGACTTAGGG + Intronic
1182962275 22:34486846-34486868 TACATTACGTATTAGAATTATGG + Intergenic
1183006328 22:34905691-34905713 TAAAATGCTTTTTGGATTTAGGG - Intergenic
1183877267 22:40794245-40794267 AACAATGCATTTTAGTTTCATGG + Intronic
1184984846 22:48123540-48123562 AACATTTCATTTTATATTTATGG - Intergenic
949155718 3:825502-825524 TAAATTGATTTCTAGATTTAAGG + Intergenic
950562575 3:13743245-13743267 TAATTTTAATTTTAGATTTAGGG + Intergenic
953260785 3:41337188-41337210 TATATTGAATTTTATATTTCTGG + Intronic
953792548 3:45959250-45959272 CACATTGCGTTTTGGCTTTAAGG - Intronic
954542545 3:51403769-51403791 AGCATTGCATTTTAGATTCCAGG - Intronic
955425518 3:58785541-58785563 TACATAATATTTTACATTTATGG - Intronic
956491949 3:69781988-69782010 TTCATTGCACTAAAGATTTAGGG + Intronic
957479991 3:80780384-80780406 TAAATTTCATTTTAGGTTTAGGG - Intergenic
958192470 3:90200212-90200234 TTCTTTTCATTTTAGAATTAAGG - Intergenic
958699883 3:97575002-97575024 TAAATTAAATTTTAGATTCAGGG - Intronic
958922860 3:100125650-100125672 TAGATTGCATTTTCTATTTCTGG + Intronic
959156819 3:102676841-102676863 TACATTGCATTTTTGGTTTCTGG + Intergenic
959193781 3:103150619-103150641 TACATTGCATTTTATTTTGTTGG + Intergenic
960626896 3:119689949-119689971 GCCATTTCATTTTAGATTTGGGG - Intergenic
961111916 3:124291598-124291620 GACATGGGATTTGAGATTTAAGG + Intronic
961340955 3:126217630-126217652 TACATTGCATATTTTATTTCTGG - Intergenic
961489944 3:127248224-127248246 AACCTTGCCTTTTAGATTTTGGG - Intergenic
961980527 3:131073320-131073342 CAAATTGCCTTTTAGTTTTAAGG - Intronic
962115140 3:132497598-132497620 TATAATACATTTTAGATATATGG + Intronic
962893105 3:139690218-139690240 TACAGTGCATTATAGACCTAGGG - Intergenic
963186435 3:142422947-142422969 TACAGTGAATTTTATTTTTAAGG + Intronic
963569595 3:146976216-146976238 TACATGGCAATTTGTATTTATGG - Intergenic
964905692 3:161717391-161717413 TACATTGCATGTTACTTTTTTGG - Intergenic
965516183 3:169623999-169624021 TACATAGCATAATAGATTGATGG - Intronic
965891679 3:173521936-173521958 TAAATTACATTTTATATTCAGGG + Intronic
966061789 3:175766233-175766255 TAAATTACATCTAAGATTTACGG - Intronic
967434468 3:189428601-189428623 TAACTTGTATTTTAGATTCAGGG - Intergenic
967766867 3:193290697-193290719 TATATTGTATTTTTGATTTCAGG + Intronic
969178593 4:5420072-5420094 TTCTTTCCATTTTAGAGTTAAGG + Intronic
971450715 4:26799015-26799037 TTTATTTCATTTTAGATTCAGGG - Intergenic
972182262 4:36482669-36482691 GACATTGAAGTTTAAATTTATGG - Intergenic
972477957 4:39470310-39470332 TAACTTGTATTTTAGATTTGAGG - Intronic
972710698 4:41591693-41591715 TATATTGCATTTTAAATATGTGG + Intronic
974179834 4:58370519-58370541 TCCATTTAATTTTAAATTTAGGG + Intergenic
974403157 4:61429746-61429768 TAAATTGCAGTTTAGAAATATGG + Intronic
974423288 4:61706562-61706584 CACCTTGCATTTTAAAATTATGG + Intronic
974486419 4:62511473-62511495 TACATGGCCTTTTAGATTTTCGG + Intergenic
975090685 4:70400003-70400025 TACTTTGCATTATATATTTTTGG - Intronic
975283731 4:72593349-72593371 TATTTTACATTTCAGATTTATGG - Intergenic
975448499 4:74496693-74496715 TAGATTGCATTTTTTTTTTAAGG + Intergenic
975863215 4:78700038-78700060 TTCATTGGATTTTGGCTTTAGGG + Intergenic
975940953 4:79644993-79645015 TACTTTGTATTTTTGATTTGGGG - Intergenic
975949255 4:79748217-79748239 TACATTGCAATTTTTCTTTAGGG + Intergenic
976673250 4:87676965-87676987 TACATTTTATTTTAGATTCGCGG - Intergenic
977320230 4:95504843-95504865 TTCATTGCAGTTTAAATTTGGGG + Intronic
977491519 4:97718919-97718941 TACTTTGGATTTCAGATTTTTGG - Intronic
977621326 4:99140893-99140915 CACCTTTAATTTTAGATTTAAGG + Intronic
978667167 4:111197879-111197901 AAAATTTCATTTTAAATTTAAGG - Intergenic
978969858 4:114790752-114790774 CACATTACATTTTAGATTGGTGG + Intergenic
979294797 4:119019199-119019221 TAATTTTCATTTTAGGTTTAGGG - Intronic
979588513 4:122449634-122449656 TACCTAACATTTTAGATTTCAGG - Intergenic
979626083 4:122847183-122847205 TATATTTGATTTTAGATTTTTGG - Intronic
979707938 4:123743767-123743789 TACAGAGCATTTTAGTTTAAGGG - Intergenic
980461158 4:133115978-133116000 TACAATGCATTTTACATGTTTGG + Intergenic
980837297 4:138211409-138211431 AACAGTGAATTTTAGATTCAGGG - Intronic
980849986 4:138369673-138369695 AAAATTGCATTTTAGATATTGGG + Intergenic
981738468 4:147977662-147977684 TCCATTTTATTTTAGATTTGGGG + Intronic
981793662 4:148569562-148569584 TAATTTTAATTTTAGATTTAAGG - Intergenic
982371265 4:154636307-154636329 TACATTTCTTTTTATATTTTAGG + Intronic
983173383 4:164560153-164560175 TATTTTACATTTTAGATTCAGGG + Intergenic
983687219 4:170424753-170424775 TAATTTGCATTTTAGAAATAAGG - Intergenic
983956354 4:173703026-173703048 TTCATTTTATTTTAGATTCAAGG - Intergenic
983976681 4:173943374-173943396 TACATTTAATTTTGGCTTTAGGG + Intergenic
984028363 4:174572250-174572272 AACATTGCTATATAGATTTAAGG - Intergenic
984061547 4:174993895-174993917 TATCTTTCATTTTAGATTCAAGG - Intergenic
984329694 4:178298618-178298640 TATATTTCATTTTAGATTGTTGG - Intergenic
984999090 4:185467169-185467191 GAGAGTGCATTTTAGATTCATGG + Intronic
985786204 5:1896572-1896594 TACATTACATTTTCTCTTTAAGG - Intergenic
987449042 5:18058915-18058937 TACATTGCTTTATACATTTATGG + Intergenic
987471214 5:18330970-18330992 TAAATTGTATTTTACTTTTATGG + Intergenic
987591551 5:19934338-19934360 TCAATTGCATTTCAGATTTCTGG + Intronic
987866247 5:23542902-23542924 CACCTTTCATTTTAGATTTAGGG + Intergenic
987955632 5:24736084-24736106 TCCATTGAACTTTATATTTATGG + Intergenic
988068814 5:26260626-26260648 TAATTTTTATTTTAGATTTAGGG + Intergenic
988075231 5:26343839-26343861 TACATGGTATGTTAGATTAAGGG + Intergenic
988111848 5:26832232-26832254 TCCAATTCATTTTAGATTTCAGG - Intergenic
988172354 5:27675177-27675199 TTAATTATATTTTAGATTTATGG + Intergenic
988197105 5:28017867-28017889 TATGTTGCATTTTAGTTTTGAGG - Intergenic
988270864 5:29014695-29014717 TGTGTTGCATTTTAGATTTAAGG - Intergenic
988308965 5:29532314-29532336 TCTTTTTCATTTTAGATTTAGGG + Intergenic
988583720 5:32490975-32490997 TACATTACATTTGAGATTAGAGG + Intergenic
989262183 5:39430540-39430562 TCCATTGCATTGTGGTTTTATGG + Intronic
989518553 5:42373792-42373814 CACATTACATTTTAGATGGAAGG + Intergenic
989758197 5:44981824-44981846 CAAATTTCATTTTAGATTTAGGG - Intergenic
989788748 5:45365195-45365217 TATTTTTCATGTTAGATTTAGGG + Intronic
991908440 5:71536223-71536245 TACATGGCTTTTTAGATTTTCGG - Intronic
992696001 5:79288072-79288094 TAGACTTCATCTTAGATTTAAGG - Intronic
993119006 5:83752784-83752806 GACATTACATTTTAATTTTATGG - Intergenic
993185394 5:84612144-84612166 CACGTGGCATTTTACATTTAAGG - Intergenic
993666258 5:90700343-90700365 TAGAATGCATTTTTGATTCATGG + Intronic
993834012 5:92794372-92794394 TACATTGTACTTGAGATTTTAGG - Intergenic
993961680 5:94305064-94305086 CAAATTGCAATTTAGATTAATGG + Intronic
994794163 5:104272583-104272605 TACATTGCATTAGAGATATGTGG - Intergenic
995496089 5:112745254-112745276 TACATTGCTTATTAGATTAATGG - Intronic
995563175 5:113405108-113405130 AACATTGCTTTTTAGATATCAGG - Intronic
995823767 5:116269449-116269471 TATATTGACTTTTAGATTTCAGG + Intronic
995878317 5:116815876-116815898 TACATTAAATATTAGATTAAAGG - Intergenic
996211091 5:120811645-120811667 TTTATTTCATTTTAGATTCAGGG + Intergenic
996288216 5:121820579-121820601 TATTTTTCATTTTAGATTTGTGG - Intergenic
996587349 5:125105115-125105137 TACATTGCTTTTTTTGTTTAGGG + Intergenic
998329046 5:141307175-141307197 TGAATTTCATTTTAGATTCAAGG - Intergenic
998638992 5:143987905-143987927 TAATTTGCATTCTAGATTTTTGG - Intergenic
998909074 5:146938540-146938562 TACATTGCATTTTAAAAATCAGG + Intronic
999363694 5:151007256-151007278 TAAATTGCATTTTATAGTTGAGG - Intergenic
999566390 5:152867452-152867474 TCCTTTGCATTTTATATTTATGG - Intergenic
999668621 5:153938594-153938616 TCCATTGCATTTTAGCTAAAGGG + Intergenic
1000163848 5:158627929-158627951 TACATTACAATCTAGATTCAAGG + Intergenic
1000217591 5:159177577-159177599 TACAAAGCATTTTATAATTATGG - Intronic
1000523498 5:162327215-162327237 CATTTTGCATTTTACATTTAGGG - Intergenic
1000526628 5:162366948-162366970 TAACTTTTATTTTAGATTTATGG - Intergenic
1000803816 5:165762695-165762717 TAAATTTTATTTTAGATTTTTGG + Intergenic
1003830384 6:10003593-10003615 TAACTTGCATTTTAAATTTACGG - Intronic
1003887899 6:10537395-10537417 TTAAATGCATTTTTGATTTATGG - Intronic
1005802553 6:29441601-29441623 TAAATTTTATTTTAGATTCAAGG + Intronic
1007205549 6:40147257-40147279 TACATTTTCTTTTAGACTTAAGG + Intergenic
1008169844 6:48189732-48189754 TCCATTGTATTTTATTTTTAGGG + Intergenic
1008293200 6:49743820-49743842 TAAATTGCATTTTATGTTGATGG + Intronic
1008999061 6:57691765-57691787 TATATTTTATTTTAGATTCAGGG - Intergenic
1009016304 6:57907020-57907042 TTAATTACATTTTAGATTTATGG + Intergenic
1009187547 6:60591150-60591172 TATATTTTATTTTAGATTCAGGG - Intergenic
1009402431 6:63273256-63273278 AATATTACATTTTAGTTTTAAGG - Intergenic
1009521009 6:64682081-64682103 TATATTGCATTCTACCTTTAAGG + Intronic
1009820580 6:68795741-68795763 TGCTTTGCATTTTAAATTCAAGG - Intronic
1009894623 6:69733191-69733213 TACATTTCATATTATATTTAGGG + Intronic
1010114922 6:72292955-72292977 TGCATTTCATTTTATATTGAGGG + Intronic
1010305463 6:74316485-74316507 TAAATTTTATTTTAGATTCAAGG + Intergenic
1010602013 6:77840628-77840650 TGCATTTTATTTTAGATTCATGG + Intronic
1011637162 6:89385231-89385253 TACATAGCAATTTGCATTTATGG - Intronic
1011902859 6:92321938-92321960 TTCTTTTCATCTTAGATTTATGG - Intergenic
1011903568 6:92332524-92332546 TACTTGGCATTTTAAAATTATGG - Intergenic
1012055120 6:94396560-94396582 TACATTGCATTTTACAATTTAGG - Intergenic
1012686200 6:102252883-102252905 TACATTTCTTTTTAAATATAGGG + Intergenic
1012739477 6:102997396-102997418 TACATTGCATATTTTATCTAAGG + Intergenic
1013439336 6:110146680-110146702 TAATGTGCATTATAGATTTAGGG - Intronic
1014066969 6:117138254-117138276 CACATTGTATTTTTTATTTAGGG - Intergenic
1014230596 6:118897909-118897931 TACATTGATTTTTATGTTTATGG - Intronic
1014377991 6:120701179-120701201 TTCATTGGATCTTGGATTTAAGG - Intergenic
1014650748 6:124034133-124034155 TTATTTTCATTTTAGATTTAGGG + Intronic
1016154611 6:140789244-140789266 TACAATGTATTTTAAAGTTAAGG + Intergenic
1016237315 6:141883622-141883644 TAAATTTTATTTTAGATTTGGGG - Intergenic
1017052562 6:150407439-150407461 TTCTTTGCTTTTTAAATTTAAGG - Intergenic
1017183888 6:151580950-151580972 TATATTGTTTTTTAGATATAGGG - Intronic
1019116401 6:169766934-169766956 AGGCTTGCATTTTAGATTTAGGG + Intronic
1019398784 7:838707-838729 TACATTGCACTTTCAGTTTATGG + Intronic
1020752021 7:12153677-12153699 TACATTTCATGTTTGATTTTGGG - Intergenic
1021138074 7:16990498-16990520 TATATTGGATTCTAGATTTAAGG + Intergenic
1021189074 7:17599812-17599834 TACAGTGCATATTGGATTAAGGG - Intergenic
1023441506 7:40189412-40189434 TACTTTTTATTTTAGATTCAGGG + Intronic
1026559854 7:71439657-71439679 CACATTTTATTTTAAATTTAAGG + Intronic
1026605502 7:71812327-71812349 TACATTGTCTTTTAGAATTTTGG - Intronic
1027607350 7:80316950-80316972 TACAATGCATTTTATCTTAAGGG - Intergenic
1028040880 7:86052961-86052983 TAACTTTCATTTTAGATTCAGGG - Intergenic
1028367753 7:90054149-90054171 TACATTGCATTTTTGAGAAATGG + Intergenic
1028664661 7:93327524-93327546 TATATTGCATATTTGATTTAAGG + Intronic
1029427815 7:100507831-100507853 TTCTTTGCATTTTAAATTAAGGG - Intergenic
1029516903 7:101029948-101029970 TACATTGTATTTTCTATTGAAGG + Intronic
1030012623 7:105186198-105186220 TAAATTTTATTTTAGATTCAGGG + Intronic
1030352268 7:108503065-108503087 TACATTGCATATGGGATTCAAGG + Intronic
1030415030 7:109232185-109232207 TACATTTCATTTTAATGTTAAGG + Intergenic
1030578568 7:111321948-111321970 CATATGGCATTTTAGGTTTAAGG - Intronic
1031378101 7:121051905-121051927 TACGTGGCTTTTTAGATTTTCGG + Intronic
1031407694 7:121406021-121406043 TGGATTGCATTTTGGTTTTAAGG + Intergenic
1031657455 7:124375426-124375448 TTCACTGCATTATGGATTTATGG + Intergenic
1031772329 7:125860143-125860165 TAACTTTCATTTTAGGTTTAGGG + Intergenic
1033527416 7:142230307-142230329 TCAATTTCATTTTAGATTCAGGG + Intergenic
1033681060 7:143597317-143597339 TCCATCTCATTTTGGATTTATGG + Intergenic
1033703832 7:143864496-143864518 TCCATCTCATTTTGGATTTATGG - Intronic
1033807126 7:144967117-144967139 TAACTTTTATTTTAGATTTAGGG - Intergenic
1034280218 7:149848329-149848351 TAGACTGCATTTCAGATTTGAGG + Exonic
1036405592 8:8452130-8452152 CAACTTGTATTTTAGATTTAGGG - Intergenic
1036791064 8:11720452-11720474 TACCTTTTATTTTAGATTTGGGG + Intronic
1036923118 8:12877231-12877253 TTCAATTCATTTTAAATTTATGG + Intergenic
1037011804 8:13852591-13852613 TGAATTGTATTTTAGATTAAAGG - Intergenic
1037031355 8:14109683-14109705 TATATAGCAATTTAGTTTTAAGG - Intronic
1037228824 8:16629376-16629398 TACATTGTTTTATATATTTATGG - Intergenic
1037414299 8:18632449-18632471 CACATTGGATTTTTAATTTAGGG + Intronic
1038025471 8:23585036-23585058 TACATTGTTTTTTAGACGTAAGG - Intergenic
1038235029 8:25745002-25745024 TAGGTTGCATTTTAGAGTTCTGG + Intergenic
1038915855 8:32021780-32021802 TGCATTCTATTTTAAATTTAGGG - Intronic
1038979430 8:32741282-32741304 TACATGTCATTTTGCATTTAAGG - Intronic
1039139423 8:34368995-34369017 CAGATTTTATTTTAGATTTAGGG - Intergenic
1039670709 8:39594586-39594608 TTCATAGAATTCTAGATTTATGG + Intronic
1039815066 8:41086474-41086496 GATATTGCATTTTAGATTAAAGG + Intergenic
1040452100 8:47558289-47558311 TTTATTTTATTTTAGATTTAAGG - Intronic
1040901829 8:52425539-52425561 TACACTGCATTTTGGATGAATGG - Intronic
1040911574 8:52524431-52524453 TAACTTGTATTTTAGATTCAGGG + Intergenic
1041284906 8:56250572-56250594 TACATTGAATCTTAAATTTATGG + Intergenic
1041726413 8:61021729-61021751 TACCTTTTATTTTAGATTCAGGG + Intergenic
1041987624 8:63944485-63944507 GACATTGTATTTTACATTTCTGG + Intergenic
1042164118 8:65929211-65929233 TAAATTGCACTTAAAATTTAAGG + Intergenic
1042299599 8:67262817-67262839 TACATTGTTTTTTAGACATAAGG + Intronic
1042843662 8:73149099-73149121 TACATTTGATTGTAGATTTAGGG - Intergenic
1042843674 8:73149195-73149217 TATATTTGATTGTAGATTTAGGG - Intergenic
1042843680 8:73149243-73149265 TATATTTGATTGTAGATTTAGGG - Intergenic
1042843691 8:73149339-73149361 TATATTTGATTGTAGATTTAGGG - Intergenic
1042843697 8:73149387-73149409 TATATTTGATTGTAGATTTAGGG - Intergenic
1042843714 8:73149531-73149553 TATATTTGATTGTAGATTTAGGG - Intergenic
1042843720 8:73149579-73149601 TATATTTGATTGTAGATTTAGGG - Intergenic
1042843726 8:73149627-73149649 TATATTTGATTGTAGATTTAGGG - Intergenic
1042843732 8:73149675-73149697 TATATTTGATTGTAGATTTAGGG - Intergenic
1042843738 8:73149723-73149745 TATATTTGATTATAGATTTAGGG - Intergenic
1042843744 8:73149771-73149793 TATATTTGATTGTAGATTTAGGG - Intergenic
1042843749 8:73149819-73149841 TATATTTGATTGTAGATTTAGGG - Intergenic
1042843755 8:73149867-73149889 TATATTTGATTGTAGATTTAGGG - Intergenic
1042843761 8:73149915-73149937 TATATTTGATTGTAGATTTAGGG - Intergenic
1042843767 8:73149963-73149985 TATATTTGATTATAGATTTAGGG - Intergenic
1042843773 8:73150011-73150033 TATATTTGATTGTAGATTTAGGG - Intergenic
1042843779 8:73150059-73150081 TATATTTGATTATAGATTTAGGG - Intergenic
1042843785 8:73150107-73150129 TATATTTGATTATAGATTTAGGG - Intergenic
1043117755 8:76280817-76280839 AACATTACATCTTAGCTTTATGG - Intergenic
1046305453 8:112358895-112358917 TAACTTTTATTTTAGATTTAGGG - Intronic
1046491841 8:114963294-114963316 AACAATGTATTTTAGATTAAAGG - Intergenic
1047099194 8:121657622-121657644 TATATAGGATTTTAGATTCAGGG + Intergenic
1047099199 8:121657663-121657685 TATATAGGATTTTAGATTCAGGG + Intergenic
1048066807 8:130978293-130978315 GAATTTGCAATTTAGATTTATGG - Intronic
1048399697 8:134052889-134052911 TAAATAGCAATTTAGATGTAGGG - Intergenic
1048836975 8:138529076-138529098 TAACTTGCATTTTGGATTCAGGG - Intergenic
1050013177 9:1206095-1206117 CACCTTTTATTTTAGATTTAGGG - Intergenic
1050141749 9:2523368-2523390 TATTTTCTATTTTAGATTTAGGG + Intergenic
1050575114 9:6986766-6986788 TAAATAACATTTTACATTTATGG + Intronic
1050684803 9:8156094-8156116 AATATGTCATTTTAGATTTATGG - Intergenic
1051031019 9:12678480-12678502 TTCATTTAATTTAAGATTTATGG - Intergenic
1051462737 9:17340977-17340999 TCCATTCCATTTAATATTTAGGG - Intronic
1052550090 9:29937285-29937307 TAAATTGTATTTTTGCTTTATGG + Intergenic
1052874159 9:33540603-33540625 TAGATTCAATTTGAGATTTAGGG + Intronic
1053328732 9:37183472-37183494 TACATTACTTTTTAGGTTTTGGG + Intronic
1053501887 9:38603740-38603762 TAGATTCAATTTGAGATTTAGGG - Intergenic
1054727511 9:68667078-68667100 TAAATTGCATTTTATCATTAAGG + Intergenic
1055267002 9:74505424-74505446 TACATTTCTTTTTATATATATGG - Intronic
1055358047 9:75458138-75458160 TAAATTGAATTATAGATTTCTGG + Intergenic
1055817571 9:80225081-80225103 CACATTATATTTTAGATTCAGGG + Intergenic
1056202086 9:84286563-84286585 TACATTACTTTTTAAATTTGGGG + Intronic
1056387943 9:86114839-86114861 TTCATAGCACTTTAGATTTGTGG + Intergenic
1056480276 9:86996546-86996568 TTCAGATCATTTTAGATTTAAGG + Intergenic
1058416733 9:104796456-104796478 TGCATTGTATATTTGATTTAGGG - Intronic
1058744727 9:107979244-107979266 AACATTCCATTGTAGACTTAAGG - Intergenic
1059084461 9:111285077-111285099 TGCATTGATTTTTAGATGTATGG + Intergenic
1059120134 9:111634154-111634176 AAACTTGCATTTTAAATTTATGG + Intronic
1059175354 9:112165180-112165202 TACATAGCTGTTTATATTTATGG + Intronic
1059313218 9:113402483-113402505 TACTTTATATTTTAAATTTAAGG + Intergenic
1061421558 9:130475497-130475519 CACATTGTATTTTAGAGTGATGG - Intronic
1062104717 9:134748476-134748498 AACCTTGCATTTAAGATTTGGGG - Intronic
1185840534 X:3385953-3385975 GACATTGCATTTTATTTTAATGG - Intergenic
1187665684 X:21606960-21606982 TAGATTGCATATCAAATTTAAGG + Intronic
1187853709 X:23616415-23616437 TAACTTTTATTTTAGATTTAGGG - Intergenic
1187896475 X:23985397-23985419 TACATTCCCTTTTAAAATTATGG - Exonic
1188140880 X:26549186-26549208 CACTTTGTATTTTAGATTAAGGG - Intergenic
1188682458 X:33027529-33027551 TAAATTACATTTCATATTTAAGG + Intronic
1188798045 X:34490657-34490679 TACCTTTCATTTTAGTTTCAGGG + Intergenic
1189173190 X:38929238-38929260 TAACTTGTATTTTAGATTCAGGG - Intergenic
1190977000 X:55415425-55415447 TAAATTGAATTTTAGCTATATGG + Intergenic
1191144664 X:57153433-57153455 TATATTGTATTTTAATTTTATGG + Intergenic
1192690617 X:73359137-73359159 TAACTTGTATTTTAGATTTAGGG + Intergenic
1193024608 X:76832076-76832098 TAAATTTTATTTTAGATTCAGGG + Intergenic
1193035233 X:76943003-76943025 TAACTTTTATTTTAGATTTAGGG + Intergenic
1193785838 X:85758991-85759013 TAAATTGTATTTTTGTTTTATGG + Intergenic
1194194612 X:90877487-90877509 TAAGTTTCATTTTAGGTTTAGGG + Intergenic
1194225862 X:91256135-91256157 TACATTCCTTTTTAGAGTTTGGG - Intergenic
1194473104 X:94322211-94322233 CAAATTTTATTTTAGATTTAGGG + Intergenic
1195093021 X:101481463-101481485 TTAAATGCATTTTAGATTTATGG + Intronic
1195204705 X:102586162-102586184 TACATGGCTTTTTAGATTTTCGG - Intergenic
1195464109 X:105160648-105160670 TACATTCTCTCTTAGATTTATGG - Intronic
1195504870 X:105645452-105645474 CACATTGCATTTGAGACTTTTGG - Intronic
1195699772 X:107695699-107695721 TAAATTGTATTTTAGATTCAGGG - Intergenic
1195805143 X:108757183-108757205 TAAATTTTATTTTAGATTCAGGG - Intergenic
1195988917 X:110663228-110663250 TAGTTTTCATTTTAGATTCAGGG - Intergenic
1196039721 X:111188926-111188948 TAAATTTTATTTTAGATTTAGGG + Intronic
1196651948 X:118177044-118177066 CACATTGCATTTGACATTAATGG + Intergenic
1196678701 X:118447995-118448017 TACAAAGCATTTTATATGTATGG + Intronic
1197238742 X:124098854-124098876 TACATAAAATTCTAGATTTATGG + Intronic
1197484937 X:127037112-127037134 TTCATGGCATTTTAGTTTTTTGG - Intergenic
1197486646 X:127059672-127059694 AACATTGCATTTTTCATTTGTGG + Intergenic
1197589738 X:128393719-128393741 AAGATTACATTTTAGAGTTATGG + Intergenic
1197924793 X:131634879-131634901 AACATTTTATTTTAGATTCAGGG - Intergenic
1199659289 X:150031975-150031997 TACATTGCATTTTCTGTTCAGGG - Intergenic
1199775143 X:151004181-151004203 TATTTTTCATTTTAGATTCAGGG + Intergenic
1199926329 X:152468910-152468932 TACATTATTTTTTAGAATTATGG + Intergenic
1200036195 X:153333020-153333042 CAACTTTCATTTTAGATTTAGGG - Intergenic
1200541229 Y:4459889-4459911 TAAGTTTCATTTTAGGTTTAGGG + Intergenic