ID: 922335811

View in Genome Browser
Species Human (GRCh38)
Location 1:224617411-224617433
Sequence GGCACCGAAGGCGCGCCCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 55}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922335811_922335818 -6 Left 922335811 1:224617411-224617433 CCGCCGGGCGCGCCTTCGGTGCC 0: 1
1: 0
2: 0
3: 7
4: 55
Right 922335818 1:224617428-224617450 GGTGCCCTGGCTGGAGGCGAGGG 0: 1
1: 0
2: 3
3: 49
4: 520
922335811_922335829 29 Left 922335811 1:224617411-224617433 CCGCCGGGCGCGCCTTCGGTGCC 0: 1
1: 0
2: 0
3: 7
4: 55
Right 922335829 1:224617463-224617485 CAGGTAGGACACCCTCTGCAGGG 0: 1
1: 0
2: 0
3: 9
4: 163
922335811_922335823 10 Left 922335811 1:224617411-224617433 CCGCCGGGCGCGCCTTCGGTGCC 0: 1
1: 0
2: 0
3: 7
4: 55
Right 922335823 1:224617444-224617466 GCGAGGGGCCGCTGGTGCCCAGG 0: 1
1: 0
2: 4
3: 29
4: 287
922335811_922335828 28 Left 922335811 1:224617411-224617433 CCGCCGGGCGCGCCTTCGGTGCC 0: 1
1: 0
2: 0
3: 7
4: 55
Right 922335828 1:224617462-224617484 CCAGGTAGGACACCCTCTGCAGG 0: 1
1: 0
2: 0
3: 12
4: 169
922335811_922335819 -5 Left 922335811 1:224617411-224617433 CCGCCGGGCGCGCCTTCGGTGCC 0: 1
1: 0
2: 0
3: 7
4: 55
Right 922335819 1:224617429-224617451 GTGCCCTGGCTGGAGGCGAGGGG 0: 1
1: 1
2: 2
3: 135
4: 5462
922335811_922335817 -7 Left 922335811 1:224617411-224617433 CCGCCGGGCGCGCCTTCGGTGCC 0: 1
1: 0
2: 0
3: 7
4: 55
Right 922335817 1:224617427-224617449 CGGTGCCCTGGCTGGAGGCGAGG 0: 1
1: 0
2: 1
3: 21
4: 315
922335811_922335824 14 Left 922335811 1:224617411-224617433 CCGCCGGGCGCGCCTTCGGTGCC 0: 1
1: 0
2: 0
3: 7
4: 55
Right 922335824 1:224617448-224617470 GGGGCCGCTGGTGCCCAGGTAGG 0: 1
1: 0
2: 4
3: 20
4: 380
922335811_922335822 2 Left 922335811 1:224617411-224617433 CCGCCGGGCGCGCCTTCGGTGCC 0: 1
1: 0
2: 0
3: 7
4: 55
Right 922335822 1:224617436-224617458 GGCTGGAGGCGAGGGGCCGCTGG 0: 1
1: 0
2: 4
3: 51
4: 561

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922335811 Original CRISPR GGCACCGAAGGCGCGCCCGG CGG (reversed) Intronic
900255066 1:1693563-1693585 GGGGCCGCAGGCGCGCCCGCGGG - Intronic
900263809 1:1746829-1746851 GGGGCCGCAGGCGCGCCCGCGGG - Intergenic
902228892 1:15014829-15014851 GGCACGGAAGGCGGGACAGGTGG - Intronic
904252987 1:29237828-29237850 GCCACCGCAGGAGCGCCCGCCGG - Intronic
905137007 1:35807999-35808021 GGGAACGAGCGCGCGCCCGGAGG - Intergenic
906514787 1:46432482-46432504 GGCACTGAAGGTGCACCAGGAGG + Intergenic
906636974 1:47416373-47416395 GGCCCCGACGGCGCGACCGCTGG - Exonic
911707008 1:101025792-101025814 GGCACCGTAGGTGAGGCCGGCGG - Intronic
912915609 1:113811933-113811955 GGCAGCGACAGCGGGCCCGGCGG + Exonic
922335811 1:224617411-224617433 GGCACCGAAGGCGCGCCCGGCGG - Intronic
1062930195 10:1347766-1347788 TGCACCGAAGGCACCCCCAGTGG + Intronic
1064230951 10:13528972-13528994 GGCCCCGAAGACGCGGCGGGCGG + Intronic
1064393375 10:14960035-14960057 GGTTCCGAAAGCACGCCCGGCGG - Intronic
1075520752 10:123142388-123142410 GGCTCAGAATGAGCGCCCGGTGG - Intergenic
1076981443 11:207094-207116 AGGACCGAAGGCGCGCGTGGCGG - Intronic
1077008663 11:370444-370466 TTCACCGAAGGCGCCCCCGCCGG - Intronic
1079136013 11:17776395-17776417 GGCACCGGAGGGGCGCACGCGGG - Intronic
1092163238 12:6327638-6327660 GGCCCCGAAGCCGGGCCCTGTGG - Exonic
1093728720 12:22544254-22544276 GACAGCGAAGGAGCGCGCGGGGG + Intronic
1093894789 12:24563197-24563219 GGCAGGGAGGGCGCGCGCGGGGG + Intergenic
1095450512 12:42326103-42326125 GGCCCCGAAGGCGGGCCCAGAGG + Exonic
1101372069 12:104138690-104138712 GGCGCTGAAGGCGCTCCAGGAGG - Intergenic
1102197236 12:111034279-111034301 TGCGCCCAGGGCGCGCCCGGGGG - Intronic
1105472031 13:20703606-20703628 AGCAGGGATGGCGCGCCCGGGGG + Intronic
1106337416 13:28796378-28796400 GGCACCAAGGGCCCGCCCTGTGG - Intergenic
1112050607 13:95641731-95641753 GGCCCCGAAGCCGCGCTGGGGGG + Exonic
1112402097 13:99086411-99086433 GGCGCCGAGGGCGCACCTGGCGG - Intronic
1113653353 13:112053676-112053698 GGCACCGGAGGCGGCCCCTGGGG - Intergenic
1128353915 15:66911243-66911265 GGCACCGCAGGCTCACCCGGTGG + Intergenic
1138105135 16:54284032-54284054 GGCACCCCAGGCGCGGCCGGAGG - Intronic
1142737243 17:1908708-1908730 GGCAGGGAAGGCGCGGGCGGGGG - Intergenic
1147161008 17:38569416-38569438 GACATCGAAGGCGCCCCTGGGGG + Intronic
1155054449 18:22171625-22171647 GCCTACGACGGCGCGCCCGGCGG + Exonic
1160907217 19:1457003-1457025 GGCACCGAGGCCGCGGCCGGGGG + Exonic
1161309391 19:3585655-3585677 GGCTCCGAGGGCGCGGGCGGGGG - Exonic
1166948596 19:46412150-46412172 GGCGCCGAGGGCGGGCCCCGGGG - Exonic
1167239359 19:48334007-48334029 GGCACTCAAGGCTCGCCCGAAGG - Exonic
925003994 2:427206-427228 GGCTCCGCAGGCACGCCGGGGGG + Intergenic
927714178 2:25341782-25341804 GGCCCGGAAGGCCGGCCCGGAGG - Intronic
927824448 2:26298493-26298515 GGCATCCAAGGCGCGCCATGGGG + Intergenic
927945786 2:27134423-27134445 GGCAGTGAACGCGCGCCGGGCGG - Exonic
937208569 2:120252825-120252847 GACGCCGGAGGCGCGCTCGGGGG + Exonic
937264101 2:120605373-120605395 GGCTCCGATGGGGCGCCTGGAGG - Intergenic
1172619373 20:36309023-36309045 GGAACTGAAGGCCCGCCAGGGGG - Intronic
1172661740 20:36573469-36573491 GGCGCCGACGGCCCGCCCCGCGG + Exonic
1176120943 20:63454357-63454379 GGCACAGATGGCGCTGCCGGGGG + Intronic
1181006429 22:20016005-20016027 GGCACCGAGGGGGCGCAGGGCGG + Intronic
1181283486 22:21736030-21736052 GGCTCCGAGGCCGCGCCCGGCGG - Intergenic
1181492417 22:23268860-23268882 GGCACTGGAGGCGAGGCCGGAGG + Intronic
968599469 4:1502186-1502208 GGCACGGCAGGCGCGCCGGGGGG + Intergenic
971195607 4:24470437-24470459 AGCACCCAAGGCCCGCCAGGCGG + Intergenic
991298197 5:65103110-65103132 GGCAGCGTCGGGGCGCCCGGAGG - Intergenic
1002874695 6:1200835-1200857 GACAGCGAAGGCGAGCCCGTTGG - Intergenic
1005968664 6:30744327-30744349 GGCACCGAAAGCGCAGCCGCAGG - Exonic
1021998342 7:26201642-26201664 GGCAGCGGGCGCGCGCCCGGCGG - Intronic
1025188992 7:56882472-56882494 GTCACCGAAGTCGCGCCCTAAGG + Intergenic
1027361802 7:77416600-77416622 AGCCCCGAAGGTGCGCGCGGAGG - Intergenic
1029125728 7:98293994-98294016 GGCACCGAAGGCCCTTCCGGGGG + Intronic
1040471417 8:47738228-47738250 GGCACCGCGGGGGCGCCCCGGGG + Exonic
1061489940 9:130939236-130939258 GGCCCCGAGGGCGCCCCCGCCGG + Intronic
1061497844 9:130985843-130985865 GGCACTGGAGGGGTGCCCGGCGG + Intergenic
1190337197 X:49269823-49269845 GGCACCGGCGGCGGGACCGGCGG - Intronic
1200093576 X:153647128-153647150 GGCTCCGGGGGCGGGCCCGGCGG - Intronic