ID: 922335837

View in Genome Browser
Species Human (GRCh38)
Location 1:224617487-224617509
Sequence CGGGACCCGGGACGCCCAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 78}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922335837_922335845 -8 Left 922335837 1:224617487-224617509 CCGACTGGGCGTCCCGGGTCCCG 0: 1
1: 0
2: 0
3: 3
4: 78
Right 922335845 1:224617502-224617524 GGGTCCCGGGCGCCGGGGAGTGG 0: 1
1: 0
2: 3
3: 46
4: 593
922335837_922335846 -5 Left 922335837 1:224617487-224617509 CCGACTGGGCGTCCCGGGTCCCG 0: 1
1: 0
2: 0
3: 3
4: 78
Right 922335846 1:224617505-224617527 TCCCGGGCGCCGGGGAGTGGCGG 0: 1
1: 0
2: 4
3: 25
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922335837 Original CRISPR CGGGACCCGGGACGCCCAGT CGG (reversed) Intronic
900156813 1:1206468-1206490 CCGCACCCGGGACCCCCGGTGGG + Exonic
900174729 1:1286652-1286674 CCCTACTCGGGACGCCCAGTGGG - Intronic
900617476 1:3571858-3571880 CAGGACCCAGGACACCCAGGAGG - Intronic
906214431 1:44030696-44030718 CGGGACCCGGGAAGCCGCGCGGG - Intronic
910771522 1:90836258-90836280 CGGGATCCTGAACGCCCAGCGGG + Intergenic
922335837 1:224617487-224617509 CGGGACCCGGGACGCCCAGTCGG - Intronic
1065020239 10:21496646-21496668 CAGGACCCGAGACCCCCAGCTGG + Intronic
1077181405 11:1218822-1218844 AGGGCACCGGGACGCCCAGGTGG + Intergenic
1077222423 11:1423674-1423696 GGGCACCCGGAACGCCCAGCGGG - Intronic
1077222437 11:1423706-1423728 GGGCACCCGGAACGCCCAGCGGG - Intronic
1077222451 11:1423738-1423760 GGGCACCCGGAACGCCCAGCGGG - Intronic
1077222465 11:1423770-1423792 GGGCACCCGGAACGCCCAGCGGG - Intronic
1077222479 11:1423802-1423824 GGGCACCCGGAACGCCCAGCGGG - Intronic
1079650308 11:22920197-22920219 CAGGACCCAGGAGGCCCAGCTGG + Intergenic
1085157211 11:74306808-74306830 CTGGACCTGGGTCTCCCAGTGGG + Intronic
1091933585 12:4416953-4416975 CTGGACCCAGGAAGCCCAGCTGG + Intergenic
1100309042 12:93377773-93377795 CGGGACCTCGGCCGCCCGGTGGG - Intergenic
1103505615 12:121440879-121440901 CCGGACCCTGGATGTCCAGTGGG - Exonic
1105071352 12:133235939-133235961 CGGCCCCCGGGACGCCTTGTGGG - Exonic
1106250391 13:27978069-27978091 AGGGACCCGGGACGCACAACCGG - Exonic
1112091844 13:96091003-96091025 CGGGACCCGGGACGGCGGGCGGG - Exonic
1116816224 14:49586163-49586185 CGGCACCAGCGACTCCCAGTCGG + Intronic
1119357528 14:74019387-74019409 AGGGAACCGGGACGCCGAGCTGG - Exonic
1119702136 14:76762383-76762405 TGAGACCCAGGGCGCCCAGTGGG + Exonic
1126109339 15:45166723-45166745 CGGGCCCGGGGAGGCCCACTGGG - Intergenic
1132055223 15:98647407-98647429 CGGGTCCCGGGGCGCCGAGGAGG - Intergenic
1136377889 16:29876382-29876404 GTGGACCCGGGGAGCCCAGTGGG + Intronic
1138928492 16:61621930-61621952 CAGGACATGGGACCCCCAGTTGG + Intergenic
1141946130 16:87311165-87311187 CAGGACCTGGGGCACCCAGTAGG + Exonic
1147720364 17:42536237-42536259 CGGGTCCCGCGACGGCCAGGGGG - Exonic
1149614773 17:57988348-57988370 CGGCAGCGGGGACGCCCAGAGGG - Intergenic
1151642274 17:75405178-75405200 AGGGGCCCGGGAAGCCCAGGCGG - Exonic
1152468444 17:80477982-80478004 CGGCACCCGGGACTGCCCGTGGG - Intergenic
1153794459 18:8609657-8609679 CGGGGCCCGGGGCGCGCAGCCGG + Exonic
1155209155 18:23586252-23586274 CGGCCACCGGGACGCCCTGTGGG - Intronic
1161104979 19:2438807-2438829 CTGGACCCAGGACGACCATTTGG + Intronic
1161313080 19:3605242-3605264 CGGGACCCGGGAGGTGCAGCTGG + Intronic
1162621703 19:11848984-11849006 CGGGACCCGGGCCTCCCTGTGGG + Intronic
1162630767 19:11925344-11925366 CGGGACCCGGGCCTCCCTGTGGG + Intronic
1162635638 19:11965282-11965304 CGGGACCCGGGCCTCCCTGCGGG + Intronic
1162672108 19:12266190-12266212 CGGGACCCGGGCCTCCCTGCGGG - Intronic
1163586913 19:18169249-18169271 CGGGGCCCGGGGCGCGCACTGGG - Exonic
1164595443 19:29528498-29528520 CGGGACCCGAGGCGGCCAGAAGG - Intronic
925394022 2:3519408-3519430 CCCGACCCCGGCCGCCCAGTGGG - Exonic
930730458 2:54723737-54723759 CGGGATCCGGGACGCGCCGGTGG + Intronic
948784987 2:240347640-240347662 CCGGCCCTGGGACCCCCAGTGGG + Intergenic
948872787 2:240812092-240812114 CGTGGCCCGGTGCGCCCAGTGGG - Intronic
1173202298 20:40962923-40962945 CGGGACTGGGGAAGCCCAGATGG - Intergenic
1185122146 22:48977714-48977736 CGACACCCGTGATGCCCAGTGGG + Intergenic
1203255546 22_KI270733v1_random:135717-135739 CGGGTGCGGGGACGCCCCGTGGG - Intergenic
953672612 3:44975852-44975874 CGGGCCGGGGGACTCCCAGTGGG - Intronic
961511164 3:127404641-127404663 AGGGGCCAGGGAAGCCCAGTGGG + Intergenic
962316763 3:134364081-134364103 CGGGACCCGGGATGCGCCTTGGG + Intronic
970018415 4:11539033-11539055 CAGGACCCAGGACCCCCAGCTGG + Intergenic
983071179 4:163269876-163269898 CTGGAGCAGGGGCGCCCAGTTGG - Intergenic
983936948 4:173508820-173508842 CGGGGCCCGGGAGGCCGAGGTGG + Intergenic
986320979 5:6632826-6632848 CGGGGTCCGGGAAGCCCAGGAGG + Intronic
987385380 5:17324058-17324080 CAGGACCCAGGAAGCCCAGGAGG - Intergenic
990308640 5:54517918-54517940 CGGGAGTCGGGACCGCCAGTCGG + Exonic
995650120 5:114361193-114361215 GGGGACCCGGGAAGCCCGGCCGG + Intronic
1000011799 5:157240214-157240236 GTGGACCCGGGCCGCCCAGCAGG + Intronic
1001652788 5:173327677-173327699 CGGCACGCGGGAGGCCCAGAGGG - Intronic
1002281125 5:178130760-178130782 CCGGCCCCGGGCCTCCCAGTCGG - Intergenic
1007708015 6:43803252-43803274 CTGGGCCCAGGACGCACAGTAGG + Intergenic
1008459947 6:51757091-51757113 CGGGAACCAGGACGCACAGCAGG - Intronic
1011225004 6:85095918-85095940 CTGGACCCAGGAAGCCCAGCTGG - Intergenic
1018909834 6:168095601-168095623 CGGGTCCCGGGAGGCCTGGTAGG - Intergenic
1020130050 7:5554739-5554761 TGGGGCCAGGGACTCCCAGTAGG - Intronic
1024359548 7:48454510-48454532 CGGGAGCAGGGAGGCGCAGTGGG + Intronic
1024579891 7:50793146-50793168 CGGGGCCCGGGACGGCCAGGCGG - Intronic
1034306314 7:150047755-150047777 CGGGCCCCTGGCCGCCCAGGAGG + Intergenic
1034634695 7:152557840-152557862 CGGCAACCGGCACGCACAGTGGG - Intergenic
1034800533 7:154052898-154052920 CGGGCCCCTGGCCGCCCAGGAGG - Intronic
1037590010 8:20304152-20304174 CGGGACCCGGGACCCCGCGCAGG - Intergenic
1038883431 8:31639336-31639358 CGGGGACGGGGACGCCCAGGAGG + Intergenic
1045929713 8:107607095-107607117 CTCGACCCGGGAAGCCCAGCTGG + Intergenic
1049822889 8:144646856-144646878 CGGGACCAGACACGCCCAGAGGG + Intergenic
1056846213 9:90040260-90040282 GGGGTTCCGGGAGGCCCAGTAGG - Intergenic
1058110764 9:101029051-101029073 CGGGAGCCGGACGGCCCAGTAGG + Exonic
1062453986 9:136627178-136627200 GGGGACCCAGGAAGCCCAGCTGG + Intergenic
1203471942 Un_GL000220v1:118852-118874 CGGGTGCGGGGACGCCCCGTGGG - Intergenic
1187518280 X:19991335-19991357 CTGGACCTGGAACGCCCATTAGG - Intergenic