ID: 922335841

View in Genome Browser
Species Human (GRCh38)
Location 1:224617496-224617518
Sequence CGTCCCGGGTCCCGGGCGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 215}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922335833_922335841 -2 Left 922335833 1:224617475-224617497 CCTCTGCAGGGCCCGACTGGGCG 0: 1
1: 0
2: 5
3: 11
4: 144
Right 922335841 1:224617496-224617518 CGTCCCGGGTCCCGGGCGCCGGG 0: 1
1: 0
2: 2
3: 26
4: 215
922335825_922335841 21 Left 922335825 1:224617452-224617474 CCGCTGGTGCCCAGGTAGGACAC 0: 1
1: 0
2: 1
3: 17
4: 156
Right 922335841 1:224617496-224617518 CGTCCCGGGTCCCGGGCGCCGGG 0: 1
1: 0
2: 2
3: 26
4: 215
922335832_922335841 -1 Left 922335832 1:224617474-224617496 CCCTCTGCAGGGCCCGACTGGGC 0: 1
1: 0
2: 2
3: 22
4: 171
Right 922335841 1:224617496-224617518 CGTCCCGGGTCCCGGGCGCCGGG 0: 1
1: 0
2: 2
3: 26
4: 215
922335827_922335841 11 Left 922335827 1:224617462-224617484 CCAGGTAGGACACCCTCTGCAGG 0: 1
1: 0
2: 1
3: 15
4: 148
Right 922335841 1:224617496-224617518 CGTCCCGGGTCCCGGGCGCCGGG 0: 1
1: 0
2: 2
3: 26
4: 215
922335826_922335841 12 Left 922335826 1:224617461-224617483 CCCAGGTAGGACACCCTCTGCAG 0: 1
1: 0
2: 0
3: 10
4: 227
Right 922335841 1:224617496-224617518 CGTCCCGGGTCCCGGGCGCCGGG 0: 1
1: 0
2: 2
3: 26
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922335841 Original CRISPR CGTCCCGGGTCCCGGGCGCC GGG Intronic