ID: 922336176

View in Genome Browser
Species Human (GRCh38)
Location 1:224619779-224619801
Sequence AGCGCCCAATTCATTTTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 169}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922336176_922336181 24 Left 922336176 1:224619779-224619801 CCCCAAAAAATGAATTGGGCGCT 0: 1
1: 0
2: 0
3: 12
4: 169
Right 922336181 1:224619826-224619848 CCTGCCATGCTGCCATGCCTAGG 0: 1
1: 0
2: 6
3: 32
4: 314
922336176_922336179 -7 Left 922336176 1:224619779-224619801 CCCCAAAAAATGAATTGGGCGCT 0: 1
1: 0
2: 0
3: 12
4: 169
Right 922336179 1:224619795-224619817 GGGCGCTTAACAACATATAGCGG 0: 1
1: 0
2: 0
3: 3
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922336176 Original CRISPR AGCGCCCAATTCATTTTTTG GGG (reversed) Intronic
902945831 1:19837598-19837620 AGTTCCCAACTCATATTTTGAGG + Intergenic
903799721 1:25957656-25957678 AGAGCCCAATAGAATTTTTGAGG + Intergenic
905157113 1:35994244-35994266 CGGCCCCAGTTCATTTTTTGAGG + Intronic
907192546 1:52661378-52661400 AGGGCCCAAGTCATTTCTTGTGG - Intronic
907657403 1:56358165-56358187 AGCACCCAAGTCATTTCCTGGGG + Intergenic
908942886 1:69457337-69457359 AAAGCCCAAGACATTTTTTGAGG - Intergenic
911502011 1:98698730-98698752 ATGGCCCAATTCATATTCTGTGG + Exonic
913271402 1:117097109-117097131 AGCACTCAGTTAATTTTTTGAGG + Intronic
913479079 1:119267922-119267944 GGCCCTCAACTCATTTTTTGAGG - Intergenic
915885859 1:159719867-159719889 ACCTCCCACTTCAATTTTTGTGG - Intergenic
918818545 1:189223834-189223856 ATCTCTAAATTCATTTTTTGAGG - Intergenic
922336176 1:224619779-224619801 AGCGCCCAATTCATTTTTTGGGG - Intronic
922579869 1:226688853-226688875 AGAGTCCAAATCATTTTTTCTGG - Intronic
924129739 1:240894660-240894682 AGCTCTCATATCATTTTTTGCGG + Intronic
924161888 1:241241392-241241414 TGAGCCCAATTTATTTTTTAAGG - Intronic
1065268956 10:24006987-24007009 AGCGTCCAACTAATGTTTTGGGG + Intronic
1068178391 10:53491487-53491509 ACCACACAATTCATTTTTTATGG + Intergenic
1069103478 10:64353851-64353873 AGATCCAAATTCATTTTTTCTGG - Intergenic
1070056263 10:72937527-72937549 ACTGCCCAATTCATTTTATGAGG + Intronic
1070212804 10:74344187-74344209 ATCTCCCAATTCATGTTATGAGG - Intronic
1071562643 10:86655752-86655774 AGGGCCCAAGACAGTTTTTGAGG - Intronic
1072804065 10:98413247-98413269 AGGGCTGAATTTATTTTTTGTGG + Intronic
1073887689 10:108059325-108059347 AGAGCTCAATGTATTTTTTGAGG - Intergenic
1074408146 10:113198832-113198854 ACCTCCCAATTAATTTTATGAGG - Intergenic
1074760811 10:116666016-116666038 AGCTCCAAGGTCATTTTTTGTGG - Intronic
1076216198 10:128695509-128695531 ACCTCCCAATTCATTTTTGCAGG + Intergenic
1076254318 10:129009103-129009125 AGCTCCCAAGTCAATTTTTAAGG + Intergenic
1076703418 10:132286412-132286434 ACCGCTCAACTCATTTTGTGAGG + Intronic
1078768513 11:14323664-14323686 ACCCCCCAAGTCATTTTATGAGG + Intronic
1079612810 11:22454157-22454179 AGCACCCGAGACATTTTTTGTGG - Intergenic
1080754147 11:35179347-35179369 AGCCCACATCTCATTTTTTGAGG + Intronic
1086201351 11:84206377-84206399 ACATCCCAAGTCATTTTTTGAGG + Intronic
1087469573 11:98554749-98554771 ACTTCCCAATTCATTGTTTGAGG - Intergenic
1089907779 11:122062063-122062085 ACTTCCCAATTCATTTTATGAGG + Intergenic
1091175138 11:133550966-133550988 ACAGCCCAATTCATATTTTCTGG - Intergenic
1091534478 12:1392581-1392603 AGCTTCCAATTCATTTTAAGTGG + Intronic
1106431635 13:29686430-29686452 ACTACCCAATTCATTTTGTGAGG - Intergenic
1109417780 13:62066040-62066062 AGCACGCTATTCCTTTTTTGGGG + Intergenic
1109857633 13:68153936-68153958 ACCACCCAATTCACTTTTTGAGG + Intergenic
1116200603 14:41789950-41789972 AGTCCCCAATGCATTTTATGAGG - Intronic
1117569048 14:57027755-57027777 ATTTCCCAATTCATTTTATGAGG - Intergenic
1118567805 14:67161463-67161485 TCGGCCCAATTCAATTTTTGAGG - Intronic
1120774433 14:88417827-88417849 AGTGCCCAGTTTATTTTATGAGG - Intronic
1121551325 14:94804124-94804146 AACACCTAATTCATTTTATGGGG + Intergenic
1122084850 14:99292555-99292577 ACCTCCCAACTCATTTTATGAGG + Intergenic
1122367980 14:101207268-101207290 AGCTCCAAACTCATTTTATGAGG - Intergenic
1123955864 15:25333595-25333617 AGCTCCCAATTCATTCTGTCAGG + Intergenic
1124598009 15:31107062-31107084 ATTGCCCAACTCATTTTATGAGG - Intronic
1129309072 15:74692491-74692513 ACTTCCCAATTCATTTTATGAGG + Intronic
1129918918 15:79301828-79301850 ACCCCCCAGTTCATTTTATGAGG - Intergenic
1130413807 15:83671170-83671192 AGTACCCAATGCATTTTATGAGG - Intronic
1131448516 15:92519479-92519501 AGCTCCCCATAGATTTTTTGGGG + Intergenic
1131710602 15:95051260-95051282 AGCTTCCAATTCAGCTTTTGTGG + Intergenic
1136936936 16:34478230-34478252 ACTGCCCAATTTATTCTTTGGGG - Intergenic
1136962883 16:34870340-34870362 ACTGCCCAATTTATTCTTTGGGG + Intergenic
1139519628 16:67473503-67473525 TACGCCCAACTAATTTTTTGTGG + Intronic
1140267808 16:73435504-73435526 CTGGCCCAATTCATTCTTTGTGG + Intergenic
1142013224 16:87727741-87727763 AGAGCCAAACTCATTTTTTAAGG + Intronic
1143035715 17:3995749-3995771 ACTTCCCAATTCATTTTATGAGG - Intergenic
1143267348 17:5649908-5649930 AACCCCCAATTCAACTTTTGTGG + Intergenic
1143744604 17:8982798-8982820 AGTCCCCAACTCATTTTATGAGG + Intergenic
1144042499 17:11425283-11425305 AGAGCCCATTTCAATTTTAGTGG + Intronic
1148665400 17:49371024-49371046 AGCCCTCAATTCATCCTTTGGGG + Intronic
1149471646 17:56921361-56921383 ATTTCCCAATTCATTCTTTGAGG - Intergenic
1150156101 17:62854716-62854738 ATCCCCAAATTCATGTTTTGTGG - Intergenic
1150159456 17:62883408-62883430 AGTGACAAATTCATTTTCTGGGG + Intergenic
1150174638 17:63038528-63038550 TACTCCCAATTCATTTTATGAGG - Intronic
1153036652 18:769920-769942 ACTTCCCAATTCATTTTGTGAGG - Intronic
1156381950 18:36570528-36570550 ACTTCCCAATTCATTTTATGAGG + Intronic
1156430604 18:37069523-37069545 ATCTCCCAACTCATTTTATGAGG - Intronic
1157510876 18:48272815-48272837 AGTACCTAATTCATTTTTTATGG - Intronic
1159793442 18:72812908-72812930 AACTACCAATTCAATTTTTGAGG + Intronic
1159799472 18:72879705-72879727 AATGCCCAATACATTATTTGTGG + Intergenic
1160016530 18:75145559-75145581 ATTGCCCAACTCATTTTATGAGG - Intergenic
1163219353 19:15903313-15903335 ATTGCCTAATTCATTTTATGAGG + Intergenic
1164275788 19:23716672-23716694 CACGCCCAGTTAATTTTTTGTGG - Intergenic
1165551664 19:36591866-36591888 AGAGGACAGTTCATTTTTTGAGG + Intronic
1166381004 19:42355414-42355436 AGGGCCCAATTCACGTTTTGAGG + Intronic
925619693 2:5779893-5779915 AGCCCCCAATTCTTTTTTCATGG - Intergenic
927350327 2:22104940-22104962 AGCACTTAATTCATTTTGTGAGG + Intergenic
927824301 2:26297408-26297430 AGCAACCACTTCAATTTTTGAGG - Intergenic
931942469 2:67267651-67267673 AGCCCCCACTTGCTTTTTTGGGG - Intergenic
937688255 2:124722704-124722726 TGCCTCCAATTCATTTTCTGAGG - Intronic
938796261 2:134719803-134719825 AGCTCTTAATTCATTTTGTGCGG + Intergenic
939370010 2:141286471-141286493 ATATCCCAATTCATTTTATGAGG - Intronic
939648011 2:144724942-144724964 ACCTCCCAAATCATTTTGTGGGG + Intergenic
939913416 2:148010814-148010836 ATCTCCAAATTCATTTTATGAGG + Intronic
941947125 2:171111717-171111739 GGGGCCCAGTTCATTTTGTGAGG + Intronic
942028243 2:171932283-171932305 AGTTCCCAACTCATTTTATGAGG - Intronic
945173042 2:207016858-207016880 ACTGCCCAATTCATTTCATGAGG + Intergenic
945491489 2:210461008-210461030 AGTGCCCAATTCATAGTTGGTGG - Intronic
948436865 2:237959728-237959750 TGCGCCCAGCTAATTTTTTGTGG - Intergenic
948791608 2:240381065-240381087 ACCCCCCAGTTCATTTTATGAGG + Intergenic
1169484730 20:6019040-6019062 AGTCCCCAATTCATTTTATGAGG - Intronic
1169699992 20:8435460-8435482 AGGGCCCAGTTCCTTTTTTAAGG - Intronic
1171755615 20:29105492-29105514 ACCGCCCTAATAATTTTTTGTGG - Intergenic
1173067942 20:39731899-39731921 ACTCCCCAATTCATTTTATGAGG - Intergenic
1173905223 20:46623090-46623112 ACTTCCCAATTCATTTTATGAGG + Intronic
1177731497 21:25032701-25032723 AGCGCCAAAATTGTTTTTTGAGG - Intergenic
1179840101 21:44067006-44067028 ATTGCCCAAGTGATTTTTTGGGG + Intronic
1183761660 22:39825452-39825474 ACTTCCCAATTCATTTTATGAGG - Intronic
949919938 3:8992772-8992794 TGTGCCCATTTCATTTTGTGGGG + Intronic
951211564 3:19981135-19981157 TGTGCTAAATTCATTTTTTGAGG - Intronic
952000395 3:28778491-28778513 ACTTCCCAATTCATTTTATGAGG - Intergenic
953311350 3:41882963-41882985 AGGTCACAATTCATTTTTTTAGG + Intronic
955477529 3:59353464-59353486 AATTCCCAATTCATTTTCTGAGG - Intergenic
955845305 3:63156305-63156327 AGTGACCCATTCATTCTTTGTGG - Intergenic
955873693 3:63467392-63467414 AGCGACCAATTCAATTTTTTGGG + Intronic
960136081 3:114106723-114106745 AGCACTCAATTCATTTTATGAGG + Intergenic
961425519 3:126843373-126843395 AGTTCCCAACTCATTTTATGAGG - Intronic
961829946 3:129618289-129618311 AGCCCCCCATTCACATTTTGGGG - Intergenic
961924829 3:130467428-130467450 TGTTCCCAACTCATTTTTTGAGG + Intronic
964729485 3:159850113-159850135 AGCTTCCATTTCATTTCTTGAGG + Intronic
966802669 3:183778734-183778756 AGCTTCCACTTCATTTTATGAGG - Intronic
966992231 3:185244511-185244533 ACTTCCCAACTCATTTTTTGAGG - Intronic
967995420 3:195162595-195162617 AGCGCCCAGCTCCTGTTTTGTGG + Intronic
973128726 4:46622020-46622042 ACTTCCAAATTCATTTTTTGAGG - Intergenic
973548752 4:52009822-52009844 ATCTCCCAATTCATTTTATGAGG + Intronic
976322851 4:83735104-83735126 AGCAATCAATTCATATTTTGAGG + Intergenic
976843864 4:89464230-89464252 AAAGTCCAATTTATTTTTTGTGG - Intergenic
982426612 4:155270034-155270056 AATGCCCAACTCATTTTATGAGG - Intergenic
982671636 4:158327068-158327090 AACATCCAATTCATTTTATGAGG - Intronic
990441493 5:55850492-55850514 AGCATCCTATTCATATTTTGTGG + Intergenic
992324764 5:75649975-75649997 AGTGCTCAATATATTTTTTGTGG + Intronic
994727635 5:103454995-103455017 AGCTCCAAATTCACTCTTTGTGG + Intergenic
995029050 5:107459099-107459121 AGCCTCCAATTGATATTTTGAGG - Intronic
997051899 5:130392477-130392499 TCCTCCCAATTCATTTTATGAGG + Intergenic
998001977 5:138632591-138632613 GGCCCCTAATTCTTTTTTTGAGG - Intronic
1000209547 5:159097234-159097256 AGCGCCCACTGGATGTTTTGGGG - Intronic
1000395495 5:160770535-160770557 AGCTCCCAATTTATTTATTCAGG + Intronic
1000995030 5:167950172-167950194 AACTCCCAATTCATTTTATTTGG + Intronic
1005360421 6:25026323-25026345 AGAGCCAAGTTCATTATTTGAGG + Intronic
1011831653 6:91380015-91380037 ATCCCTCAATTCATTATTTGAGG + Intergenic
1016741103 6:147529785-147529807 AGTGCCCAATTCATTTTTATTGG - Intronic
1017151090 6:151281465-151281487 AGTGCCCACTTTATCTTTTGAGG + Intronic
1018672210 6:166189010-166189032 AGCAGCCATTTCATTATTTGGGG + Intergenic
1019584492 7:1790483-1790505 CACGCCCAGCTCATTTTTTGGGG - Intergenic
1021729715 7:23584690-23584712 TACGCCCAACTAATTTTTTGGGG + Intergenic
1021793583 7:24230366-24230388 AGGGCTTAATTCATTTTTTCTGG + Intergenic
1022638669 7:32161082-32161104 GCAGCCCAATTCATTTTTTATGG - Intronic
1025211827 7:57023796-57023818 AGAGAACACTTCATTTTTTGTGG - Intergenic
1025660128 7:63553032-63553054 AGAGAACACTTCATTTTTTGTGG + Intergenic
1025759649 7:64378018-64378040 AGGTCCAAATTCCTTTTTTGTGG - Intergenic
1027385753 7:77658183-77658205 AGAGCTCAAATCATTTGTTGGGG - Intergenic
1028739919 7:94262190-94262212 AGCACCCAATTCTGGTTTTGGGG + Intergenic
1031092483 7:117376431-117376453 ACATCCCAATTCATTTTGTGAGG + Intronic
1031235927 7:119176305-119176327 AGCTCCAAATTCATTTTTCATGG - Intergenic
1041832846 8:62176304-62176326 ACCGTCAAATTCATTTTGTGTGG + Intergenic
1043132523 8:76479463-76479485 AGCACACAATTGAATTTTTGGGG - Intergenic
1043134796 8:76507670-76507692 ATGTCCCAATTCATTTTATGAGG - Intergenic
1043319212 8:78961083-78961105 AGCCCTTAATTCATTTTTTATGG - Intergenic
1043659255 8:82715152-82715174 AGTTTCCAATTCATTTTATGAGG - Intergenic
1045594166 8:103633544-103633566 ACCTCCCAATTCATTTTGTGAGG - Intronic
1045665718 8:104482283-104482305 AGCTTCCAAGTCACTTTTTGGGG + Intergenic
1045802750 8:106120676-106120698 AGTTCCCAAGTCATTTTATGAGG + Intergenic
1048187757 8:132259136-132259158 ATCTCCCAACTCATTTTATGAGG + Intronic
1050641150 9:7668896-7668918 AACTCCCATTTCATGTTTTGTGG - Intergenic
1051694290 9:19751592-19751614 AGAAACCAAATCATTTTTTGGGG + Intronic
1052007206 9:23362505-23362527 ACCTCCCAATTAATCTTTTGAGG - Intergenic
1052267649 9:26592437-26592459 AGTTCCAAATTCATTTTATGAGG - Intergenic
1055311113 9:74981108-74981130 AGCTTCCAATTCAGCTTTTGTGG + Exonic
1057324793 9:94051468-94051490 ATCGCCCAATTCATTCTGTAAGG - Intronic
1057348284 9:94271891-94271913 ACTTCCCAATTCATTTTATGAGG - Intronic
1058092907 9:100825951-100825973 AGGGCCTAACTCATTTTATGAGG - Intergenic
1058582592 9:106474788-106474810 ACCCCCTAATTCATTTTATGAGG - Intergenic
1058599630 9:106655132-106655154 AGGGCCCAATTCATTTAATGTGG - Intergenic
1059206417 9:112471273-112471295 ATCCCCCAATTCATTTGTTGAGG + Exonic
1061378753 9:130241726-130241748 AGTGCCCACTTTATTCTTTGAGG + Intergenic
1062152140 9:135026078-135026100 ACTCCCCAACTCATTTTTTGAGG + Intergenic
1186480397 X:9892386-9892408 AGAGCCCAGTGTATTTTTTGGGG + Intronic
1187081463 X:15993694-15993716 ACCACCCAATTTATTTTGTGTGG - Intergenic
1188344579 X:29047874-29047896 AGTGCCCAATTCAGTTAATGAGG - Intronic
1188740658 X:33775629-33775651 ACTTCCAAATTCATTTTTTGAGG - Intergenic
1189521449 X:41773055-41773077 ATTCCCCAATTCATTTTATGAGG + Intronic
1190731422 X:53228567-53228589 CGCACCCCATTCATGTTTTGTGG + Intergenic
1191658313 X:63623698-63623720 TTCGCCCACTTCATTTTATGAGG - Intergenic
1194360392 X:92942431-92942453 AGAGGGAAATTCATTTTTTGGGG - Intergenic
1195806467 X:108776478-108776500 AAGGCCTAAGTCATTTTTTGTGG + Intergenic
1199225000 X:145363058-145363080 CACGCCCAACTAATTTTTTGTGG + Intergenic
1202265465 Y:23013258-23013280 AGGTCCAAATTCTTTTTTTGTGG - Intergenic
1202418458 Y:24647000-24647022 AGGTCCAAATTCTTTTTTTGTGG - Intergenic
1202452328 Y:25023086-25023108 AGGTCCAAATTCTTTTTTTGTGG + Intergenic