ID: 922338135

View in Genome Browser
Species Human (GRCh38)
Location 1:224634285-224634307
Sequence AAGAATAAGAAAAAAGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8158
Summary {0: 1, 1: 3, 2: 59, 3: 856, 4: 7239}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922338135 Original CRISPR AAGAATAAGAAAAAAGAGGC CGG Intronic
Too many off-targets to display for this crispr