ID: 922339392

View in Genome Browser
Species Human (GRCh38)
Location 1:224643477-224643499
Sequence GACCCACTCACTGTCCCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 199}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922339392_922339396 2 Left 922339392 1:224643477-224643499 CCTGGTGGGACAGTGAGTGGGTC 0: 1
1: 0
2: 2
3: 36
4: 199
Right 922339396 1:224643502-224643524 GAAGGCAAGGCCTGACGTGGTGG 0: 1
1: 0
2: 2
3: 46
4: 469
922339392_922339395 -1 Left 922339392 1:224643477-224643499 CCTGGTGGGACAGTGAGTGGGTC 0: 1
1: 0
2: 2
3: 36
4: 199
Right 922339395 1:224643499-224643521 CATGAAGGCAAGGCCTGACGTGG 0: 1
1: 0
2: 0
3: 5
4: 141
922339392_922339400 17 Left 922339392 1:224643477-224643499 CCTGGTGGGACAGTGAGTGGGTC 0: 1
1: 0
2: 2
3: 36
4: 199
Right 922339400 1:224643517-224643539 CGTGGTGGGTCTGGTGTGTGAGG 0: 1
1: 0
2: 1
3: 119
4: 694
922339392_922339397 3 Left 922339392 1:224643477-224643499 CCTGGTGGGACAGTGAGTGGGTC 0: 1
1: 0
2: 2
3: 36
4: 199
Right 922339397 1:224643503-224643525 AAGGCAAGGCCTGACGTGGTGGG 0: 1
1: 0
2: 1
3: 10
4: 109
922339392_922339398 8 Left 922339392 1:224643477-224643499 CCTGGTGGGACAGTGAGTGGGTC 0: 1
1: 0
2: 2
3: 36
4: 199
Right 922339398 1:224643508-224643530 AAGGCCTGACGTGGTGGGTCTGG 0: 1
1: 0
2: 3
3: 66
4: 445

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922339392 Original CRISPR GACCCACTCACTGTCCCACC AGG (reversed) Intronic
900905128 1:5551740-5551762 GACTCACTCACTGTAGCACTTGG - Intergenic
901232388 1:7648491-7648513 CACCCCCTCTCTCTCCCACCCGG - Intronic
901672374 1:10863384-10863406 GAGCCCCTCACTGTCCACCCGGG + Intergenic
901746087 1:11374692-11374714 GACTGACTCATTGTCCCCCCGGG + Intergenic
902417807 1:16251767-16251789 CCACCACACACTGTCCCACCTGG + Exonic
902901070 1:19516559-19516581 GATCCACTCACCCTCCCACCAGG + Intergenic
903278534 1:22236818-22236840 CACCCACGCACTGTCCTTCCTGG - Intergenic
903374425 1:22856926-22856948 AAGTCACTCACTGTCCAACCAGG + Intronic
905576679 1:39050169-39050191 GGCCCACTCCCTCTCCCAGCCGG + Intergenic
906694008 1:47811796-47811818 GACCCACTCTCTGGGCCACAGGG + Intronic
906908909 1:49925391-49925413 GACCCACAGCCTGTACCACCTGG - Intronic
908485156 1:64584453-64584475 TACCCAGTCACTTGCCCACCTGG + Intronic
910852634 1:91663770-91663792 GACCCACCCGGAGTCCCACCGGG - Intergenic
913303597 1:117399504-117399526 CACCCACTCACTGTGCAAGCAGG - Intronic
914227273 1:145731098-145731120 ACCCTGCTCACTGTCCCACCTGG - Intronic
916090957 1:161307318-161307340 GACCCACTCACTGGACCAGAAGG + Exonic
917931344 1:179824738-179824760 GAACCACTCACTCCCCCAACAGG + Intergenic
920386937 1:205576079-205576101 GCCCCACTCACTCTCCACCCTGG - Intronic
920717194 1:208351341-208351363 CACTCACTCACTGACTCACCTGG + Intergenic
920743429 1:208602804-208602826 GACACATTCACTTTCCCACCAGG - Intergenic
921432986 1:215083777-215083799 GCACCACTGCCTGTCCCACCAGG - Intronic
921937782 1:220810647-220810669 GACACACTCACTCCCCCACCAGG - Intronic
922339392 1:224643477-224643499 GACCCACTCACTGTCCCACCAGG - Intronic
922724314 1:227915357-227915379 GACTCACTCCCTGCCCCACCTGG - Intergenic
1068395627 10:56457333-56457355 GACCCAATGACTGGCCCATCTGG + Intergenic
1068671473 10:59727780-59727802 GACCCACCCAGAGTCCCACCAGG - Intronic
1071266390 10:83968439-83968461 GGCCCACTCAGTGTCACAGCCGG - Intergenic
1072629373 10:97134883-97134905 AACCCACTCACTGTGCAACCTGG + Intronic
1076182311 10:128419666-128419688 GCCCAACTAACTGGCCCACCTGG - Intergenic
1079553422 11:21729842-21729864 GACCCACCCAGTGACCCAGCAGG - Intergenic
1083081905 11:60102698-60102720 GACCCATCCAGAGTCCCACCGGG - Intergenic
1083197508 11:61097508-61097530 GACCCACCCGGAGTCCCACCAGG + Intergenic
1083755758 11:64790732-64790754 GACCCAGTCACTGTGTGACCTGG + Intronic
1084055155 11:66627162-66627184 TACCAACTGACTGTCCCAACAGG - Exonic
1085033054 11:73284176-73284198 GACCCTGTCACTGCCCCACTTGG - Intronic
1085240069 11:75045804-75045826 GGCCCACCCAGAGTCCCACCAGG + Intergenic
1086009466 11:82082302-82082324 CACCTACTCACTGTGCAACCCGG - Intergenic
1086973128 11:93104846-93104868 GACCCACCCGGAGTCCCACCAGG - Intergenic
1089697579 11:120225597-120225619 GACCTTCCCACTGGCCCACCGGG - Intronic
1090507122 11:127328099-127328121 GATCCAATCACCCTCCCACCAGG - Intergenic
1090719250 11:129457295-129457317 CCCCCACTCTCTCTCCCACCCGG + Intergenic
1091814173 12:3423695-3423717 GACCCACCCAGAGTCCCACTGGG - Intronic
1092105005 12:5915009-5915031 CACCCACTCGCAGTCCCGCCAGG + Intronic
1093027553 12:14258663-14258685 CACACACACAGTGTCCCACCAGG - Intergenic
1096757785 12:53814604-53814626 GACCCTGTAACTGTCCCTCCAGG + Intergenic
1096800067 12:54104532-54104554 GACCCAATCCCTGCCCCATCAGG - Intergenic
1100164378 12:91900073-91900095 GATCCAATCCCTGTCCCACCAGG - Intergenic
1101028185 12:100634366-100634388 GATCCACCCAGAGTCCCACCGGG - Intergenic
1101970795 12:109310406-109310428 GACCCACTCACTGCCGCTCGGGG - Intergenic
1102752629 12:115308902-115308924 AAACCAATGACTGTCCCACCAGG - Intergenic
1104554442 12:129787028-129787050 GACCCTCTCACTGCACCAGCGGG - Intronic
1104568435 12:129904419-129904441 GAGCCACCCACTCTCCCAACAGG + Intergenic
1104627521 12:130370786-130370808 GACCCACTCGCTGCCCCCACAGG + Intronic
1104804317 12:131575363-131575385 GAACCACTGTCTGTCCCAGCTGG - Intergenic
1107987800 13:45790739-45790761 GTGCCAGCCACTGTCCCACCTGG + Intronic
1109803325 13:67404574-67404596 GACCCACCCGGAGTCCCACCGGG + Intergenic
1110718829 13:78738555-78738577 GATCCTCCCACTGTACCACCAGG - Intergenic
1112285488 13:98100410-98100432 CACCCACCCACTCACCCACCAGG - Intergenic
1113067179 13:106384471-106384493 GACCTACTCAGTGACCCACGGGG - Intergenic
1115404940 14:33004515-33004537 CACTCACTCACTGACTCACCTGG - Intronic
1116240727 14:42339063-42339085 GACCCACCCGGAGTCCCACCGGG - Intergenic
1117295937 14:54378855-54378877 GACCCACTCACTGGATCACCTGG + Intergenic
1117493843 14:56281061-56281083 CACCAATTCACAGTCCCACCAGG - Intronic
1119432643 14:74578503-74578525 GACACACACACTGGGCCACCAGG + Intronic
1123118799 14:105907579-105907601 GACAGACCCACAGTCCCACCTGG - Intergenic
1125533398 15:40428604-40428626 GCCCCATTCACTGGCCCTCCAGG + Intronic
1126065731 15:44824961-44824983 GACCCAGCCTCTGTCCCAGCTGG - Intergenic
1126094104 15:45075606-45075628 GACCCAGCCTCTGTCCCAGCTGG + Exonic
1126431429 15:48589304-48589326 CTCCCACTCACTGTCCCTCTCGG - Intronic
1128850862 15:70954734-70954756 GACCCAGTCCCAGTCCCACAGGG - Intronic
1129333831 15:74840900-74840922 CACCCTCTCACTGTCCCCCCAGG + Intronic
1129585477 15:76859276-76859298 GACACCCTCACTGTTCCACCAGG + Intronic
1131372562 15:91894849-91894871 TACGCACTCCCTGTCCCTCCGGG - Intronic
1131468186 15:92672603-92672625 GACCCAGGCACTGCCCCACCTGG + Intronic
1133332169 16:4981584-4981606 GAGCCAGGCACTGTCCCCCCGGG - Intronic
1134234732 16:12456558-12456580 TACTCACACACTGCCCCACCAGG - Intronic
1136289067 16:29260734-29260756 GACTCTCCCACTCTCCCACCAGG + Intergenic
1139515714 16:67451260-67451282 GCCCGACTCATGGTCCCACCCGG - Intronic
1140240961 16:73199769-73199791 CACCCTCTCACTGTAGCACCTGG - Intergenic
1142094798 16:88233661-88233683 GACTCTCCCACTCTCCCACCAGG + Intergenic
1143791413 17:9298986-9299008 GATGCACTCACCTTCCCACCTGG + Intronic
1145788435 17:27609318-27609340 GACCAACTCACCGTCCCTCTCGG - Exonic
1145797463 17:27664130-27664152 CACCCAGTAGCTGTCCCACCTGG - Intergenic
1146764495 17:35507027-35507049 GACCCACCCAGAGTCCCACCAGG + Intronic
1147328627 17:39683241-39683263 GACCCTCCCTCTCTCCCACCTGG + Intronic
1150272673 17:63876682-63876704 GACCCACTTCCATTCCCACCTGG - Intronic
1151194458 17:72421649-72421671 GGCCCACTCACTGTCCCAAGAGG + Intergenic
1153777054 18:8463503-8463525 CACCCACTCCCTGTCCCATCTGG - Intergenic
1157347618 18:46853861-46853883 GACAAACTAAATGTCCCACCCGG + Intronic
1157619549 18:49008476-49008498 GTCCCTCTCCCTGCCCCACCTGG + Intergenic
1158292426 18:55956641-55956663 GACCCACCCAGAGTCCCACCGGG + Intergenic
1160727856 19:625457-625479 GAACCTCCCACAGTCCCACCTGG - Intronic
1161465643 19:4428848-4428870 GACCCACGCACGTTTCCACCCGG + Exonic
1161520018 19:4718644-4718666 CACACACTTAATGTCCCACCTGG - Intronic
1162251338 19:9446282-9446304 GTCCCACTGAATGTCCCACCTGG - Intergenic
1162444374 19:10713206-10713228 ATCCCACCCTCTGTCCCACCTGG + Exonic
1163703920 19:18801324-18801346 GACCCCCCCACTTCCCCACCAGG + Intergenic
1163942878 19:20511190-20511212 GACCCACCCAGAGTCCCACCAGG - Intergenic
1164216575 19:23155841-23155863 GACCCACCCGGAGTCCCACCAGG - Intergenic
1164845831 19:31432010-31432032 CACCCAGTGACTGTCCCTCCAGG + Intergenic
1164939692 19:32243140-32243162 GTCCCACTCACTGTCACCCTTGG - Intergenic
1165699086 19:37923561-37923583 CACTCACTCACTGACTCACCTGG - Intronic
1166410360 19:42552574-42552596 GCCCCTCTCTGTGTCCCACCAGG + Intronic
1167521850 19:49960052-49960074 GAGCCACTCACTGTCCCGCTGGG + Intronic
1167523533 19:49970670-49970692 GAGCCACTCACTGTCCTGCTGGG - Intergenic
1167756532 19:51416581-51416603 GAGCCGCTCACTGTCCCACTGGG + Intronic
1168137603 19:54361657-54361679 GTCCCACACTCAGTCCCACCCGG - Intronic
1168160466 19:54507421-54507443 GTCCCACACTCAGTCCCACCCGG + Intronic
1168369363 19:55819255-55819277 GACCCACACACTGTAGCCCCTGG + Intronic
926296219 2:11570921-11570943 GCCCCACTTCCTGTCTCACCTGG + Intronic
926491112 2:13527276-13527298 GACCCACCCAGAGTCCCACCGGG - Intergenic
926762551 2:16291782-16291804 AACCCAGTCACTTTCACACCTGG - Intergenic
927228550 2:20796338-20796360 AACCCACCCACTTCCCCACCTGG - Intronic
928128600 2:28632868-28632890 GCCCCACTCACTCTCCCAGCAGG - Intronic
928377488 2:30787485-30787507 GGCTCACTGACTGTGCCACCAGG - Intronic
931182981 2:59921952-59921974 GACCCATTCACTGACCCTCTAGG - Intergenic
935721154 2:105980416-105980438 GACCCACCCGGAGTCCCACCAGG - Intergenic
935970910 2:108530120-108530142 GACCCACCCGGAGTCCCACCGGG + Intergenic
936419226 2:112347451-112347473 GACCCACCCAGAGTCCCACCGGG - Intergenic
938222553 2:129582699-129582721 GACCCAAACACCTTCCCACCAGG + Intergenic
940317095 2:152336579-152336601 GGCCCAGACACTGTCCCAGCAGG - Intronic
943509755 2:188810000-188810022 GACTCAATTACTGTGCCACCTGG + Intergenic
945102405 2:206274567-206274589 CACTCACTCACTCTCCCACCCGG - Intergenic
948455290 2:238101908-238101930 CCCCCACTCACTGACCTACCCGG + Intronic
948689218 2:239691435-239691457 GACCAACACACTGTCCCTGCTGG - Intergenic
948750907 2:240132406-240132428 AAAGCACTCACTGTCCCATCAGG - Intronic
948811395 2:240480286-240480308 GACCCACTCCCGTCCCCACCAGG + Intronic
1172186699 20:33035499-33035521 TCCCCAGTCCCTGTCCCACCAGG + Intronic
1172319136 20:33982665-33982687 GCCCCACTTACTGACCCACAGGG - Intergenic
1172996006 20:39071033-39071055 GAACCAGTCACTGGCCCAGCAGG + Intergenic
1175071346 20:56336589-56336611 GCTGCACTCACTGTCCAACCAGG - Intergenic
1178876138 21:36415581-36415603 AACCCACTCCCTGGCTCACCAGG - Intronic
1179670567 21:42944073-42944095 GACCCACCCGGAGTCCCACCAGG - Intergenic
1179791083 21:43756347-43756369 CACCCACTCACCCTCCCACAGGG - Exonic
1179926666 21:44538694-44538716 GTCCCACCCACTCTCTCACCTGG - Intronic
1179932379 21:44579171-44579193 GTCCCACCCACTGTCCCACCTGG - Intronic
1179937242 21:44613470-44613492 AACCCACCCACTGTCCCACCTGG + Intronic
1180595229 22:16968584-16968606 TACCCACACAGTGTCCCTCCTGG + Intronic
1181132208 22:20738635-20738657 CACCCACTCACACTCACACCTGG - Intronic
1182041435 22:27241744-27241766 GAACCCCTGACTGTCCCATCAGG + Intergenic
1184220040 22:43094269-43094291 GCCCCACTCACACTGCCACCAGG + Intergenic
1184265019 22:43342251-43342273 GACCCCCCCACCCTCCCACCCGG - Intronic
1185101014 22:48840834-48840856 GACTCACTCACTCACCCACACGG - Intronic
949612309 3:5715405-5715427 TACCCCCACAGTGTCCCACCAGG + Intergenic
952532502 3:34276672-34276694 GACCCTCACACTGTGCTACCTGG + Intergenic
954517958 3:51197217-51197239 GACACTATCACTGGCCCACCTGG - Intronic
959593151 3:108101096-108101118 GACCCACTGAATTTGCCACCTGG - Intergenic
961545468 3:127629796-127629818 GACACACTCACACTCCCTCCCGG - Intronic
962277381 3:134026304-134026326 GACCCACCCGGAGTCCCACCGGG + Intronic
964704153 3:159601015-159601037 GACCCAAAGACTGGCCCACCTGG - Intronic
964932678 3:162045854-162045876 GACCCACCCAGAGACCCACCCGG - Intergenic
966876204 3:184323230-184323252 GCCCCACTCACCGGCCCACGGGG - Exonic
966928309 3:184659765-184659787 GACACACTGCCTGTCCCTCCCGG - Intronic
967943975 3:194787531-194787553 GTCCCACTCCCTGTCACTCCTGG - Intergenic
968908436 4:3464889-3464911 GACTCACAGATTGTCCCACCTGG - Intronic
969456371 4:7302024-7302046 TACCCACCCACTGCCCAACCAGG - Intronic
970539238 4:17060696-17060718 GATTCACTCACTGTTCCACATGG + Intergenic
972990896 4:44821622-44821644 GACCCACCCGGAGTCCCACCGGG - Intergenic
975090569 4:70397754-70397776 GATCCAATCACTGTCCTAGCAGG - Intergenic
975161332 4:71128150-71128172 AATCCACTCACAGTTCCACCTGG + Intergenic
975205992 4:71644650-71644672 GACCCACCCAGAGTCCCACCGGG + Intergenic
975943610 4:79677872-79677894 AACACACACATTGTCCCACCAGG + Intergenic
977043222 4:92039756-92039778 GACGCACTCAGAGTCCCACTGGG - Intergenic
977319791 4:95499264-95499286 GACCTGGTCACTGTCCCATCAGG + Intronic
981527485 4:145720775-145720797 GACCCCTCCACTGTCCCACAGGG - Intronic
981998954 4:151004452-151004474 AAATCACTCTCTGTCCCACCAGG - Intronic
985590530 5:762174-762196 CAGCCACTCACAGTCCCAGCCGG + Intronic
986199947 5:5571143-5571165 CACCCACTCACTGTGGGACCCGG + Intergenic
987675197 5:21064510-21064532 GATCAACTCACAGTTCCACCTGG - Intergenic
989037601 5:37192005-37192027 CACCCACTCACTGACTCCCCTGG + Intronic
993733073 5:91445564-91445586 GACCGATTCACTGTCTCCCCTGG - Intergenic
995474162 5:112531309-112531331 GACCCACCCGGAGTCCCACCGGG + Intergenic
996396916 5:123022574-123022596 GACCCACTCTGTTTCCAACCTGG + Intronic
997955328 5:138274535-138274557 GACGCACACACTCTCCCACCAGG + Exonic
998047308 5:138998750-138998772 GATCCAATTACTCTCCCACCAGG + Intronic
999250723 5:150180672-150180694 GACCCGCACACGCTCCCACCAGG - Intronic
999510445 5:152245137-152245159 GACCCTTCCACTGGCCCACCTGG - Intergenic
1000339033 5:160262829-160262851 GCCCCACTCACAGTCCCAGGAGG - Intronic
1000803357 5:165757302-165757324 GAGTCTCTCACTGTCTCACCAGG + Intergenic
1002040114 5:176507253-176507275 GACCCATCCATTGTCCCAGCTGG + Exonic
1003178928 6:3775578-3775600 GACCCCCTCACTGACACGCCAGG - Intergenic
1003293839 6:4806168-4806190 GACCCACCGGCTGTGCCACCTGG + Intronic
1005462264 6:26080403-26080425 GACCCACCCAGAGTCCCACCGGG + Intergenic
1006517744 6:34554093-34554115 GACCCGCCCACGGTCCCACATGG + Intronic
1006739057 6:36294369-36294391 GACCCACGCATTGTTCCCCCCGG + Exonic
1007124542 6:39414563-39414585 GCCCCACTCACTGCCACAACTGG + Intronic
1008877401 6:56344686-56344708 GACCCAGTCACCTCCCCACCAGG - Intronic
1010370544 6:75101988-75102010 GACCAACTCACTGTTCGGCCTGG + Exonic
1014546559 6:122742830-122742852 GACCCACCCAGAGTCCCACCAGG - Intergenic
1016261311 6:142174060-142174082 ATCCCACACACAGTCCCACCTGG + Intronic
1018934059 6:168261652-168261674 GCCTCACTCGCTGTCCCACAGGG - Intergenic
1020043502 7:5022196-5022218 GACCCACGCAGAGTCCCACCGGG - Intronic
1020143303 7:5624179-5624201 GGCCTCCTCACTGTCCCACGGGG - Intronic
1022511411 7:30937081-30937103 CACACATGCACTGTCCCACCTGG - Intergenic
1034157674 7:148968816-148968838 GATCCAATCACCGCCCCACCAGG - Intergenic
1034443146 7:151097759-151097781 GACCCAAACACCCTCCCACCAGG + Intronic
1035074489 7:156169098-156169120 ACCCCACCCACTGTCCCCCCAGG - Intergenic
1038983661 8:32785930-32785952 CATCCACTCACTGTTCCACTGGG - Intergenic
1039645054 8:39272659-39272681 CACTCACTCACTGACTCACCCGG - Intronic
1041515794 8:58697529-58697551 GACCCACCCGGAGTCCCACCGGG + Intergenic
1041956883 8:63566074-63566096 TAGCCACACACTGTCCCATCAGG - Intergenic
1048251832 8:132872626-132872648 CACTCACTCACTGACTCACCCGG + Intronic
1048306154 8:133286060-133286082 GGGGCTCTCACTGTCCCACCAGG + Intronic
1049062272 8:140285777-140285799 GACCCACTCACTCTCCCCGCTGG + Intronic
1049211387 8:141387965-141387987 AACCCTCTCACTGTCCCAGCTGG - Intergenic
1049613147 8:143565105-143565127 GACCAGCCCACTGTGCCACCTGG + Intergenic
1052508412 9:29383340-29383362 GACCCACCCAGAGTCCCACAGGG + Intergenic
1053877842 9:42561877-42561899 GCCCCACTCAATGTCCCCACTGG + Intergenic
1054233853 9:62539817-62539839 GCCCCACTCAATGTCCCCACTGG - Intergenic
1057930565 9:99189548-99189570 GACCCACCCACAGTCCCTACTGG + Intergenic
1059708342 9:116844305-116844327 GACCCAGAAACCGTCCCACCTGG - Intronic
1060529133 9:124338003-124338025 GTCTCACTCACTCTCTCACCTGG + Intronic
1061003248 9:127914645-127914667 GGCCCACTCACCTTCCCATCTGG + Exonic
1061374154 9:130214278-130214300 GGCCCACCCACTCTCCCGCCAGG - Intronic
1061550540 9:131331983-131332005 GACCCAGTCACTGTCCCCAGGGG + Intergenic
1062341175 9:136094653-136094675 GACCCACGAACGGGCCCACCTGG + Intronic
1062391261 9:136334840-136334862 GCCCCACTCACTGCTCCAGCAGG - Intronic
1185910302 X:3974846-3974868 GACCCACCCAGAGTCCCACCGGG + Intergenic
1190270614 X:48860457-48860479 GACCCACCCAGAGTCCCACCGGG + Intergenic
1190336429 X:49265543-49265565 GACCCAGCCACTGTCCCACTGGG + Intergenic
1191639553 X:63415392-63415414 GACCCACCCAGAGTCCCACCAGG + Intergenic
1191917629 X:66219869-66219891 AACCCACCCAGAGTCCCACCGGG - Intronic
1192707087 X:73537850-73537872 GACCCACTCAGGGACCCAGCAGG + Intergenic
1193717668 X:84951143-84951165 GACCCACCCAGAGTCCCACCAGG + Intergenic
1195840162 X:109167680-109167702 GGCCCAAAGACTGTCCCACCTGG - Intergenic
1196422679 X:115539055-115539077 GACCCACCCGGAGTCCCACCGGG - Intergenic
1197941607 X:131795844-131795866 GACCTACACACTGGCCCACAAGG - Intergenic
1199484884 X:148336984-148337006 TACCCCCTCATTGTGCCACCTGG - Intergenic
1200943686 Y:8810376-8810398 GACCCACCCAGAGTCCCACAGGG + Intergenic
1201259817 Y:12148015-12148037 GACCCACCCAGAGTCCCACCAGG - Intergenic
1202109138 Y:21403702-21403724 GACAGCCTCACTGCCCCACCTGG + Intergenic
1202120136 Y:21512417-21512439 GACAGCCTCACTGCCCCACCTGG - Intronic
1202122587 Y:21535958-21535980 GACAGCCTCACTGCCCCACCTGG - Intronic
1202156418 Y:21893425-21893447 GACAGCCTCACTGCCCCACCTGG + Intronic
1202158866 Y:21916966-21916988 GACAGCCTCACTGCCCCACCTGG + Intronic
1202185317 Y:22181881-22181903 GACAGCCTCACTGCCCCACCTGG + Intronic
1202197547 Y:22309904-22309926 GACAGCCTCACTGCCCCACCTGG - Intronic
1202206043 Y:22404514-22404536 GACAGCCTCACTGCCCCACCTGG - Intronic